contestId int64 0 1.01k | index stringclasses 57
values | name stringlengths 2 58 | type stringclasses 2
values | rating int64 0 3.5k | tags listlengths 0 11 | title stringclasses 522
values | time-limit stringclasses 8
values | memory-limit stringclasses 8
values | problem-description stringlengths 0 7.15k | input-specification stringlengths 0 2.05k | output-specification stringlengths 0 1.5k | demo-input listlengths 0 7 | demo-output listlengths 0 7 | note stringlengths 0 5.24k | points float64 0 425k | test_cases listlengths 0 402 | creationTimeSeconds int64 1.37B 1.7B | relativeTimeSeconds int64 8 2.15B | programmingLanguage stringclasses 3
values | verdict stringclasses 14
values | testset stringclasses 12
values | passedTestCount int64 0 1k | timeConsumedMillis int64 0 15k | memoryConsumedBytes int64 0 805M | code stringlengths 3 65.5k | prompt stringlengths 262 8.2k | response stringlengths 17 65.5k | score float64 -1 3.99 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
938 | C | Constructing Tests | PROGRAMMING | 1,700 | [
"binary search",
"brute force",
"constructive algorithms"
] | null | null | Let's denote a *m*-free matrix as a binary (that is, consisting of only 1's and 0's) matrix such that every square submatrix of size *m*<=×<=*m* of this matrix contains at least one zero.
Consider the following problem:
You are given two integers *n* and *m*. You have to construct an *m*-free square matrix of size *... | The first line contains one integer *t* (1<=≤<=*t*<=≤<=100) — the number of tests you have to construct.
Then *t* lines follow, *i*-th line containing one integer *x**i* (0<=≤<=*x**i*<=≤<=109).
Note that in hacks you have to set *t*<==<=1. | For each test you have to construct, output two positive numbers *n**i* and *m**i* (1<=≤<=*m**i*<=≤<=*n**i*<=≤<=109) such that the maximum number of 1's in a *m**i*-free *n**i*<=×<=*n**i* matrix is exactly *x**i*. If there are multiple solutions, you may output any of them; and if this is impossible to construct a test... | [
"3\n21\n0\n1\n"
] | [
"5 2\n1 1\n-1\n"
] | none | 0 | [
{
"input": "3\n21\n0\n1",
"output": "5 2\n1 1\n-1"
},
{
"input": "1\n420441920",
"output": "-1"
},
{
"input": "1\n4",
"output": "-1"
},
{
"input": "1\n297540",
"output": "546 22"
},
{
"input": "1\n9",
"output": "-1"
},
{
"input": "1\n144",
"output"... | 1,632,669,949 | 1,549 | PyPy 3 | WRONG_ANSWER | TESTS | 0 | 46 | 0 | def make_divisors(n):
divisors = []
for i in range(1, int(n**0.5)+1):
if n % i == 0:
divisors.append(i)
if i != n // i:
divisors.append(n//i)
#divisors.sort(reverse=True)
return divisors
t = int(input())
for i in range(t):
x = int(input(... | Title: Constructing Tests
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Let's denote a *m*-free matrix as a binary (that is, consisting of only 1's and 0's) matrix such that every square submatrix of size *m*<=×<=*m* of this matrix contains at least one zero.
Consider the following pro... | ```python
def make_divisors(n):
divisors = []
for i in range(1, int(n**0.5)+1):
if n % i == 0:
divisors.append(i)
if i != n // i:
divisors.append(n//i)
#divisors.sort(reverse=True)
return divisors
t = int(input())
for i in range(t):
x = ... | 0 | |
35 | A | Shell Game | PROGRAMMING | 1,000 | [
"implementation"
] | A. Shell Game | 2 | 64 | Today the «Z» city residents enjoy a shell game competition. The residents are gathered on the main square to watch the breath-taking performance. The performer puts 3 non-transparent cups upside down in a row. Then he openly puts a small ball under one of the cups and starts to shuffle the cups around very quickly so ... | The first input line contains an integer from 1 to 3 — index of the cup which covers the ball before the shuffles. The following three lines describe the shuffles. Each description of a shuffle contains two distinct integers from 1 to 3 — indexes of the cups which the performer shuffled this time. The cups are numbered... | In the first line output an integer from 1 to 3 — index of the cup which will have the ball after all the shuffles. | [
"1\n1 2\n2 1\n2 1\n",
"1\n2 1\n3 1\n1 3\n"
] | [
"2\n",
"2\n"
] | none | 500 | [
{
"input": "1\n1 2\n2 1\n2 1",
"output": "2"
},
{
"input": "1\n2 1\n3 1\n1 3",
"output": "2"
},
{
"input": "3\n3 1\n2 1\n1 2",
"output": "1"
},
{
"input": "1\n1 3\n1 2\n2 3",
"output": "2"
},
{
"input": "3\n3 2\n3 1\n3 1",
"output": "2"
},
{
"input": "... | 1,591,380,959 | 2,147,483,647 | PyPy 3 | RUNTIME_ERROR | TESTS | 0 | 372 | 2,150,400 | n=int(input())
a1,b1=map(int,input().split())
if a1==n:
n=b1
if b1==n:
n=a1
a2,b2=map(int,input().split())
if a2==n:
n=b2
if b2==n:
n=a2
a3,b3=map(int,input().split())
if a3==n:
n=b3
if b3==n:
n=a3
print(n) | Title: Shell Game
Time Limit: 2 seconds
Memory Limit: 64 megabytes
Problem Description:
Today the «Z» city residents enjoy a shell game competition. The residents are gathered on the main square to watch the breath-taking performance. The performer puts 3 non-transparent cups upside down in a row. Then he openly put... | ```python
n=int(input())
a1,b1=map(int,input().split())
if a1==n:
n=b1
if b1==n:
n=a1
a2,b2=map(int,input().split())
if a2==n:
n=b2
if b2==n:
n=a2
a3,b3=map(int,input().split())
if a3==n:
n=b3
if b3==n:
n=a3
print(n)
``` | -1 |
546 | A | Soldier and Bananas | PROGRAMMING | 800 | [
"brute force",
"implementation",
"math"
] | null | null | A soldier wants to buy *w* bananas in the shop. He has to pay *k* dollars for the first banana, 2*k* dollars for the second one and so on (in other words, he has to pay *i*·*k* dollars for the *i*-th banana).
He has *n* dollars. How many dollars does he have to borrow from his friend soldier to buy *w* bananas? | The first line contains three positive integers *k*,<=*n*,<=*w* (1<=<=≤<=<=*k*,<=*w*<=<=≤<=<=1000, 0<=≤<=*n*<=≤<=109), the cost of the first banana, initial number of dollars the soldier has and number of bananas he wants. | Output one integer — the amount of dollars that the soldier must borrow from his friend. If he doesn't have to borrow money, output 0. | [
"3 17 4\n"
] | [
"13"
] | none | 500 | [
{
"input": "3 17 4",
"output": "13"
},
{
"input": "1 2 1",
"output": "0"
},
{
"input": "1 1 1",
"output": "0"
},
{
"input": "1 5 6",
"output": "16"
},
{
"input": "1 1000000000 1",
"output": "0"
},
{
"input": "1000 0 1000",
"output": "500500000"
}... | 1,697,113,230 | 2,147,483,647 | PyPy 3 | COMPILATION_ERROR | TESTS | 0 | 0 | 0 | /**
* author: Ratem
* created: 12.10.2023 12:58:39
**/
#include <bits/stdc++.h>
using namespace std;
typedef long long ll;
#ifdef LOCAL
#include "algo/debug.h"
#else
#define debug(...) 42
#endif
int main()
{
ll k, n, w;
cin >> k >> n >> w;
for (int i = 1; i <= w; i++)
n -... | Title: Soldier and Bananas
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A soldier wants to buy *w* bananas in the shop. He has to pay *k* dollars for the first banana, 2*k* dollars for the second one and so on (in other words, he has to pay *i*·*k* dollars for the *i*-th banana).
He h... | ```python
/**
* author: Ratem
* created: 12.10.2023 12:58:39
**/
#include <bits/stdc++.h>
using namespace std;
typedef long long ll;
#ifdef LOCAL
#include "algo/debug.h"
#else
#define debug(...) 42
#endif
int main()
{
ll k, n, w;
cin >> k >> n >> w;
for (int i = 1; i <= w; i++)... | -1 | |
25 | A | IQ test | PROGRAMMING | 1,300 | [
"brute force"
] | A. IQ test | 2 | 256 | Bob is preparing to pass IQ test. The most frequent task in this test is to find out which one of the given *n* numbers differs from the others. Bob observed that one number usually differs from the others in evenness. Help Bob — to check his answers, he needs a program that among the given *n* numbers finds one that i... | The first line contains integer *n* (3<=≤<=*n*<=≤<=100) — amount of numbers in the task. The second line contains *n* space-separated natural numbers, not exceeding 100. It is guaranteed, that exactly one of these numbers differs from the others in evenness. | Output index of number that differs from the others in evenness. Numbers are numbered from 1 in the input order. | [
"5\n2 4 7 8 10\n",
"4\n1 2 1 1\n"
] | [
"3\n",
"2\n"
] | none | 0 | [
{
"input": "5\n2 4 7 8 10",
"output": "3"
},
{
"input": "4\n1 2 1 1",
"output": "2"
},
{
"input": "3\n1 2 2",
"output": "1"
},
{
"input": "3\n100 99 100",
"output": "2"
},
{
"input": "3\n5 3 2",
"output": "3"
},
{
"input": "4\n43 28 1 91",
"output"... | 1,659,518,362 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 9 | 92 | 0 | n = int(input())
d = list(map(int, input().split()))
k = (d[0] % 2 + d[1] % 2 + d[2] % 2) % 2
for i in range(n):
if d[i] % 2 == k:
print(i + 1)
break
| Title: IQ test
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Bob is preparing to pass IQ test. The most frequent task in this test is to find out which one of the given *n* numbers differs from the others. Bob observed that one number usually differs from the others in evenness. Help Bob — t... | ```python
n = int(input())
d = list(map(int, input().split()))
k = (d[0] % 2 + d[1] % 2 + d[2] % 2) % 2
for i in range(n):
if d[i] % 2 == k:
print(i + 1)
break
``` | 0 |
793 | B | Igor and his way to work | PROGRAMMING | 1,600 | [
"dfs and similar",
"graphs",
"implementation",
"shortest paths"
] | null | null | Woken up by the alarm clock Igor the financial analyst hurried up to the work. He ate his breakfast and sat in his car. Sadly, when he opened his GPS navigator, he found that some of the roads in Bankopolis, the city where he lives, are closed due to road works. Moreover, Igor has some problems with the steering wheel,... | The first line contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=1000) — the number of rows and the number of columns in the grid.
Each of the next *n* lines contains *m* characters denoting the corresponding row of the grid. The following characters can occur:
- "." — an empty cell; - "*" — a cell with road ... | In the only line print "YES" if there is a path between Igor's home and Igor's office with no more than two turns, and "NO" otherwise. | [
"5 5\n..S..\n****.\nT....\n****.\n.....\n",
"5 5\nS....\n****.\n.....\n.****\n..T..\n"
] | [
"YES",
"NO"
] | The first sample is shown on the following picture:
In the second sample it is impossible to reach Igor's office using less that 4 turns, thus there exists no path using no more than 2 turns. The path using exactly 4 turns is shown on this picture: | 1,000 | [
{
"input": "5 5\nS....\n****.\n.....\n.****\n..T..",
"output": "NO"
},
{
"input": "1 2\nST",
"output": "YES"
},
{
"input": "3 1\nS\n*\nT",
"output": "NO"
},
{
"input": "3 3\n*..\n...\nTS.",
"output": "YES"
},
{
"input": "3 3\nT.*\n*.*\n*S*",
"output": "YES"
... | 1,496,028,031 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 8 | 280 | 5,836,800 | def maze(a , r , c , t ,dir ,lastDir ,turnCount):
if r==t[0] and c==t[1]:
return True
if r==-1 or r>n-1 or c>m-1 or c==-1:
return False
if dir not in lastDir and lastDir is not "0":
turnCount+=1
if turnCount>2:
return False
if a[r][c] is "*":
... | Title: Igor and his way to work
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Woken up by the alarm clock Igor the financial analyst hurried up to the work. He ate his breakfast and sat in his car. Sadly, when he opened his GPS navigator, he found that some of the roads in Bankopolis, th... | ```python
def maze(a , r , c , t ,dir ,lastDir ,turnCount):
if r==t[0] and c==t[1]:
return True
if r==-1 or r>n-1 or c>m-1 or c==-1:
return False
if dir not in lastDir and lastDir is not "0":
turnCount+=1
if turnCount>2:
return False
if a[r][c] is "*"... | -1 | |
731 | A | Night at the Museum | PROGRAMMING | 800 | [
"implementation",
"strings"
] | null | null | Grigoriy, like the hero of one famous comedy film, found a job as a night security guard at the museum. At first night he received embosser and was to take stock of the whole exposition.
Embosser is a special devise that allows to "print" the text of a plastic tape. Text is printed sequentially, character by character... | The only line of input contains the name of some exhibit — the non-empty string consisting of no more than 100 characters. It's guaranteed that the string consists of only lowercase English letters. | Print one integer — the minimum number of rotations of the wheel, required to print the name given in the input. | [
"zeus\n",
"map\n",
"ares\n"
] | [
"18\n",
"35\n",
"34\n"
] | To print the string from the first sample it would be optimal to perform the following sequence of rotations:
1. from 'a' to 'z' (1 rotation counterclockwise), 1. from 'z' to 'e' (5 clockwise rotations), 1. from 'e' to 'u' (10 rotations counterclockwise), 1. from 'u' to 's' (2 counterclockwise rotations). | 500 | [
{
"input": "zeus",
"output": "18"
},
{
"input": "map",
"output": "35"
},
{
"input": "ares",
"output": "34"
},
{
"input": "l",
"output": "11"
},
{
"input": "abcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuv",
"... | 1,660,830,975 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 44 | 62 | 0 |
# a1 , a2 , a3,a4 = [int(x) for x in input().split()]
# d = {
# 1:int(a1),
# 2:int(a2),
# 3:int(a3),
# 4:int(a4)
# }
# s = input()
# count = 0
# for i in s:
# count = count +d[int(i)]
# print(count)
s = input()
p = 'a'
cnt = 0
for i in s:
x = abs(ord(p) - ord(i))
if... | Title: Night at the Museum
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Grigoriy, like the hero of one famous comedy film, found a job as a night security guard at the museum. At first night he received embosser and was to take stock of the whole exposition.
Embosser is a special devis... | ```python
# a1 , a2 , a3,a4 = [int(x) for x in input().split()]
# d = {
# 1:int(a1),
# 2:int(a2),
# 3:int(a3),
# 4:int(a4)
# }
# s = input()
# count = 0
# for i in s:
# count = count +d[int(i)]
# print(count)
s = input()
p = 'a'
cnt = 0
for i in s:
x = abs(ord(p) - ord(i... | 3 | |
180 | F | Mathematical Analysis Rocks! | PROGRAMMING | 1,200 | [
"constructive algorithms",
"implementation",
"math"
] | null | null | Students of group 199 have written their lectures dismally. Now an exam on Mathematical Analysis is approaching and something has to be done asap (that is, quickly). Let's number the students of the group from 1 to *n*. Each student *i* (1<=≤<=*i*<=≤<=*n*) has a best friend *p*[*i*] (1<=≤<=*p*[*i*]<=≤<=*n*). In fact, e... | The first line contains integer *n* (1<=≤<=*n*<=≤<=105) — the number of students in the group. The second line contains sequence of different integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=*n*). The third line contains the sequence of different integers *b*1,<=*b*2,<=...,<=*b**n* (1<=≤<=*b**i*<=≤<=*n*). | Print sequence *n* of different integers *p*[1],<=*p*[2],<=...,<=*p*[*n*] (1<=≤<=*p*[*i*]<=≤<=*n*). It is guaranteed that the solution exists and that it is unique. | [
"4\n2 1 4 3\n3 4 2 1\n",
"5\n5 2 3 1 4\n1 3 2 4 5\n",
"2\n1 2\n2 1\n"
] | [
"4 3 1 2 ",
"4 3 2 5 1 ",
"2 1 "
] | none | 0 | [
{
"input": "4\n2 1 4 3\n3 4 2 1",
"output": "4 3 1 2 "
},
{
"input": "5\n5 2 3 1 4\n1 3 2 4 5",
"output": "4 3 2 5 1 "
},
{
"input": "2\n1 2\n2 1",
"output": "2 1 "
},
{
"input": "1\n1\n1",
"output": "1 "
},
{
"input": "2\n1 2\n1 2",
"output": "1 2 "
},
{
... | 1,645,431,558 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 40 | 654 | 22,118,400 | import string
def main_function():
n = int(input())
a = [int(i) for i in input().split(" ")]
b = [int(i) for i in input().split(" ")]
hash_a = [0 for i in range(n + 1)]
hash_b = [0 for i in range(n + 1)]
for i in range(len(a)):
hash_a[a[i]] = i + 1
hash_b[b[i]] = i +... | Title: Mathematical Analysis Rocks!
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Students of group 199 have written their lectures dismally. Now an exam on Mathematical Analysis is approaching and something has to be done asap (that is, quickly). Let's number the students of the group f... | ```python
import string
def main_function():
n = int(input())
a = [int(i) for i in input().split(" ")]
b = [int(i) for i in input().split(" ")]
hash_a = [0 for i in range(n + 1)]
hash_b = [0 for i in range(n + 1)]
for i in range(len(a)):
hash_a[a[i]] = i + 1
hash_b[b... | 3 | |
337 | A | Puzzles | PROGRAMMING | 900 | [
"greedy"
] | null | null | The end of the school year is near and Ms. Manana, the teacher, will soon have to say goodbye to a yet another class. She decided to prepare a goodbye present for her *n* students and give each of them a jigsaw puzzle (which, as wikipedia states, is a tiling puzzle that requires the assembly of numerous small, often od... | The first line contains space-separated integers *n* and *m* (2<=≤<=*n*<=≤<=*m*<=≤<=50). The second line contains *m* space-separated integers *f*1,<=*f*2,<=...,<=*f**m* (4<=≤<=*f**i*<=≤<=1000) — the quantities of pieces in the puzzles sold in the shop. | Print a single integer — the least possible difference the teacher can obtain. | [
"4 6\n10 12 10 7 5 22\n"
] | [
"5\n"
] | Sample 1. The class has 4 students. The shop sells 6 puzzles. If Ms. Manana buys the first four puzzles consisting of 10, 12, 10 and 7 pieces correspondingly, then the difference between the sizes of the largest and the smallest puzzle will be equal to 5. It is impossible to obtain a smaller difference. Note that the t... | 500 | [
{
"input": "4 6\n10 12 10 7 5 22",
"output": "5"
},
{
"input": "2 2\n4 4",
"output": "0"
},
{
"input": "2 10\n4 5 6 7 8 9 10 11 12 12",
"output": "0"
},
{
"input": "4 5\n818 136 713 59 946",
"output": "759"
},
{
"input": "3 20\n446 852 783 313 549 965 40 88 86 617... | 1,681,993,174 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 2 | 62 | 0 | chldrin , present = map(int , input().split())
l = sorted(list(map(int , input().split())))
print(l[chldrin-1] - l[0])
| Title: Puzzles
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The end of the school year is near and Ms. Manana, the teacher, will soon have to say goodbye to a yet another class. She decided to prepare a goodbye present for her *n* students and give each of them a jigsaw puzzle (which, a... | ```python
chldrin , present = map(int , input().split())
l = sorted(list(map(int , input().split())))
print(l[chldrin-1] - l[0])
``` | 0 | |
597 | C | Subsequences | PROGRAMMING | 1,900 | [
"data structures",
"dp"
] | null | null | For the given sequence with *n* different elements find the number of increasing subsequences with *k*<=+<=1 elements. It is guaranteed that the answer is not greater than 8·1018. | First line contain two integer values *n* and *k* (1<=≤<=*n*<=≤<=105,<=0<=≤<=*k*<=≤<=10) — the length of sequence and the number of elements in increasing subsequences.
Next *n* lines contains one integer *a**i* (1<=≤<=*a**i*<=≤<=*n*) each — elements of sequence. All values *a**i* are different. | Print one integer — the answer to the problem. | [
"5 2\n1\n2\n3\n5\n4\n"
] | [
"7\n"
] | none | 1,500 | [
{
"input": "5 2\n1\n2\n3\n5\n4",
"output": "7"
},
{
"input": "1 0\n1",
"output": "1"
},
{
"input": "2 1\n1\n2",
"output": "1"
},
{
"input": "2 1\n2\n1",
"output": "0"
},
{
"input": "3 2\n1\n2\n3",
"output": "1"
},
{
"input": "3 1\n1\n3\n2",
"output... | 1,666,378,013 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 1 | 31 | 0 | import sys
def input():
return sys.stdin.readline().rstrip("\r\n")
def getsum(BITTree, i):
# print("getsum", i)
s = 0 # initialize result
# index in BITree[] is 1 more than the index in arr[]
i = i + 1
# Traverse ancestors of BITree[index]
while i > 0:
# Add cu... | Title: Subsequences
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
For the given sequence with *n* different elements find the number of increasing subsequences with *k*<=+<=1 elements. It is guaranteed that the answer is not greater than 8·1018.
Input Specification:
First line contain t... | ```python
import sys
def input():
return sys.stdin.readline().rstrip("\r\n")
def getsum(BITTree, i):
# print("getsum", i)
s = 0 # initialize result
# index in BITree[] is 1 more than the index in arr[]
i = i + 1
# Traverse ancestors of BITree[index]
while i > 0:
... | 0 | |
740 | B | Alyona and flowers | PROGRAMMING | 1,200 | [
"constructive algorithms"
] | null | null | Little Alyona is celebrating Happy Birthday! Her mother has an array of *n* flowers. Each flower has some mood, the mood of *i*-th flower is *a**i*. The mood can be positive, zero or negative.
Let's define a subarray as a segment of consecutive flowers. The mother suggested some set of subarrays. Alyona wants to choos... | The first line contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100) — the number of flowers and the number of subarrays suggested by the mother.
The second line contains the flowers moods — *n* integers *a*1,<=*a*2,<=...,<=*a**n* (<=-<=100<=≤<=*a**i*<=≤<=100).
The next *m* lines contain the description of the ... | Print single integer — the maximum possible value added to the Alyona's happiness. | [
"5 4\n1 -2 1 3 -4\n1 2\n4 5\n3 4\n1 4\n",
"4 3\n1 2 3 4\n1 3\n2 4\n1 1\n",
"2 2\n-1 -2\n1 1\n1 2\n"
] | [
"7\n",
"16\n",
"0\n"
] | The first example is the situation described in the statements.
In the second example Alyona should choose all subarrays.
The third example has answer 0 because Alyona can choose none of the subarrays. | 1,000 | [
{
"input": "5 4\n1 -2 1 3 -4\n1 2\n4 5\n3 4\n1 4",
"output": "7"
},
{
"input": "4 3\n1 2 3 4\n1 3\n2 4\n1 1",
"output": "16"
},
{
"input": "2 2\n-1 -2\n1 1\n1 2",
"output": "0"
},
{
"input": "5 6\n1 1 1 -1 0\n2 4\n1 3\n4 5\n1 5\n1 4\n4 5",
"output": "8"
},
{
"inpu... | 1,631,532,291 | 2,147,483,647 | Python 3 | OK | TESTS | 53 | 62 | 6,963,200 | n,m = map(int,input().split())
moods = list(map(int,input().split()))
for i in range(1,n):
moods[i] += moods[i-1]
total_Happiness=0
while(m>0):
l,r = map(int,input().split())
if l==1:
sum = moods[r-1]
else:
sum = moods[r-1] - moods[l-2]
if sum>0:
total_Happiness+=... | Title: Alyona and flowers
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Little Alyona is celebrating Happy Birthday! Her mother has an array of *n* flowers. Each flower has some mood, the mood of *i*-th flower is *a**i*. The mood can be positive, zero or negative.
Let's define a subarra... | ```python
n,m = map(int,input().split())
moods = list(map(int,input().split()))
for i in range(1,n):
moods[i] += moods[i-1]
total_Happiness=0
while(m>0):
l,r = map(int,input().split())
if l==1:
sum = moods[r-1]
else:
sum = moods[r-1] - moods[l-2]
if sum>0:
total_H... | 3 | |
420 | A | Start Up | PROGRAMMING | 1,000 | [
"implementation"
] | null | null | Recently, a start up by two students of a state university of city F gained incredible popularity. Now it's time to start a new company. But what do we call it?
The market analysts came up with a very smart plan: the name of the company should be identical to its reflection in a mirror! In other words, if we write out... | The first line contains a non-empty name that needs to be checked. The name contains at most 105 large English letters. The name will be written with the next sans serif font: | Print 'YES' (without the quotes), if the given name matches its mirror reflection. Otherwise, print 'NO' (without the quotes). | [
"AHA\n",
"Z\n",
"XO\n"
] | [
"YES\n",
"NO\n",
"NO\n"
] | none | 500 | [
{
"input": "AHA",
"output": "YES"
},
{
"input": "Z",
"output": "NO"
},
{
"input": "XO",
"output": "NO"
},
{
"input": "AAA",
"output": "YES"
},
{
"input": "AHHA",
"output": "YES"
},
{
"input": "BAB",
"output": "NO"
},
{
"input": "OMMMAAMMMO"... | 1,603,792,972 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 5 | 124 | 0 | name = input()
if len(name) <= 1:
print("NO")
else:
print('YES') if name == name[::-1] else print('NO')
| Title: Start Up
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Recently, a start up by two students of a state university of city F gained incredible popularity. Now it's time to start a new company. But what do we call it?
The market analysts came up with a very smart plan: the name of ... | ```python
name = input()
if len(name) <= 1:
print("NO")
else:
print('YES') if name == name[::-1] else print('NO')
``` | 0 | |
705 | A | Hulk | PROGRAMMING | 800 | [
"implementation"
] | null | null | Dr. Bruce Banner hates his enemies (like others don't). As we all know, he can barely talk when he turns into the incredible Hulk. That's why he asked you to help him to express his feelings.
Hulk likes the Inception so much, and like that his feelings are complicated. They have *n* layers. The first layer is hate, se... | The only line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=100) — the number of layers of love and hate. | Print Dr.Banner's feeling in one line. | [
"1\n",
"2\n",
"3\n"
] | [
"I hate it\n",
"I hate that I love it\n",
"I hate that I love that I hate it\n"
] | none | 500 | [
{
"input": "1",
"output": "I hate it"
},
{
"input": "2",
"output": "I hate that I love it"
},
{
"input": "3",
"output": "I hate that I love that I hate it"
},
{
"input": "4",
"output": "I hate that I love that I hate that I love it"
},
{
"input": "5",
"output"... | 1,695,365,298 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 21 | 61 | 0 | n = int(input())
import sys
s = 'I hate '
s2 = 'I love '
ss = ''
if n == 1: print(s+"it"); sys.exit()
for i in range(n):
if (i+1) % 2 == 1 and i != n-1:
ss = ss + s + "that "
elif (i+1) % 2 == 0 and i != n-1:
ss = ss + s2 + "that "
if (i+1) % 2 == 0 and i == n-1:
ss = ss ... | Title: Hulk
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Dr. Bruce Banner hates his enemies (like others don't). As we all know, he can barely talk when he turns into the incredible Hulk. That's why he asked you to help him to express his feelings.
Hulk likes the Inception so much, and... | ```python
n = int(input())
import sys
s = 'I hate '
s2 = 'I love '
ss = ''
if n == 1: print(s+"it"); sys.exit()
for i in range(n):
if (i+1) % 2 == 1 and i != n-1:
ss = ss + s + "that "
elif (i+1) % 2 == 0 and i != n-1:
ss = ss + s2 + "that "
if (i+1) % 2 == 0 and i == n-1:
... | 3 | |
615 | A | Bulbs | PROGRAMMING | 800 | [
"implementation"
] | null | null | Vasya wants to turn on Christmas lights consisting of *m* bulbs. Initially, all bulbs are turned off. There are *n* buttons, each of them is connected to some set of bulbs. Vasya can press any of these buttons. When the button is pressed, it turns on all the bulbs it's connected to. Can Vasya light up all the bulbs?
I... | The first line of the input contains integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100) — the number of buttons and the number of bulbs respectively.
Each of the next *n* lines contains *x**i* (0<=≤<=*x**i*<=≤<=*m*) — the number of bulbs that are turned on by the *i*-th button, and then *x**i* numbers *y**ij* (1<=≤<=*y**... | If it's possible to turn on all *m* bulbs print "YES", otherwise print "NO". | [
"3 4\n2 1 4\n3 1 3 1\n1 2\n",
"3 3\n1 1\n1 2\n1 1\n"
] | [
"YES\n",
"NO\n"
] | In the first sample you can press each button once and turn on all the bulbs. In the 2 sample it is impossible to turn on the 3-rd lamp. | 500 | [
{
"input": "3 4\n2 1 4\n3 1 3 1\n1 2",
"output": "YES"
},
{
"input": "3 3\n1 1\n1 2\n1 1",
"output": "NO"
},
{
"input": "3 4\n1 1\n1 2\n1 3",
"output": "NO"
},
{
"input": "1 5\n5 1 2 3 4 5",
"output": "YES"
},
{
"input": "1 5\n5 4 4 1 2 3",
"output": "NO"
},... | 1,628,269,884 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 4 | 108 | 20,172,800 | n,m = map(int,input().split())
on = []
ls = list(range(1,m+1))
ans = 'YES'
for t in range(n):
arr = list(map(int,input().split()))
on.extend(arr)
for i in range(len(ls)):
if ls[i] not in on:
ans = 'NO'
print(ans)
| Title: Bulbs
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya wants to turn on Christmas lights consisting of *m* bulbs. Initially, all bulbs are turned off. There are *n* buttons, each of them is connected to some set of bulbs. Vasya can press any of these buttons. When the button is... | ```python
n,m = map(int,input().split())
on = []
ls = list(range(1,m+1))
ans = 'YES'
for t in range(n):
arr = list(map(int,input().split()))
on.extend(arr)
for i in range(len(ls)):
if ls[i] not in on:
ans = 'NO'
print(ans)
``` | 0 | |
711 | A | Bus to Udayland | PROGRAMMING | 800 | [
"brute force",
"implementation"
] | null | null | ZS the Coder and Chris the Baboon are travelling to Udayland! To get there, they have to get on the special IOI bus. The IOI bus has *n* rows of seats. There are 4 seats in each row, and the seats are separated into pairs by a walkway. When ZS and Chris came, some places in the bus was already occupied.
ZS and Chris a... | The first line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=1000) — the number of rows of seats in the bus.
Then, *n* lines follow. Each line contains exactly 5 characters, the first two of them denote the first pair of seats in the row, the third character denotes the walkway (it always equals '|') and t... | If it is possible for Chris and ZS to sit at neighbouring empty seats, print "YES" (without quotes) in the first line. In the next *n* lines print the bus configuration, where the characters in the pair of seats for Chris and ZS is changed with characters '+'. Thus the configuration should differ from the input one by ... | [
"6\nOO|OX\nXO|XX\nOX|OO\nXX|OX\nOO|OO\nOO|XX\n",
"4\nXO|OX\nXO|XX\nOX|OX\nXX|OX\n",
"5\nXX|XX\nXX|XX\nXO|OX\nXO|OO\nOX|XO\n"
] | [
"YES\n++|OX\nXO|XX\nOX|OO\nXX|OX\nOO|OO\nOO|XX\n",
"NO\n",
"YES\nXX|XX\nXX|XX\nXO|OX\nXO|++\nOX|XO\n"
] | Note that the following is an incorrect configuration for the first sample case because the seats must be in the same pair.
O+|+X
XO|XX
OX|OO
XX|OX
OO|OO
OO|XX | 500 | [
{
"input": "6\nOO|OX\nXO|XX\nOX|OO\nXX|OX\nOO|OO\nOO|XX",
"output": "YES\n++|OX\nXO|XX\nOX|OO\nXX|OX\nOO|OO\nOO|XX"
},
{
"input": "4\nXO|OX\nXO|XX\nOX|OX\nXX|OX",
"output": "NO"
},
{
"input": "5\nXX|XX\nXX|XX\nXO|OX\nXO|OO\nOX|XO",
"output": "YES\nXX|XX\nXX|XX\nXO|OX\nXO|++\nOX|XO"
... | 1,669,452,739 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 31 | 0 | n = int(input())
c=0
res=[]
for i in range(n):
i = input()
if 'OO' in i:
c+=1
i=i.replace('OO', '++', 1)
res.append(i +'\n')
if c>=1:
print('YES')
print(*res)
else:
print('NO') | Title: Bus to Udayland
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
ZS the Coder and Chris the Baboon are travelling to Udayland! To get there, they have to get on the special IOI bus. The IOI bus has *n* rows of seats. There are 4 seats in each row, and the seats are separated into pai... | ```python
n = int(input())
c=0
res=[]
for i in range(n):
i = input()
if 'OO' in i:
c+=1
i=i.replace('OO', '++', 1)
res.append(i +'\n')
if c>=1:
print('YES')
print(*res)
else:
print('NO')
``` | 0 | |
192 | A | Funky Numbers | PROGRAMMING | 1,300 | [
"binary search",
"brute force",
"implementation"
] | null | null | As you very well know, this year's funkiest numbers are so called triangular numbers (that is, integers that are representable as , where *k* is some positive integer), and the coolest numbers are those that are representable as a sum of two triangular numbers.
A well-known hipster Andrew adores everything funky and c... | The first input line contains an integer *n* (1<=≤<=*n*<=≤<=109). | Print "YES" (without the quotes), if *n* can be represented as a sum of two triangular numbers, otherwise print "NO" (without the quotes). | [
"256\n",
"512\n"
] | [
"YES\n",
"NO\n"
] | In the first sample number <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/92095692c6ea93e9e3b837a0408ba7543549d5b2.png" style="max-width: 100.0%;max-height: 100.0%;"/>.
In the second sample number 512 can not be represented as a sum of two triangular numbers. | 500 | [
{
"input": "256",
"output": "YES"
},
{
"input": "512",
"output": "NO"
},
{
"input": "80",
"output": "NO"
},
{
"input": "828",
"output": "YES"
},
{
"input": "6035",
"output": "NO"
},
{
"input": "39210",
"output": "YES"
},
{
"input": "79712",... | 1,621,968,290 | 2,147,483,647 | PyPy 3 | OK | TESTS | 71 | 280 | 7,884,800 | n = int(input())
st = set([p * (p + 1) / 2 for p in range(1, 55000)])
flag=0
for i in st:
if n-i in st:
flag=1
if flag==1:
print("YES")
else:
print("NO") | Title: Funky Numbers
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
As you very well know, this year's funkiest numbers are so called triangular numbers (that is, integers that are representable as , where *k* is some positive integer), and the coolest numbers are those that are represent... | ```python
n = int(input())
st = set([p * (p + 1) / 2 for p in range(1, 55000)])
flag=0
for i in st:
if n-i in st:
flag=1
if flag==1:
print("YES")
else:
print("NO")
``` | 3 | |
5 | C | Longest Regular Bracket Sequence | PROGRAMMING | 1,900 | [
"constructive algorithms",
"data structures",
"dp",
"greedy",
"sortings",
"strings"
] | C. Longest Regular Bracket Sequence | 2 | 256 | This is yet another problem dealing with regular bracket sequences.
We should remind you that a bracket sequence is called regular, if by inserting «+» and «1» into it we can get a correct mathematical expression. For example, sequences «(())()», «()» and «(()(()))» are regular, while «)(», «(()» and «(()))(» are not.... | The first line of the input file contains a non-empty string, consisting of «(» and «)» characters. Its length does not exceed 106. | Print the length of the longest substring that is a regular bracket sequence, and the number of such substrings. If there are no such substrings, write the only line containing "0 1". | [
")((())))(()())\n",
"))(\n"
] | [
"6 2\n",
"0 1\n"
] | none | 0 | [
{
"input": ")((())))(()())",
"output": "6 2"
},
{
"input": "))(",
"output": "0 1"
},
{
"input": "()(())()",
"output": "8 1"
},
{
"input": "((((()(((",
"output": "2 1"
},
{
"input": "))))()())))",
"output": "4 1"
},
{
"input": "(()())()(())()()())())()(... | 1,682,683,363 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 3 | 92 | 0 | brackets = tuple(input())
stack = []
max_len = 0
curr_len = 0
count = 1
for bracket in brackets:
if bracket == '(':
stack.append(bracket)
elif stack:
stack.pop()
curr_len += 2
if not stack:
if curr_len == max_len:
count += 1
max_len = max... | Title: Longest Regular Bracket Sequence
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
This is yet another problem dealing with regular bracket sequences.
We should remind you that a bracket sequence is called regular, if by inserting «+» and «1» into it we can get a correct mathematical exp... | ```python
brackets = tuple(input())
stack = []
max_len = 0
curr_len = 0
count = 1
for bracket in brackets:
if bracket == '(':
stack.append(bracket)
elif stack:
stack.pop()
curr_len += 2
if not stack:
if curr_len == max_len:
count += 1
max... | 0 |
858 | C | Did you mean... | PROGRAMMING | 1,500 | [
"dp",
"greedy",
"implementation"
] | null | null | Beroffice text editor has a wide range of features that help working with text. One of the features is an automatic search for typos and suggestions of how to fix them.
Beroffice works only with small English letters (i.e. with 26 letters from a to z). Beroffice thinks that a word is typed with a typo if there are thr... | The only line contains a non-empty word consisting of small English letters. The length of the word is between 1 and 3000 letters. | Print the given word without any changes if there are no typos.
If there is at least one typo in the word, insert the minimum number of spaces into the word so that each of the resulting words doesn't have any typos. If there are multiple solutions, print any of them. | [
"hellno\n",
"abacaba\n",
"asdfasdf\n"
] | [
"hell no \n",
"abacaba \n",
"asd fasd f \n"
] | none | 1,500 | [
{
"input": "hellno",
"output": "hell no "
},
{
"input": "abacaba",
"output": "abacaba "
},
{
"input": "asdfasdf",
"output": "asd fasd f "
},
{
"input": "ooo",
"output": "ooo "
},
{
"input": "moyaoborona",
"output": "moyaoborona "
},
{
"input": "jxegxxx... | 1,592,890,798 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 6 | 109 | 6,963,200 | s = input()
j=''
k='aeiou'
i=0
a=set()
n=len(s)
while i<n-2:
if s[i] not in k:
a.add(s[i])
if s[i+1] not in k:
a.add(s[i+1])
if s[i+2] not in k:
a.add(s[i+2])
if len(a)==1:
j+=s[i]
i+... | Title: Did you mean...
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Beroffice text editor has a wide range of features that help working with text. One of the features is an automatic search for typos and suggestions of how to fix them.
Beroffice works only with small English letters (... | ```python
s = input()
j=''
k='aeiou'
i=0
a=set()
n=len(s)
while i<n-2:
if s[i] not in k:
a.add(s[i])
if s[i+1] not in k:
a.add(s[i+1])
if s[i+2] not in k:
a.add(s[i+2])
if len(a)==1:
j+=s[i]
... | 0 | |
41 | A | Translation | PROGRAMMING | 800 | [
"implementation",
"strings"
] | A. Translation | 2 | 256 | The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc.... | The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols. | If the word *t* is a word *s*, written reversely, print YES, otherwise print NO. | [
"code\nedoc\n",
"abb\naba\n",
"code\ncode\n"
] | [
"YES\n",
"NO\n",
"NO\n"
] | none | 500 | [
{
"input": "code\nedoc",
"output": "YES"
},
{
"input": "abb\naba",
"output": "NO"
},
{
"input": "code\ncode",
"output": "NO"
},
{
"input": "abacaba\nabacaba",
"output": "YES"
},
{
"input": "q\nq",
"output": "YES"
},
{
"input": "asrgdfngfnmfgnhweratgjkk... | 1,592,395,891 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 9 | 218 | 0 | s=input()
t=input()
m=len(s)
count=0
for l in range (0,m):
if s[l]==t[m-1-l]:
count=count+1
if count==m:
print('YES')
else:
print('NO') | Title: Translation
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pron... | ```python
s=input()
t=input()
m=len(s)
count=0
for l in range (0,m):
if s[l]==t[m-1-l]:
count=count+1
if count==m:
print('YES')
else:
print('NO')
``` | -1 |
875 | A | Classroom Watch | PROGRAMMING | 1,200 | [
"brute force",
"math"
] | null | null | Eighth-grader Vova is on duty today in the class. After classes, he went into the office to wash the board, and found on it the number *n*. He asked what is this number and the teacher of mathematics Inna Petrovna answered Vova that *n* is the answer to the arithmetic task for first-graders. In the textbook, a certain ... | The first line contains integer *n* (1<=≤<=*n*<=≤<=109). | In the first line print one integer *k* — number of different values of *x* satisfying the condition.
In next *k* lines print these values in ascending order. | [
"21\n",
"20\n"
] | [
"1\n15\n",
"0\n"
] | In the first test case *x* = 15 there is only one variant: 15 + 1 + 5 = 21.
In the second test case there are no such *x*. | 500 | [
{
"input": "21",
"output": "1\n15"
},
{
"input": "20",
"output": "0"
},
{
"input": "1",
"output": "0"
},
{
"input": "2",
"output": "1\n1"
},
{
"input": "3",
"output": "0"
},
{
"input": "100000001",
"output": "2\n99999937\n100000000"
},
{
"i... | 1,612,512,370 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 3 | 61 | 307,200 | def getSum(n):
sum = 0
while(n > 0):
sum += int(n % 10)
n = int(n/10)
return sum
t=int(input())
c=0
l=[]
for i in range(10,t):
s=t
s=s-getSum(i)
if s==i:
l.append(i)
c+=1
if c==0:
print(c)
else:
print(c)
for i in l:
print(i,end="\n")
... | Title: Classroom Watch
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Eighth-grader Vova is on duty today in the class. After classes, he went into the office to wash the board, and found on it the number *n*. He asked what is this number and the teacher of mathematics Inna Petrovna answe... | ```python
def getSum(n):
sum = 0
while(n > 0):
sum += int(n % 10)
n = int(n/10)
return sum
t=int(input())
c=0
l=[]
for i in range(10,t):
s=t
s=s-getSum(i)
if s==i:
l.append(i)
c+=1
if c==0:
print(c)
else:
print(c)
for i in l:
print(i,end=... | 0 | |
5 | B | Center Alignment | PROGRAMMING | 1,200 | [
"implementation",
"strings"
] | B. Center Alignment | 1 | 64 | Almost every text editor has a built-in function of center text alignment. The developers of the popular in Berland text editor «Textpad» decided to introduce this functionality into the fourth release of the product.
You are to implement the alignment in the shortest possible time. Good luck! | The input file consists of one or more lines, each of the lines contains Latin letters, digits and/or spaces. The lines cannot start or end with a space. It is guaranteed that at least one of the lines has positive length. The length of each line and the total amount of the lines do not exceed 1000. | Format the given text, aligning it center. Frame the whole text with characters «*» of the minimum size. If a line cannot be aligned perfectly (for example, the line has even length, while the width of the block is uneven), you should place such lines rounding down the distance to the left or to the right edge and brin... | [
"This is\n\nCodeforces\nBeta\nRound\n5\n",
"welcome to the\nCodeforces\nBeta\nRound 5\n\nand\ngood luck\n"
] | [
"************\n* This is *\n* *\n*Codeforces*\n* Beta *\n* Round *\n* 5 *\n************\n",
"****************\n*welcome to the*\n* Codeforces *\n* Beta *\n* Round 5 *\n* *\n* and *\n* good luck *\n****************\n"
] | none | 0 | [
{
"input": "This is\n\nCodeforces\nBeta\nRound\n5",
"output": "************\n* This is *\n* *\n*Codeforces*\n* Beta *\n* Round *\n* 5 *\n************"
},
{
"input": "welcome to the\nCodeforces\nBeta\nRound 5\n\nand\ngood luck",
"output": "****************\n*welcome to th... | 1,625,241,195 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 1 | 60 | 0 | data=[]
while True:
try:
data.append(input())
except EOFError:
break
width=len(max(data,key=len))
check=True
border='*'*(width+2)
new_data=[border]
for elem in data:
elem=elem.strip()
if elem=='':
elem=' '*width
while len(elem)<width :
elem=' '+elem... | Title: Center Alignment
Time Limit: 1 seconds
Memory Limit: 64 megabytes
Problem Description:
Almost every text editor has a built-in function of center text alignment. The developers of the popular in Berland text editor «Textpad» decided to introduce this functionality into the fourth release of the product.
You ... | ```python
data=[]
while True:
try:
data.append(input())
except EOFError:
break
width=len(max(data,key=len))
check=True
border='*'*(width+2)
new_data=[border]
for elem in data:
elem=elem.strip()
if elem=='':
elem=' '*width
while len(elem)<width :
ele... | 0 |
500 | A | New Year Transportation | PROGRAMMING | 1,000 | [
"dfs and similar",
"graphs",
"implementation"
] | null | null | New Year is coming in Line World! In this world, there are *n* cells numbered by integers from 1 to *n*, as a 1<=×<=*n* board. People live in cells. However, it was hard to move between distinct cells, because of the difficulty of escaping the cell. People wanted to meet people who live in other cells.
So, user tncks0... | The first line contains two space-separated integers *n* (3<=≤<=*n*<=≤<=3<=×<=104) and *t* (2<=≤<=*t*<=≤<=*n*) — the number of cells, and the index of the cell which I want to go to.
The second line contains *n*<=-<=1 space-separated integers *a*1,<=*a*2,<=...,<=*a**n*<=-<=1 (1<=≤<=*a**i*<=≤<=*n*<=-<=*i*). It is guara... | If I can go to cell *t* using the transportation system, print "YES". Otherwise, print "NO". | [
"8 4\n1 2 1 2 1 2 1\n",
"8 5\n1 2 1 2 1 1 1\n"
] | [
"YES\n",
"NO\n"
] | In the first sample, the visited cells are: 1, 2, 4; so we can successfully visit the cell 4.
In the second sample, the possible cells to visit are: 1, 2, 4, 6, 7, 8; so we can't visit the cell 5, which we want to visit. | 500 | [
{
"input": "8 4\n1 2 1 2 1 2 1",
"output": "YES"
},
{
"input": "8 5\n1 2 1 2 1 1 1",
"output": "NO"
},
{
"input": "20 19\n13 16 7 6 12 1 5 7 8 6 5 7 5 5 3 3 2 2 1",
"output": "YES"
},
{
"input": "50 49\n11 7 1 41 26 36 19 16 38 14 36 35 37 27 20 27 3 6 21 2 27 11 18 17 19 16 ... | 1,688,423,765 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 10 | 31 | 3,584,000 | n,t = map(int,input().split())
a = list(map(int,input().split()))
x = 0
for i in range(len(a)):
if x + a[x] > len(a) or x > t-1:
print("NO")
break
elif x + a[x] == t-1:
print("YES")
break
else:
x = x + a[x]
| Title: New Year Transportation
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
New Year is coming in Line World! In this world, there are *n* cells numbered by integers from 1 to *n*, as a 1<=×<=*n* board. People live in cells. However, it was hard to move between distinct cells, because o... | ```python
n,t = map(int,input().split())
a = list(map(int,input().split()))
x = 0
for i in range(len(a)):
if x + a[x] > len(a) or x > t-1:
print("NO")
break
elif x + a[x] == t-1:
print("YES")
break
else:
x = x + a[x]
``` | -1 | |
224 | A | Parallelepiped | PROGRAMMING | 1,100 | [
"brute force",
"geometry",
"math"
] | null | null | You've got a rectangular parallelepiped with integer edge lengths. You know the areas of its three faces that have a common vertex. Your task is to find the sum of lengths of all 12 edges of this parallelepiped. | The first and the single line contains three space-separated integers — the areas of the parallelepiped's faces. The area's values are positive (<=><=0) and do not exceed 104. It is guaranteed that there exists at least one parallelepiped that satisfies the problem statement. | Print a single number — the sum of all edges of the parallelepiped. | [
"1 1 1\n",
"4 6 6\n"
] | [
"12\n",
"28\n"
] | In the first sample the parallelepiped has sizes 1 × 1 × 1, in the second one — 2 × 2 × 3. | 500 | [
{
"input": "1 1 1",
"output": "12"
},
{
"input": "4 6 6",
"output": "28"
},
{
"input": "20 10 50",
"output": "68"
},
{
"input": "9 4 36",
"output": "56"
},
{
"input": "324 9 36",
"output": "184"
},
{
"input": "1333 93 129",
"output": "308"
},
{... | 1,642,678,699 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 0 | 184 | 2,662,400 | from math import sqrt,gcd,ceil,floor,log,factorial
from itertools import permutations,combinations
from collections import Counter, defaultdict
import collections,sys,threading
import collections,sys,threading
from bisect import *
from heapq import *
#sys.setrecursionlimit(10**9)
#threading.stack_size(10**8)
#... | Title: Parallelepiped
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You've got a rectangular parallelepiped with integer edge lengths. You know the areas of its three faces that have a common vertex. Your task is to find the sum of lengths of all 12 edges of this parallelepiped.
Input S... | ```python
from math import sqrt,gcd,ceil,floor,log,factorial
from itertools import permutations,combinations
from collections import Counter, defaultdict
import collections,sys,threading
import collections,sys,threading
from bisect import *
from heapq import *
#sys.setrecursionlimit(10**9)
#threading.stack_size... | 0 | |
864 | A | Fair Game | PROGRAMMING | 1,000 | [
"implementation",
"sortings"
] | null | null | Petya and Vasya decided to play a game. They have *n* cards (*n* is an even number). A single integer is written on each card.
Before the game Petya will choose an integer and after that Vasya will choose another integer (different from the number that Petya chose). During the game each player takes all the cards with... | The first line contains a single integer *n* (2<=≤<=*n*<=≤<=100) — number of cards. It is guaranteed that *n* is an even number.
The following *n* lines contain a sequence of integers *a*1,<=*a*2,<=...,<=*a**n* (one integer per line, 1<=≤<=*a**i*<=≤<=100) — numbers written on the *n* cards. | If it is impossible for Petya and Vasya to choose numbers in such a way that the game will be fair, print "NO" (without quotes) in the first line. In this case you should not print anything more.
In the other case print "YES" (without quotes) in the first line. In the second line print two distinct integers — number t... | [
"4\n11\n27\n27\n11\n",
"2\n6\n6\n",
"6\n10\n20\n30\n20\n10\n20\n",
"6\n1\n1\n2\n2\n3\n3\n"
] | [
"YES\n11 27\n",
"NO\n",
"NO\n",
"NO\n"
] | In the first example the game will be fair if, for example, Petya chooses number 11, and Vasya chooses number 27. Then the will take all cards — Petya will take cards 1 and 4, and Vasya will take cards 2 and 3. Thus, each of them will take exactly two cards.
In the second example fair game is impossible because the nu... | 500 | [
{
"input": "4\n11\n27\n27\n11",
"output": "YES\n11 27"
},
{
"input": "2\n6\n6",
"output": "NO"
},
{
"input": "6\n10\n20\n30\n20\n10\n20",
"output": "NO"
},
{
"input": "6\n1\n1\n2\n2\n3\n3",
"output": "NO"
},
{
"input": "2\n1\n100",
"output": "YES\n1 100"
},
... | 1,588,981,899 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 28 | 139 | 20,172,800 | n=int(input())
L=[]
for i in range(n):
L.append(int(input()))
s=set(L)
if(len(s)==1 or len(s)>2):
print('NO')
else:
L=list(s)
L.sort()
print('YES')
print(L[0],L[1])
| Title: Fair Game
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Petya and Vasya decided to play a game. They have *n* cards (*n* is an even number). A single integer is written on each card.
Before the game Petya will choose an integer and after that Vasya will choose another integer (di... | ```python
n=int(input())
L=[]
for i in range(n):
L.append(int(input()))
s=set(L)
if(len(s)==1 or len(s)>2):
print('NO')
else:
L=list(s)
L.sort()
print('YES')
print(L[0],L[1])
``` | 0 | |
62 | A | A Student's Dream | PROGRAMMING | 1,300 | [
"greedy",
"math"
] | A. A Student's Dream | 2 | 256 | Statistics claims that students sleep no more than three hours a day. But even in the world of their dreams, while they are snoring peacefully, the sense of impending doom is still upon them.
A poor student is dreaming that he is sitting the mathematical analysis exam. And he is examined by the most formidable profess... | The first line contains two positive integers not exceeding 100. They are the number of fingers on the Venusian girl's left and right hand correspondingly. The second line contains two integers not exceeding 100. They are the number of fingers on the Marsian boy's left and right hands correspondingly. | Print YES or NO, that is, the answer to Petr Palych's question. | [
"5 1\n10 5\n",
"4 5\n3 3\n",
"1 2\n11 6\n"
] | [
"YES",
"YES",
"NO"
] | The boy and the girl don't really care who goes to the left. | 500 | [
{
"input": "5 1\n10 5",
"output": "YES"
},
{
"input": "4 5\n3 3",
"output": "YES"
},
{
"input": "1 2\n11 6",
"output": "NO"
},
{
"input": "1 1\n1 1",
"output": "YES"
},
{
"input": "2 2\n1 1",
"output": "YES"
},
{
"input": "3 3\n1 1",
"output": "NO"... | 1,626,327,897 | 2,147,483,647 | Python 3 | OK | TESTS | 60 | 124 | 6,758,400 | al, ar = list(map(int, input().split()))
bl, br = list(map(int, input().split()))
if (br >= al-1 and br <= (al+1)*2) or (bl <= (ar+1)*2 and bl >= ar-1):
print('YES')
else:
print('NO') | Title: A Student's Dream
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Statistics claims that students sleep no more than three hours a day. But even in the world of their dreams, while they are snoring peacefully, the sense of impending doom is still upon them.
A poor student is dreaming t... | ```python
al, ar = list(map(int, input().split()))
bl, br = list(map(int, input().split()))
if (br >= al-1 and br <= (al+1)*2) or (bl <= (ar+1)*2 and bl >= ar-1):
print('YES')
else:
print('NO')
``` | 3.956411 |
61 | A | Ultra-Fast Mathematician | PROGRAMMING | 800 | [
"implementation"
] | A. Ultra-Fast Mathematician | 2 | 256 | Shapur was an extremely gifted student. He was great at everything including Combinatorics, Algebra, Number Theory, Geometry, Calculus, etc. He was not only smart but extraordinarily fast! He could manage to sum 1018 numbers in a single second.
One day in 230 AD Shapur was trying to find out if any one can possibly do... | There are two lines in each input. Each of them contains a single number. It is guaranteed that the numbers are made from 0 and 1 only and that their length is same. The numbers may start with 0. The length of each number doesn't exceed 100. | Write one line — the corresponding answer. Do not omit the leading 0s. | [
"1010100\n0100101\n",
"000\n111\n",
"1110\n1010\n",
"01110\n01100\n"
] | [
"1110001\n",
"111\n",
"0100\n",
"00010\n"
] | none | 500 | [
{
"input": "1010100\n0100101",
"output": "1110001"
},
{
"input": "000\n111",
"output": "111"
},
{
"input": "1110\n1010",
"output": "0100"
},
{
"input": "01110\n01100",
"output": "00010"
},
{
"input": "011101\n000001",
"output": "011100"
},
{
"input": "... | 1,624,376,532 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 3 | 62 | 0 | print(str(int(input())+int(input())).replace("2", "0")) | Title: Ultra-Fast Mathematician
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Shapur was an extremely gifted student. He was great at everything including Combinatorics, Algebra, Number Theory, Geometry, Calculus, etc. He was not only smart but extraordinarily fast! He could manage to sum 10... | ```python
print(str(int(input())+int(input())).replace("2", "0"))
``` | 0 |
237 | A | Free Cash | PROGRAMMING | 1,000 | [
"implementation"
] | null | null | Valera runs a 24/7 fast food cafe. He magically learned that next day *n* people will visit his cafe. For each person we know the arrival time: the *i*-th person comes exactly at *h**i* hours *m**i* minutes. The cafe spends less than a minute to serve each client, but if a client comes in and sees that there is no free... | The first line contains a single integer *n* (1<=≤<=*n*<=≤<=105), that is the number of cafe visitors.
Each of the following *n* lines has two space-separated integers *h**i* and *m**i* (0<=≤<=*h**i*<=≤<=23; 0<=≤<=*m**i*<=≤<=59), representing the time when the *i*-th person comes into the cafe.
Note that the time is... | Print a single integer — the minimum number of cashes, needed to serve all clients next day. | [
"4\n8 0\n8 10\n8 10\n8 45\n",
"3\n0 12\n10 11\n22 22\n"
] | [
"2\n",
"1\n"
] | In the first sample it is not enough one cash to serve all clients, because two visitors will come into cafe in 8:10. Therefore, if there will be one cash in cafe, then one customer will be served by it, and another one will not wait and will go away.
In the second sample all visitors will come in different times, so ... | 500 | [
{
"input": "4\n8 0\n8 10\n8 10\n8 45",
"output": "2"
},
{
"input": "3\n0 12\n10 11\n22 22",
"output": "1"
},
{
"input": "5\n12 8\n15 27\n15 27\n16 2\n19 52",
"output": "2"
},
{
"input": "7\n5 6\n7 34\n7 34\n7 34\n12 29\n15 19\n20 23",
"output": "3"
},
{
"input": "... | 1,609,835,606 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 8 | 2,000 | 921,600 | #from collections import Counter
n = int(input())
hours = []
c = 1
for i in range(0,n):
x= list(map(int,input().split()))
hours.append(x)
y= 0
while len(hours) > 2:
#print(hours)
t = hours.count(hours[y])
hours = [i for i in hours if i != hours[y]]
if t>c:
c=t
#print(ho... | Title: Free Cash
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Valera runs a 24/7 fast food cafe. He magically learned that next day *n* people will visit his cafe. For each person we know the arrival time: the *i*-th person comes exactly at *h**i* hours *m**i* minutes. The cafe spends l... | ```python
#from collections import Counter
n = int(input())
hours = []
c = 1
for i in range(0,n):
x= list(map(int,input().split()))
hours.append(x)
y= 0
while len(hours) > 2:
#print(hours)
t = hours.count(hours[y])
hours = [i for i in hours if i != hours[y]]
if t>c:
c=t
... | 0 | |
25 | A | IQ test | PROGRAMMING | 1,300 | [
"brute force"
] | A. IQ test | 2 | 256 | Bob is preparing to pass IQ test. The most frequent task in this test is to find out which one of the given *n* numbers differs from the others. Bob observed that one number usually differs from the others in evenness. Help Bob — to check his answers, he needs a program that among the given *n* numbers finds one that i... | The first line contains integer *n* (3<=≤<=*n*<=≤<=100) — amount of numbers in the task. The second line contains *n* space-separated natural numbers, not exceeding 100. It is guaranteed, that exactly one of these numbers differs from the others in evenness. | Output index of number that differs from the others in evenness. Numbers are numbered from 1 in the input order. | [
"5\n2 4 7 8 10\n",
"4\n1 2 1 1\n"
] | [
"3\n",
"2\n"
] | none | 0 | [
{
"input": "5\n2 4 7 8 10",
"output": "3"
},
{
"input": "4\n1 2 1 1",
"output": "2"
},
{
"input": "3\n1 2 2",
"output": "1"
},
{
"input": "3\n100 99 100",
"output": "2"
},
{
"input": "3\n5 3 2",
"output": "3"
},
{
"input": "4\n43 28 1 91",
"output"... | 1,650,715,230 | 2,147,483,647 | Python 3 | OK | TESTS | 32 | 92 | 0 | n=int(input())
a=[int(x) for x in input().split()]
odd = 0
even = 0
index1 = 0
index2 = 0
for i in range(n):
if a[i]%2==0:
even = even + 1
index1 = i
else:
odd = odd + 1
index2 = i
if even > odd:
print(index2 + 1)
else:
print(index1 + 1) | Title: IQ test
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Bob is preparing to pass IQ test. The most frequent task in this test is to find out which one of the given *n* numbers differs from the others. Bob observed that one number usually differs from the others in evenness. Help Bob — t... | ```python
n=int(input())
a=[int(x) for x in input().split()]
odd = 0
even = 0
index1 = 0
index2 = 0
for i in range(n):
if a[i]%2==0:
even = even + 1
index1 = i
else:
odd = odd + 1
index2 = i
if even > odd:
print(index2 + 1)
else:
print(index1 + 1)
``` | 3.977 |
50 | A | Domino piling | PROGRAMMING | 800 | [
"greedy",
"math"
] | A. Domino piling | 2 | 256 | You are given a rectangular board of *M*<=×<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=×<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as possible on the board so as to meet the following conditions:
1. Each domino completely covers ... | In a single line you are given two integers *M* and *N* — board sizes in squares (1<=≤<=*M*<=≤<=*N*<=≤<=16). | Output one number — the maximal number of dominoes, which can be placed. | [
"2 4\n",
"3 3\n"
] | [
"4\n",
"4\n"
] | none | 500 | [
{
"input": "2 4",
"output": "4"
},
{
"input": "3 3",
"output": "4"
},
{
"input": "1 5",
"output": "2"
},
{
"input": "1 6",
"output": "3"
},
{
"input": "1 15",
"output": "7"
},
{
"input": "1 16",
"output": "8"
},
{
"input": "2 5",
"outpu... | 1,696,096,053 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 35 | 122 | 0 | import sys
import bisect
input = sys.stdin.readline
def yes():
print("YES")
def no():
print("NO")
m, n = map(int, input().split())
s = m * n
print(s // 2) | Title: Domino piling
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
You are given a rectangular board of *M*<=×<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=×<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as p... | ```python
import sys
import bisect
input = sys.stdin.readline
def yes():
print("YES")
def no():
print("NO")
m, n = map(int, input().split())
s = m * n
print(s // 2)
``` | 3.9695 |
616 | A | Comparing Two Long Integers | PROGRAMMING | 900 | [
"implementation",
"strings"
] | null | null | You are given two very long integers *a*,<=*b* (leading zeroes are allowed). You should check what number *a* or *b* is greater or determine that they are equal.
The input size is very large so don't use the reading of symbols one by one. Instead of that use the reading of a whole line or token.
As input/output can r... | The first line contains a non-negative integer *a*.
The second line contains a non-negative integer *b*.
The numbers *a*,<=*b* may contain leading zeroes. Each of them contains no more than 106 digits. | Print the symbol "<" if *a*<=<<=*b* and the symbol ">" if *a*<=><=*b*. If the numbers are equal print the symbol "=". | [
"9\n10\n",
"11\n10\n",
"00012345\n12345\n",
"0123\n9\n",
"0123\n111\n"
] | [
"<\n",
">\n",
"=\n",
">\n",
">\n"
] | none | 0 | [
{
"input": "9\n10",
"output": "<"
},
{
"input": "11\n10",
"output": ">"
},
{
"input": "00012345\n12345",
"output": "="
},
{
"input": "0123\n9",
"output": ">"
},
{
"input": "0123\n111",
"output": ">"
},
{
"input": "9\n9",
"output": "="
},
{
... | 1,659,432,464 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 30 | 0 | #Python 2.7.17
a=input()
b=input()
if (a==b): print("=")
elif (a > b): print(">")
else: print("<") | Title: Comparing Two Long Integers
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given two very long integers *a*,<=*b* (leading zeroes are allowed). You should check what number *a* or *b* is greater or determine that they are equal.
The input size is very large so don't use th... | ```python
#Python 2.7.17
a=input()
b=input()
if (a==b): print("=")
elif (a > b): print(">")
else: print("<")
``` | 0 | |
954 | A | Diagonal Walking | PROGRAMMING | 800 | [
"implementation"
] | null | null | Mikhail walks on a 2D plane. He can go either up or right. You are given a sequence of Mikhail's moves. He thinks that this sequence is too long and he wants to make it as short as possible.
In the given sequence moving up is described by character U and moving right is described by character R. Mikhail can replace an... | The first line of the input contains one integer *n* (1<=≤<=*n*<=≤<=100) — the length of the sequence. The second line contains the sequence consisting of *n* characters U and R. | Print the minimum possible length of the sequence of moves after all replacements are done. | [
"5\nRUURU\n",
"17\nUUURRRRRUUURURUUU\n"
] | [
"3\n",
"13\n"
] | In the first test the shortened sequence of moves may be DUD (its length is 3).
In the second test the shortened sequence of moves can be UUDRRRDUDDUUU (its length is 13). | 0 | [
{
"input": "5\nRUURU",
"output": "3"
},
{
"input": "17\nUUURRRRRUUURURUUU",
"output": "13"
},
{
"input": "100\nUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU",
"output": "100"
},
{
"input": "100\nRRURRUUUURURRRURRRRURRRRRR... | 1,676,214,942 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 0 | 77 | 0 | n = int(input())
text = input()
indx = 0
result = ''
while indx < len(text):
result += text[indx]
result = result.replace('RU','D')
result = result.replace('UR','D')
indx += 1
print((result))
print(len(result)) | Title: Diagonal Walking
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Mikhail walks on a 2D plane. He can go either up or right. You are given a sequence of Mikhail's moves. He thinks that this sequence is too long and he wants to make it as short as possible.
In the given sequence movi... | ```python
n = int(input())
text = input()
indx = 0
result = ''
while indx < len(text):
result += text[indx]
result = result.replace('RU','D')
result = result.replace('UR','D')
indx += 1
print((result))
print(len(result))
``` | 0 | |
599 | C | Day at the Beach | PROGRAMMING | 1,600 | [
"sortings"
] | null | null | One day Squidward, Spongebob and Patrick decided to go to the beach. Unfortunately, the weather was bad, so the friends were unable to ride waves. However, they decided to spent their time building sand castles.
At the end of the day there were *n* castles built by friends. Castles are numbered from 1 to *n*, and the ... | The first line of the input contains a single integer *n* (1<=≤<=*n*<=≤<=100<=000) — the number of castles Spongebob, Patrick and Squidward made from sand during the day.
The next line contains *n* integers *h**i* (1<=≤<=*h**i*<=≤<=109). The *i*-th of these integers corresponds to the height of the *i*-th castle. | Print the maximum possible number of blocks in a valid partitioning. | [
"3\n1 2 3\n",
"4\n2 1 3 2\n"
] | [
"3\n",
"2\n"
] | In the first sample the partitioning looks like that: [1][2][3].
In the second sample the partitioning is: [2, 1][3, 2] | 1,500 | [
{
"input": "3\n1 2 3",
"output": "3"
},
{
"input": "4\n2 1 3 2",
"output": "2"
},
{
"input": "17\n1 45 22 39 28 23 23 100 500 778 777 778 1001 1002 1005 1003 1005",
"output": "10"
},
{
"input": "101\n1 50 170 148 214 153 132 234 181 188 180 225 226 200 197 122 181 168 87 220 ... | 1,675,922,741 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 2 | 46 | 0 | n = int(input())
a = list(map(int,input().split()))
if n%2==0:
print(n//2)
else:
print(n) | Title: Day at the Beach
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One day Squidward, Spongebob and Patrick decided to go to the beach. Unfortunately, the weather was bad, so the friends were unable to ride waves. However, they decided to spent their time building sand castles.
At th... | ```python
n = int(input())
a = list(map(int,input().split()))
if n%2==0:
print(n//2)
else:
print(n)
``` | 0 | |
342 | A | Xenia and Divisors | PROGRAMMING | 1,200 | [
"greedy",
"implementation"
] | null | null | Xenia the mathematician has a sequence consisting of *n* (*n* is divisible by 3) positive integers, each of them is at most 7. She wants to split the sequence into groups of three so that for each group of three *a*,<=*b*,<=*c* the following conditions held:
- *a*<=<<=*b*<=<<=*c*; - *a* divides *b*, *b* divide... | The first line contains integer *n* (3<=≤<=*n*<=≤<=99999) — the number of elements in the sequence. The next line contains *n* positive integers, each of them is at most 7.
It is guaranteed that *n* is divisible by 3. | If the required partition exists, print groups of three. Print each group as values of the elements it contains. You should print values in increasing order. Separate the groups and integers in groups by whitespaces. If there are multiple solutions, you can print any of them.
If there is no solution, print -1. | [
"6\n1 1 1 2 2 2\n",
"6\n2 2 1 1 4 6\n"
] | [
"-1\n",
"1 2 4\n1 2 6\n"
] | none | 500 | [
{
"input": "6\n1 1 1 2 2 2",
"output": "-1"
},
{
"input": "6\n2 2 1 1 4 6",
"output": "1 2 4\n1 2 6"
},
{
"input": "3\n1 2 3",
"output": "-1"
},
{
"input": "3\n7 5 7",
"output": "-1"
},
{
"input": "3\n1 3 4",
"output": "-1"
},
{
"input": "3\n1 1 1",
... | 1,640,276,149 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 0 | 31 | 0 | data = input()
street_cnt, prosp_cnt = data.split(" ")
selected_line = []
min_price = None
for n in range(int(street_cnt)):
line = [int(a) for a in input().split(" ")]
test_min = min(line)
if min_price is None or test_min > min_price:
min_price = test_min
print(min_price)
| Title: Xenia and Divisors
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Xenia the mathematician has a sequence consisting of *n* (*n* is divisible by 3) positive integers, each of them is at most 7. She wants to split the sequence into groups of three so that for each group of three *a*,... | ```python
data = input()
street_cnt, prosp_cnt = data.split(" ")
selected_line = []
min_price = None
for n in range(int(street_cnt)):
line = [int(a) for a in input().split(" ")]
test_min = min(line)
if min_price is None or test_min > min_price:
min_price = test_min
print(min_price)
... | -1 | |
10 | B | Cinema Cashier | PROGRAMMING | 1,500 | [
"dp",
"implementation"
] | B. Cinema Cashier | 1 | 256 | All cinema halls in Berland are rectangles with *K* rows of *K* seats each, and *K* is an odd number. Rows and seats are numbered from 1 to *K*. For safety reasons people, who come to the box office to buy tickets, are not allowed to choose seats themselves. Formerly the choice was made by a cashier, but now this is th... | The first line contains two integers *N* and *K* (1<=≤<=*N*<=≤<=1000,<=1<=≤<=*K*<=≤<=99) — the amount of requests and the hall size respectively. The second line contains *N* space-separated integers *M**i* from the range [1,<=*K*] — requests to the program. | Output *N* lines. In the *i*-th line output «-1» (without quotes), if it is impossible to find *M**i* successive seats in one row, otherwise output three numbers *x*,<=*y**l*,<=*y**r*. Separate the numbers with a space. | [
"2 1\n1 1\n",
"4 3\n1 2 3 1\n"
] | [
"1 1 1\n-1\n",
"2 2 2\n1 1 2\n3 1 3\n2 1 1\n"
] | none | 0 | [
{
"input": "2 1\n1 1",
"output": "1 1 1\n-1"
},
{
"input": "4 3\n1 2 3 1",
"output": "2 2 2\n1 1 2\n3 1 3\n2 1 1"
},
{
"input": "1 3\n1",
"output": "2 2 2"
},
{
"input": "2 3\n3 3",
"output": "2 1 3\n1 1 3"
},
{
"input": "3 3\n3 2 3",
"output": "2 1 3\n1 1 2\n... | 1,620,674,342 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 9 | 109 | 20,172,800 | n,k=list(map(int,input().split()))
a=list(map(int,input().split()))
b=[-1]*k
for m in a:
c=[-1]
for x in range(1,k+1):
j=x-1
if b[j]==-1:
yl=k//2+1-m//2
yr=yl+m-1
d=abs(x-k//2-1)*m+(yl+min(yr,k//2+1))//2*(min(yr,k//2+1)-yl+1)+((1+yr)//2)*max(0,yr-k//... | Title: Cinema Cashier
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
All cinema halls in Berland are rectangles with *K* rows of *K* seats each, and *K* is an odd number. Rows and seats are numbered from 1 to *K*. For safety reasons people, who come to the box office to buy tickets, are not a... | ```python
n,k=list(map(int,input().split()))
a=list(map(int,input().split()))
b=[-1]*k
for m in a:
c=[-1]
for x in range(1,k+1):
j=x-1
if b[j]==-1:
yl=k//2+1-m//2
yr=yl+m-1
d=abs(x-k//2-1)*m+(yl+min(yr,k//2+1))//2*(min(yr,k//2+1)-yl+1)+((1+yr)//2)*ma... | 0 |
107 | A | Dorm Water Supply | PROGRAMMING | 1,400 | [
"dfs and similar",
"graphs"
] | A. Dorm Water Supply | 1 | 256 | The German University in Cairo (GUC) dorm houses are numbered from 1 to *n*. Underground water pipes connect these houses together. Each pipe has certain direction (water can flow only in this direction and not vice versa), and diameter (which characterizes the maximal amount of water it can handle).
For each house, t... | The first line contains two space-separated integers *n* and *p* (1<=≤<=*n*<=≤<=1000,<=0<=≤<=*p*<=≤<=*n*) — the number of houses and the number of pipes correspondingly.
Then *p* lines follow — the description of *p* pipes. The *i*-th line contains three integers *a**i* *b**i* *d**i*, indicating a pipe of diameter *d... | Print integer *t* in the first line — the number of tank-tap pairs of houses.
For the next *t* lines, print 3 integers per line, separated by spaces: *tank**i*, *tap**i*, and *diameter**i*, where *tank**i*<=≠<=*tap**i* (1<=≤<=*i*<=≤<=*t*). Here *tank**i* and *tap**i* are indexes of tank and tap houses respectively, an... | [
"3 2\n1 2 10\n2 3 20\n",
"3 3\n1 2 20\n2 3 10\n3 1 5\n",
"4 2\n1 2 60\n3 4 50\n"
] | [
"1\n1 3 10\n",
"0\n",
"2\n1 2 60\n3 4 50\n"
] | none | 500 | [
{
"input": "3 2\n1 2 10\n2 3 20",
"output": "1\n1 3 10"
},
{
"input": "3 3\n1 2 20\n2 3 10\n3 1 5",
"output": "0"
},
{
"input": "4 2\n1 2 60\n3 4 50",
"output": "2\n1 2 60\n3 4 50"
},
{
"input": "10 10\n10 3 70\n1 9 98\n9 10 67\n5 2 78\n8 6 71\n4 8 95\n7 1 10\n2 5 73\n6 7 94\... | 1,573,218,549 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 0 | 109 | 0 | c=input()
w=input()
print('YES' if c[0] in w or c[1] in w else 'NO') | Title: Dorm Water Supply
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
The German University in Cairo (GUC) dorm houses are numbered from 1 to *n*. Underground water pipes connect these houses together. Each pipe has certain direction (water can flow only in this direction and not vice versa... | ```python
c=input()
w=input()
print('YES' if c[0] in w or c[1] in w else 'NO')
``` | 0 |
996 | A | Hit the Lottery | PROGRAMMING | 800 | [
"dp",
"greedy"
] | null | null | Allen has a LOT of money. He has $n$ dollars in the bank. For security reasons, he wants to withdraw it in cash (we will not disclose the reasons here). The denominations for dollar bills are $1$, $5$, $10$, $20$, $100$. What is the minimum number of bills Allen could receive after withdrawing his entire balance? | The first and only line of input contains a single integer $n$ ($1 \le n \le 10^9$). | Output the minimum number of bills that Allen could receive. | [
"125\n",
"43\n",
"1000000000\n"
] | [
"3\n",
"5\n",
"10000000\n"
] | In the first sample case, Allen can withdraw this with a $100$ dollar bill, a $20$ dollar bill, and a $5$ dollar bill. There is no way for Allen to receive $125$ dollars in one or two bills.
In the second sample case, Allen can withdraw two $20$ dollar bills and three $1$ dollar bills.
In the third sample case, Allen... | 500 | [
{
"input": "125",
"output": "3"
},
{
"input": "43",
"output": "5"
},
{
"input": "1000000000",
"output": "10000000"
},
{
"input": "4",
"output": "4"
},
{
"input": "5",
"output": "1"
},
{
"input": "1",
"output": "1"
},
{
"input": "74",
"o... | 1,683,737,022 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 2 | 1,000 | 0 | n = int(input())
s=0
while n>0:
s+=1
if n - 100>=0:
n-=100
elif n-20>=0:
n-=20
elif n-10>=0:
n-=10
elif n-5>=0:
n-=5
else:
n-=1
print(s) | Title: Hit the Lottery
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Allen has a LOT of money. He has $n$ dollars in the bank. For security reasons, he wants to withdraw it in cash (we will not disclose the reasons here). The denominations for dollar bills are $1$, $5$, $10$, $20$, $100$... | ```python
n = int(input())
s=0
while n>0:
s+=1
if n - 100>=0:
n-=100
elif n-20>=0:
n-=20
elif n-10>=0:
n-=10
elif n-5>=0:
n-=5
else:
n-=1
print(s)
``` | 0 | |
148 | A | Insomnia cure | PROGRAMMING | 800 | [
"constructive algorithms",
"implementation",
"math"
] | null | null | «One dragon. Two dragon. Three dragon», — the princess was counting. She had trouble falling asleep, and she got bored of counting lambs when she was nine.
However, just counting dragons was boring as well, so she entertained herself at best she could. Tonight she imagined that all dragons were here to steal her, and ... | Input data contains integer numbers *k*,<=*l*,<=*m*,<=*n* and *d*, each number in a separate line (1<=≤<=*k*,<=*l*,<=*m*,<=*n*<=≤<=10, 1<=≤<=*d*<=≤<=105). | Output the number of damaged dragons. | [
"1\n2\n3\n4\n12\n",
"2\n3\n4\n5\n24\n"
] | [
"12\n",
"17\n"
] | In the first case every first dragon got punched with a frying pan. Some of the dragons suffered from other reasons as well, but the pan alone would be enough.
In the second case dragons 1, 7, 11, 13, 17, 19 and 23 escaped unharmed. | 1,000 | [
{
"input": "1\n2\n3\n4\n12",
"output": "12"
},
{
"input": "2\n3\n4\n5\n24",
"output": "17"
},
{
"input": "1\n1\n1\n1\n100000",
"output": "100000"
},
{
"input": "10\n9\n8\n7\n6",
"output": "0"
},
{
"input": "8\n4\n4\n3\n65437",
"output": "32718"
},
{
"i... | 1,698,369,225 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 1 | 60 | 0 | num=[]
list1=[]
dragon=[]
for i in range(5):
a=input()
num.append(int(a))
for j in range(1,num[4]+1):
list1.append(int(j))
for x in num[0:4]:
for j in list1:
if j % num[0] == 0 :
list1.remove(j)
print(num[4]-len(list1)) | Title: Insomnia cure
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
«One dragon. Two dragon. Three dragon», — the princess was counting. She had trouble falling asleep, and she got bored of counting lambs when she was nine.
However, just counting dragons was boring as well, so she entert... | ```python
num=[]
list1=[]
dragon=[]
for i in range(5):
a=input()
num.append(int(a))
for j in range(1,num[4]+1):
list1.append(int(j))
for x in num[0:4]:
for j in list1:
if j % num[0] == 0 :
list1.remove(j)
print(num[4]-len(list1))
``` | 0 | |
913 | B | Christmas Spruce | PROGRAMMING | 1,200 | [
"implementation",
"trees"
] | null | null | Consider a rooted tree. A rooted tree has one special vertex called the root. All edges are directed from the root. Vertex *u* is called a child of vertex *v* and vertex *v* is called a parent of vertex *u* if there exists a directed edge from *v* to *u*. A vertex is called a leaf if it doesn't have children and has a ... | The first line contains one integer *n* — the number of vertices in the tree (3<=≤<=*n*<=≤<=1<=000). Each of the next *n*<=-<=1 lines contains one integer *p**i* (1<=≤<=*i*<=≤<=*n*<=-<=1) — the index of the parent of the *i*<=+<=1-th vertex (1<=≤<=*p**i*<=≤<=*i*).
Vertex 1 is the root. It's guaranteed that the root ha... | Print "Yes" if the tree is a spruce and "No" otherwise. | [
"4\n1\n1\n1\n",
"7\n1\n1\n1\n2\n2\n2\n",
"8\n1\n1\n1\n1\n3\n3\n3\n"
] | [
"Yes\n",
"No\n",
"Yes\n"
] | The first example:
<img class="tex-graphics" src="https://espresso.codeforces.com/8dd976913226df83d535dfa66193f5525f8471bc.png" style="max-width: 100.0%;max-height: 100.0%;"/>
The second example:
<img class="tex-graphics" src="https://espresso.codeforces.com/44dad5804f5290a2e026c9c41a15151562df8682.png" style="max-w... | 750 | [
{
"input": "4\n1\n1\n1",
"output": "Yes"
},
{
"input": "7\n1\n1\n1\n2\n2\n2",
"output": "No"
},
{
"input": "8\n1\n1\n1\n1\n3\n3\n3",
"output": "Yes"
},
{
"input": "3\n1\n1",
"output": "No"
},
{
"input": "13\n1\n2\n2\n2\n1\n6\n6\n6\n1\n10\n10\n10",
"output": "N... | 1,623,779,074 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 5 | 92 | 1,433,600 | n= int(input())
ls=[]
for i in range(n):
ls.append([])
for i in range(2,n+1):
j=int(input())
ls[j-1].append(i)
for i in ls:
for j in i:
if ls[j-1]:
i.remove(j)
ls = list(filter(([]).__ne__, ls))
if len(min(ls))<3:
print('No')
else:
print('Yes') | Title: Christmas Spruce
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Consider a rooted tree. A rooted tree has one special vertex called the root. All edges are directed from the root. Vertex *u* is called a child of vertex *v* and vertex *v* is called a parent of vertex *u* if there ex... | ```python
n= int(input())
ls=[]
for i in range(n):
ls.append([])
for i in range(2,n+1):
j=int(input())
ls[j-1].append(i)
for i in ls:
for j in i:
if ls[j-1]:
i.remove(j)
ls = list(filter(([]).__ne__, ls))
if len(min(ls))<3:
print('No')
else:
print... | 0 | |
391 | A | Genetic Engineering | PROGRAMMING | 0 | [
"implementation",
"two pointers"
] | null | null | You will receive 3 points for solving this problem.
Manao is designing the genetic code for a new type of algae to efficiently produce fuel. Specifically, Manao is focusing on a stretch of DNA that encodes one protein. The stretch of DNA is represented by a string containing only the characters 'A', 'T', 'G' and 'C'.
... | The input consists of a single line, containing a string *s* of length *n* (1<=≤<=*n*<=≤<=100). Each character of *s* will be from the set {'A', 'T', 'G', 'C'}.
This problem doesn't have subproblems. You will get 3 points for the correct submission. | The program should print on one line a single integer representing the minimum number of 'A', 'T', 'G', 'C' characters that are required to be inserted into the input string in order to make all runs of identical characters have odd length. | [
"GTTAAAG\n",
"AACCAACCAAAAC\n"
] | [
"1\n",
"5\n"
] | In the first example, it is sufficient to insert a single nucleotide of any type between the two 'T's in the sequence to restore the functionality of the protein. | 3 | [
{
"input": "GTTAAAG",
"output": "1"
},
{
"input": "AACCAACCAAAAC",
"output": "5"
},
{
"input": "GTGAATTTCC",
"output": "2"
},
{
"input": "CAGGGGGCCGCCCATGAAAAAAACCCGGCCCCTTGGGAAAACTTGGGTTA",
"output": "7"
},
{
"input": "CCCTTCACCCGGATCCAAATCCCTTAGAAATAATCCCCGACGGC... | 1,525,667,130 | 2,147,483,647 | PyPy 3 | OK | TESTS | 20 | 93 | 21,401,600 | R = lambda: map(int, input().split())
s = input()
cc, c = 0, 0
for r in range(len(s)):
if r == 0 or s[r] == s[r - 1]:
c += 1
else:
cc += (c % 2 == 0)
c = 1
cc += (c % 2 == 0)
print(cc) | Title: Genetic Engineering
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You will receive 3 points for solving this problem.
Manao is designing the genetic code for a new type of algae to efficiently produce fuel. Specifically, Manao is focusing on a stretch of DNA that encodes one prot... | ```python
R = lambda: map(int, input().split())
s = input()
cc, c = 0, 0
for r in range(len(s)):
if r == 0 or s[r] == s[r - 1]:
c += 1
else:
cc += (c % 2 == 0)
c = 1
cc += (c % 2 == 0)
print(cc)
``` | 3 | |
828 | A | Restaurant Tables | PROGRAMMING | 1,200 | [
"implementation"
] | null | null | In a small restaurant there are *a* tables for one person and *b* tables for two persons.
It it known that *n* groups of people come today, each consisting of one or two people.
If a group consist of one person, it is seated at a vacant one-seater table. If there are none of them, it is seated at a vacant two-seate... | The first line contains three integers *n*, *a* and *b* (1<=≤<=*n*<=≤<=2·105, 1<=≤<=*a*,<=*b*<=≤<=2·105) — the number of groups coming to the restaurant, the number of one-seater and the number of two-seater tables.
The second line contains a sequence of integers *t*1,<=*t*2,<=...,<=*t**n* (1<=≤<=*t**i*<=≤<=2) — the d... | Print the total number of people the restaurant denies service to. | [
"4 1 2\n1 2 1 1\n",
"4 1 1\n1 1 2 1\n"
] | [
"0\n",
"2\n"
] | In the first example the first group consists of one person, it is seated at a vacant one-seater table. The next group occupies a whole two-seater table. The third group consists of one person, it occupies one place at the remaining two-seater table. The fourth group consists of one person, he is seated at the remainin... | 500 | [
{
"input": "4 1 2\n1 2 1 1",
"output": "0"
},
{
"input": "4 1 1\n1 1 2 1",
"output": "2"
},
{
"input": "1 1 1\n1",
"output": "0"
},
{
"input": "2 1 2\n2 2",
"output": "0"
},
{
"input": "5 1 3\n1 2 2 2 1",
"output": "1"
},
{
"input": "7 6 1\n1 1 1 1 1 1... | 1,499,791,741 | 241 | Python 3 | OK | TESTS | 97 | 155 | 8,499,200 | n, a, b = map(int, input().split())
c = 0
ans = 0
for v in map(int, input().split()):
if v == 1:
if a:
a -= 1
elif b:
b -= 1
c += 1
elif c:
c -= 1
else:
ans += 1
else:
if b:
b -= 1
else:
ans += 2
print(ans) | Title: Restaurant Tables
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In a small restaurant there are *a* tables for one person and *b* tables for two persons.
It it known that *n* groups of people come today, each consisting of one or two people.
If a group consist of one person, i... | ```python
n, a, b = map(int, input().split())
c = 0
ans = 0
for v in map(int, input().split()):
if v == 1:
if a:
a -= 1
elif b:
b -= 1
c += 1
elif c:
c -= 1
else:
ans += 1
else:
if b:
b -= 1
else:
ans += 2
print(ans)
``` | 3 | |
137 | A | Postcards and photos | PROGRAMMING | 900 | [
"implementation"
] | null | null | Polycarpus has postcards and photos hung in a row on the wall. He decided to put them away to the closet and hang on the wall a famous painter's picture. Polycarpus does it like that: he goes from the left to the right and removes the objects consecutively. As Polycarpus doesn't want any mix-ups to happen, he will not ... | The only line of the input data contains a non-empty string consisting of letters "С" and "P" whose length does not exceed 100 characters. If the *i*-th character in the string is the letter "С", that means that the *i*-th object (the numbering goes from the left to the right) on Polycarpus' wall is a postcard. And if ... | Print the only number — the minimum number of times Polycarpus has to visit the closet. | [
"CPCPCPC\n",
"CCCCCCPPPPPP\n",
"CCCCCCPPCPPPPPPPPPP\n",
"CCCCCCCCCC\n"
] | [
"7\n",
"4\n",
"6\n",
"2\n"
] | In the first sample Polycarpus needs to take one item to the closet 7 times.
In the second sample Polycarpus can first take 3 postcards to the closet; then 3 more. He can take the 6 photos that are left in the similar way, going to the closet twice.
In the third sample Polycarpus can visit the closet twice, both time... | 500 | [
{
"input": "CPCPCPC",
"output": "7"
},
{
"input": "CCCCCCPPPPPP",
"output": "4"
},
{
"input": "CCCCCCPPCPPPPPPPPPP",
"output": "6"
},
{
"input": "CCCCCCCCCC",
"output": "2"
},
{
"input": "CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC... | 1,517,679,075 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 4 | 92 | 5,632,000 | x=input()
p=0
alist=[]
if x[0]=='P':
p+=1
elif x[0]=='C':
p-=1
for i in range(1,len(x)):
if x[i]==x[i-1]=='P':
p+=1
elif x[i]==x[i-1]=='C':
p-=1
elif x[i]!=x[i-1] and x[i]=='P':
alist.append(p)
p = 1
elif x[i] != x[i - 1] and x[i] == 'C':
a... | Title: Postcards and photos
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Polycarpus has postcards and photos hung in a row on the wall. He decided to put them away to the closet and hang on the wall a famous painter's picture. Polycarpus does it like that: he goes from the left to the r... | ```python
x=input()
p=0
alist=[]
if x[0]=='P':
p+=1
elif x[0]=='C':
p-=1
for i in range(1,len(x)):
if x[i]==x[i-1]=='P':
p+=1
elif x[i]==x[i-1]=='C':
p-=1
elif x[i]!=x[i-1] and x[i]=='P':
alist.append(p)
p = 1
elif x[i] != x[i - 1] and x[i] == 'C':
... | 0 | |
897 | A | Scarborough Fair | PROGRAMMING | 800 | [
"implementation"
] | null | null | Parsley, sage, rosemary and thyme.
Remember me to one who lives there.
He once was the true love of mine.
Willem is taking the girl to the highest building in island No.28, however, neither of them knows how to get there.
Willem asks his friend, Grick for directions, Grick helped them, and gave them a task.
Althou... | The first line contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100).
The second line contains a string *s* of length *n*, consisting of lowercase English letters.
Each of the next *m* lines contains four parameters *l*,<=*r*,<=*c*1,<=*c*2 (1<=≤<=*l*<=≤<=*r*<=≤<=*n*, *c*1,<=*c*2 are lowercase English letters), ... | Output string *s* after performing *m* operations described above. | [
"3 1\nioi\n1 1 i n\n",
"5 3\nwxhak\n3 3 h x\n1 5 x a\n1 3 w g\n"
] | [
"noi",
"gaaak"
] | For the second example:
After the first operation, the string is wxxak.
After the second operation, the string is waaak.
After the third operation, the string is gaaak. | 500 | [
{
"input": "3 1\nioi\n1 1 i n",
"output": "noi"
},
{
"input": "5 3\nwxhak\n3 3 h x\n1 5 x a\n1 3 w g",
"output": "gaaak"
},
{
"input": "9 51\nbhfbdcgff\n2 3 b b\n2 8 e f\n3 8 g f\n5 7 d a\n1 5 e b\n3 4 g b\n6 7 c d\n3 6 e g\n3 6 e h\n5 6 a e\n7 9 a c\n4 9 a h\n3 7 c b\n6 9 b g\n1 7 h b\n... | 1,546,525,329 | 2,147,483,647 | Python 3 | OK | TESTS | 47 | 109 | 0 | a = list(map(int,input().split()))
n = a[0]
m = a[1]
s = input()
q = []
for i in range(n):
q.append(s[i])
for x in range(m):
d = list(input().split())
l = int(d[0])
r = int(d[1])
c1 = d[2]
c2 = d[3]
for c in range(l,r+1):
if q[c-1] == c1:
q[c-1] = c2
for p... | Title: Scarborough Fair
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Parsley, sage, rosemary and thyme.
Remember me to one who lives there.
He once was the true love of mine.
Willem is taking the girl to the highest building in island No.28, however, neither of them knows how to get ... | ```python
a = list(map(int,input().split()))
n = a[0]
m = a[1]
s = input()
q = []
for i in range(n):
q.append(s[i])
for x in range(m):
d = list(input().split())
l = int(d[0])
r = int(d[1])
c1 = d[2]
c2 = d[3]
for c in range(l,r+1):
if q[c-1] == c1:
q[c-1] =... | 3 | |
266 | A | Stones on the Table | PROGRAMMING | 800 | [
"implementation"
] | null | null | There are *n* stones on the table in a row, each of them can be red, green or blue. Count the minimum number of stones to take from the table so that any two neighboring stones had different colors. Stones in a row are considered neighboring if there are no other stones between them. | The first line contains integer *n* (1<=≤<=*n*<=≤<=50) — the number of stones on the table.
The next line contains string *s*, which represents the colors of the stones. We'll consider the stones in the row numbered from 1 to *n* from left to right. Then the *i*-th character *s* equals "R", if the *i*-th stone is red... | Print a single integer — the answer to the problem. | [
"3\nRRG\n",
"5\nRRRRR\n",
"4\nBRBG\n"
] | [
"1\n",
"4\n",
"0\n"
] | none | 500 | [
{
"input": "3\nRRG",
"output": "1"
},
{
"input": "5\nRRRRR",
"output": "4"
},
{
"input": "4\nBRBG",
"output": "0"
},
{
"input": "1\nB",
"output": "0"
},
{
"input": "2\nBG",
"output": "0"
},
{
"input": "3\nBGB",
"output": "0"
},
{
"input": "... | 1,695,761,337 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 34 | 124 | 28,774,400 | number_or_stones = int(input())
prom = input()
cel = []
for i in range(number_or_stones):
cel.append(prom[i])
caser = 0
for j in range(1, number_or_stones):
if cel[j - 1] == cel[j]:
caser += 1
print(caser) | Title: Stones on the Table
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There are *n* stones on the table in a row, each of them can be red, green or blue. Count the minimum number of stones to take from the table so that any two neighboring stones had different colors. Stones in a row ... | ```python
number_or_stones = int(input())
prom = input()
cel = []
for i in range(number_or_stones):
cel.append(prom[i])
caser = 0
for j in range(1, number_or_stones):
if cel[j - 1] == cel[j]:
caser += 1
print(caser)
``` | 3 | |
919 | B | Perfect Number | PROGRAMMING | 1,100 | [
"binary search",
"brute force",
"dp",
"implementation",
"number theory"
] | null | null | We consider a positive integer perfect, if and only if the sum of its digits is exactly $10$. Given a positive integer $k$, your task is to find the $k$-th smallest perfect positive integer. | A single line with a positive integer $k$ ($1 \leq k \leq 10\,000$). | A single number, denoting the $k$-th smallest perfect integer. | [
"1\n",
"2\n"
] | [
"19\n",
"28\n"
] | The first perfect integer is $19$ and the second one is $28$. | 750 | [
{
"input": "1",
"output": "19"
},
{
"input": "2",
"output": "28"
},
{
"input": "13",
"output": "136"
},
{
"input": "101",
"output": "1432"
},
{
"input": "1023",
"output": "100270"
},
{
"input": "9999",
"output": "10800010"
},
{
"input": "10... | 1,689,494,736 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 35 | 249 | 2,969,600 | import sys
def input(): return sys.stdin.readline().strip()
def getints(): return map(int,sys.stdin.readline().strip().split())
n = int(input())
ans = 19
i = 1
while i < n:
ans += 9
if sum(map(int,str(ans))) == 10: i+= 1
print(ans) | Title: Perfect Number
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
We consider a positive integer perfect, if and only if the sum of its digits is exactly $10$. Given a positive integer $k$, your task is to find the $k$-th smallest perfect positive integer.
Input Specification:
A singl... | ```python
import sys
def input(): return sys.stdin.readline().strip()
def getints(): return map(int,sys.stdin.readline().strip().split())
n = int(input())
ans = 19
i = 1
while i < n:
ans += 9
if sum(map(int,str(ans))) == 10: i+= 1
print(ans)
``` | 3 | |
554 | B | Ohana Cleans Up | PROGRAMMING | 1,200 | [
"brute force",
"greedy",
"strings"
] | null | null | Ohana Matsumae is trying to clean a room, which is divided up into an *n* by *n* grid of squares. Each square is initially either clean or dirty. Ohana can sweep her broom over columns of the grid. Her broom is very strange: if she sweeps over a clean square, it will become dirty, and if she sweeps over a dirty square,... | The first line of input will be a single integer *n* (1<=≤<=*n*<=≤<=100).
The next *n* lines will describe the state of the room. The *i*-th line will contain a binary string with *n* characters denoting the state of the *i*-th row of the room. The *j*-th character on this line is '1' if the *j*-th square in the *i*-t... | The output should be a single line containing an integer equal to a maximum possible number of rows that are completely clean. | [
"4\n0101\n1000\n1111\n0101\n",
"3\n111\n111\n111\n"
] | [
"2\n",
"3\n"
] | In the first sample, Ohana can sweep the 1st and 3rd columns. This will make the 1st and 4th row be completely clean.
In the second sample, everything is already clean, so Ohana doesn't need to do anything. | 500 | [
{
"input": "4\n0101\n1000\n1111\n0101",
"output": "2"
},
{
"input": "3\n111\n111\n111",
"output": "3"
},
{
"input": "10\n0100000000\n0000000000\n0000000000\n0000000000\n0000000000\n0000000000\n0000000000\n0000000000\n0000000000\n0000000000",
"output": "9"
},
{
"input": "1\n1"... | 1,551,027,131 | 2,147,483,647 | Python 3 | OK | TESTS | 36 | 109 | 0 | n = int(input())
grid = [input() for i in range(n)]
print(max([grid.count(i) for i in set(grid)]))
| Title: Ohana Cleans Up
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Ohana Matsumae is trying to clean a room, which is divided up into an *n* by *n* grid of squares. Each square is initially either clean or dirty. Ohana can sweep her broom over columns of the grid. Her broom is very str... | ```python
n = int(input())
grid = [input() for i in range(n)]
print(max([grid.count(i) for i in set(grid)]))
``` | 3 | |
49 | A | Sleuth | PROGRAMMING | 800 | [
"implementation"
] | A. Sleuth | 2 | 256 | Vasya plays the sleuth with his friends. The rules of the game are as follows: those who play for the first time, that is Vasya is the sleuth, he should investigate a "crime" and find out what is happening. He can ask any questions whatsoever that can be answered with "Yes" or "No". All the rest agree beforehand to ans... | The single line contains a question represented by a non-empty line consisting of large and small Latin letters, spaces and a question mark. The line length does not exceed 100. It is guaranteed that the question mark occurs exactly once in the line — as the last symbol and that the line contains at least one letter. | Print answer for the question in a single line: YES if the answer is "Yes", NO if the answer is "No".
Remember that in the reply to the question the last letter, not the last character counts. I. e. the spaces and the question mark do not count as letters. | [
"Is it a melon?\n",
"Is it an apple?\n",
"Is it a banana ?\n",
"Is it an apple and a banana simultaneouSLY?\n"
] | [
"NO\n",
"YES\n",
"YES\n",
"YES\n"
] | none | 500 | [
{
"input": "Is it a melon?",
"output": "NO"
},
{
"input": "Is it an apple?",
"output": "YES"
},
{
"input": " Is it a banana ?",
"output": "YES"
},
{
"input": "Is it an apple and a banana simultaneouSLY?",
"output": "YES"
},
{
"input": "oHtSbDwzHb?",
... | 1,659,764,450 | 2,147,483,647 | Python 3 | OK | TESTS | 35 | 122 | 0 | a=['a','e','i','o','u','y']
s=input().lower()
if s[-2]==" ":
s=s.replace(" ",'')
# print(s)
if s[-2] in a:
print("YES")
else:
print("NO")
| Title: Sleuth
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya plays the sleuth with his friends. The rules of the game are as follows: those who play for the first time, that is Vasya is the sleuth, he should investigate a "crime" and find out what is happening. He can ask any questions ... | ```python
a=['a','e','i','o','u','y']
s=input().lower()
if s[-2]==" ":
s=s.replace(" ",'')
# print(s)
if s[-2] in a:
print("YES")
else:
print("NO")
``` | 3.9695 |
96 | A | Football | PROGRAMMING | 900 | [
"implementation",
"strings"
] | A. Football | 2 | 256 | Petya loves football very much. One day, as he was watching a football match, he was writing the players' current positions on a piece of paper. To simplify the situation he depicted it as a string consisting of zeroes and ones. A zero corresponds to players of one team; a one corresponds to players of another team. If... | The first input line contains a non-empty string consisting of characters "0" and "1", which represents players. The length of the string does not exceed 100 characters. There's at least one player from each team present on the field. | Print "YES" if the situation is dangerous. Otherwise, print "NO". | [
"001001\n",
"1000000001\n"
] | [
"NO\n",
"YES\n"
] | none | 500 | [
{
"input": "001001",
"output": "NO"
},
{
"input": "1000000001",
"output": "YES"
},
{
"input": "00100110111111101",
"output": "YES"
},
{
"input": "11110111111111111",
"output": "YES"
},
{
"input": "01",
"output": "NO"
},
{
"input": "10100101",
"outp... | 1,696,931,624 | 2,147,483,647 | Python 3 | OK | TESTS | 44 | 92 | 0 | s=input()
s=list(s)
c1=c0=0
if s[0]=="1":
c1+=1
else:
c0+=1
f=False
for i in range(1,len(s)):
if s[i]=="1" and s[i-1]=="1":
c1+=1
if c1>=7:
print("YES")
f=True
break
if s[i]=="0" and s[i-1]=="0":
c0+=1
if c0>=7:
print("YES")... | Title: Football
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Petya loves football very much. One day, as he was watching a football match, he was writing the players' current positions on a piece of paper. To simplify the situation he depicted it as a string consisting of zeroes and ones. A... | ```python
s=input()
s=list(s)
c1=c0=0
if s[0]=="1":
c1+=1
else:
c0+=1
f=False
for i in range(1,len(s)):
if s[i]=="1" and s[i-1]=="1":
c1+=1
if c1>=7:
print("YES")
f=True
break
if s[i]=="0" and s[i-1]=="0":
c0+=1
if c0>=7:
pr... | 3.977 |
412 | B | Network Configuration | PROGRAMMING | 900 | [
"greedy",
"sortings"
] | null | null | The R1 company wants to hold a web search championship. There were *n* computers given for the competition, each of them is connected to the Internet. The organizers believe that the data transfer speed directly affects the result. The higher the speed of the Internet is, the faster the participant will find the necess... | The first line contains two space-separated integers *n* and *k* (1<=≤<=*k*<=≤<=*n*<=≤<=100) — the number of computers and the number of participants, respectively. In the second line you have a space-separated sequence consisting of *n* integers: *a*1,<=*a*2,<=...,<=*a**n* (16<=≤<=*a**i*<=≤<=32768); number *a**i* deno... | Print a single integer — the maximum Internet speed value. It is guaranteed that the answer to the problem is always an integer. | [
"3 2\n40 20 30\n",
"6 4\n100 20 40 20 50 50\n"
] | [
"30\n",
"40\n"
] | In the first test case the organizers can cut the first computer's speed to 30 kilobits. Then two computers (the first and the third one) will have the same speed of 30 kilobits. They should be used as the participants' computers. This answer is optimal. | 1,000 | [
{
"input": "3 2\n40 20 30",
"output": "30"
},
{
"input": "6 4\n100 20 40 20 50 50",
"output": "40"
},
{
"input": "1 1\n16",
"output": "16"
},
{
"input": "2 1\n10000 17",
"output": "10000"
},
{
"input": "2 2\n200 300",
"output": "200"
},
{
"input": "3 1... | 1,657,752,761 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 1 | 30 | 0 | n, k = map(int, input().split())
speed = input().split()
speed.sort()
if n - k < 1:
print(speed[0])
else:
print(speed[n - k]) | Title: Network Configuration
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The R1 company wants to hold a web search championship. There were *n* computers given for the competition, each of them is connected to the Internet. The organizers believe that the data transfer speed directly a... | ```python
n, k = map(int, input().split())
speed = input().split()
speed.sort()
if n - k < 1:
print(speed[0])
else:
print(speed[n - k])
``` | 0 | |
443 | A | Anton and Letters | PROGRAMMING | 800 | [
"constructive algorithms",
"implementation"
] | null | null | Recently, Anton has found a set. The set consists of small English letters. Anton carefully wrote out all the letters from the set in one line, separated by a comma. He also added an opening curved bracket at the beginning of the line and a closing curved bracket at the end of the line.
Unfortunately, from time to ti... | The first and the single line contains the set of letters. The length of the line doesn't exceed 1000. It is guaranteed that the line starts from an opening curved bracket and ends with a closing curved bracket. Between them, small English letters are listed, separated by a comma. Each comma is followed by a space. | Print a single number — the number of distinct letters in Anton's set. | [
"{a, b, c}\n",
"{b, a, b, a}\n",
"{}\n"
] | [
"3\n",
"2\n",
"0\n"
] | none | 500 | [
{
"input": "{a, b, c}",
"output": "3"
},
{
"input": "{b, a, b, a}",
"output": "2"
},
{
"input": "{}",
"output": "0"
},
{
"input": "{a, a, c, b, b, b, c, c, c, c}",
"output": "3"
},
{
"input": "{a, c, b, b}",
"output": "3"
},
{
"input": "{a, b}",
"o... | 1,693,416,284 | 2,147,483,647 | PyPy 3-64 | RUNTIME_ERROR | TESTS | 0 | 77 | 2,764,800 | s = input()
letters = [letter.split() for letter in s[1:-1].split(",")]
distinct = set(letters)
print(len(distinct))
| Title: Anton and Letters
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Recently, Anton has found a set. The set consists of small English letters. Anton carefully wrote out all the letters from the set in one line, separated by a comma. He also added an opening curved bracket at the begi... | ```python
s = input()
letters = [letter.split() for letter in s[1:-1].split(",")]
distinct = set(letters)
print(len(distinct))
``` | -1 | |
909 | C | Python Indentation | PROGRAMMING | 1,800 | [
"dp"
] | null | null | In Python, code blocks don't have explicit begin/end or curly braces to mark beginning and end of the block. Instead, code blocks are defined by indentation.
We will consider an extremely simplified subset of Python with only two types of statements.
Simple statements are written in a single line, one per line. An ex... | The first line contains a single integer *N* (1<=≤<=*N*<=≤<=5000) — the number of commands in the program. *N* lines of the program follow, each line describing a single command. Each command is either "f" (denoting "for statement") or "s" ("simple statement"). It is guaranteed that the last line is a simple statement. | Output one line containing an integer - the number of ways the given sequence of statements can be indented modulo 109<=+<=7. | [
"4\ns\nf\nf\ns\n",
"4\nf\ns\nf\ns\n"
] | [
"1\n",
"2\n"
] | In the first test case, there is only one way to indent the program: the second for statement must be part of the body of the first one.
In the second test case, there are two ways to indent the program: the second for statement can either be part of the first one's body or a separate statement following the first one... | 1,500 | [
{
"input": "4\ns\nf\nf\ns",
"output": "1"
},
{
"input": "4\nf\ns\nf\ns",
"output": "2"
},
{
"input": "156\nf\ns\nf\ns\nf\ns\ns\ns\ns\nf\ns\ns\nf\nf\ns\nf\nf\nf\nf\ns\ns\ns\nf\ns\ns\nf\nf\nf\nf\nf\nf\ns\ns\ns\ns\nf\ns\nf\ns\nf\ns\nf\nf\nf\nf\ns\ns\nf\nf\ns\ns\ns\ns\nf\ns\nf\ns\nf\ns\nf\ns... | 1,516,029,302 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 2 | 77 | 6,041,600 | x=int(input())
l2=[]
from copy import deepcopy
for i in range(x):
l2.append(input())
b=deepcopy(l2)
i=x-1;c=0
while i!=0:
j=i
if l2[j]=='f' and l2[j-1]=='f':
while l2[j]=='f' and l2[j-1]=='f':
b.pop(i)
j-=1
c+=1
i=j
i-=1
for i in range(len(b)-1,0,-1):
if b[i]=='s' :
c+=b[:i-1]... | Title: Python Indentation
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In Python, code blocks don't have explicit begin/end or curly braces to mark beginning and end of the block. Instead, code blocks are defined by indentation.
We will consider an extremely simplified subset of Python... | ```python
x=int(input())
l2=[]
from copy import deepcopy
for i in range(x):
l2.append(input())
b=deepcopy(l2)
i=x-1;c=0
while i!=0:
j=i
if l2[j]=='f' and l2[j-1]=='f':
while l2[j]=='f' and l2[j-1]=='f':
b.pop(i)
j-=1
c+=1
i=j
i-=1
for i in range(len(b)-1,0,-1):
if b[i]=='s' :
... | 0 | |
903 | C | Boxes Packing | PROGRAMMING | 1,200 | [
"greedy"
] | null | null | Mishka has got *n* empty boxes. For every *i* (1<=≤<=*i*<=≤<=*n*), *i*-th box is a cube with side length *a**i*.
Mishka can put a box *i* into another box *j* if the following conditions are met:
- *i*-th box is not put into another box; - *j*-th box doesn't contain any other boxes; - box *i* is smaller than box *... | The first line contains one integer *n* (1<=≤<=*n*<=≤<=5000) — the number of boxes Mishka has got.
The second line contains *n* integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=109), where *a**i* is the side length of *i*-th box. | Print the minimum possible number of visible boxes. | [
"3\n1 2 3\n",
"4\n4 2 4 3\n"
] | [
"1\n",
"2\n"
] | In the first example it is possible to put box 1 into box 2, and 2 into 3.
In the second example Mishka can put box 2 into box 3, and box 4 into box 1. | 0 | [
{
"input": "3\n1 2 3",
"output": "1"
},
{
"input": "4\n4 2 4 3",
"output": "2"
},
{
"input": "10\n58 58 58 58 58 58 58 58 58 58",
"output": "10"
},
{
"input": "10\n86 89 89 86 86 89 86 86 89 89",
"output": "5"
},
{
"input": "100\n981 288 186 186 292 876 341 288 98... | 1,647,282,558 | 2,147,483,647 | Python 3 | OK | TESTS | 24 | 46 | 102,400 | n = input()
dic = {}
l = list(input().split())
for x in l:
if x in dic:
dic[x]+=1
else:
dic[x]=1
print(max(dic.values())) | Title: Boxes Packing
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Mishka has got *n* empty boxes. For every *i* (1<=≤<=*i*<=≤<=*n*), *i*-th box is a cube with side length *a**i*.
Mishka can put a box *i* into another box *j* if the following conditions are met:
- *i*-th box is not pu... | ```python
n = input()
dic = {}
l = list(input().split())
for x in l:
if x in dic:
dic[x]+=1
else:
dic[x]=1
print(max(dic.values()))
``` | 3 | |
670 | A | Holidays | PROGRAMMING | 900 | [
"brute force",
"constructive algorithms",
"greedy",
"math"
] | null | null | On the planet Mars a year lasts exactly *n* days (there are no leap years on Mars). But Martians have the same weeks as earthlings — 5 work days and then 2 days off. Your task is to determine the minimum possible and the maximum possible number of days off per year on Mars. | The first line of the input contains a positive integer *n* (1<=≤<=*n*<=≤<=1<=000<=000) — the number of days in a year on Mars. | Print two integers — the minimum possible and the maximum possible number of days off per year on Mars. | [
"14\n",
"2\n"
] | [
"4 4\n",
"0 2\n"
] | In the first sample there are 14 days in a year on Mars, and therefore independently of the day a year starts with there will be exactly 4 days off .
In the second sample there are only 2 days in a year on Mars, and they can both be either work days or days off. | 500 | [
{
"input": "14",
"output": "4 4"
},
{
"input": "2",
"output": "0 2"
},
{
"input": "1",
"output": "0 1"
},
{
"input": "3",
"output": "0 2"
},
{
"input": "4",
"output": "0 2"
},
{
"input": "5",
"output": "0 2"
},
{
"input": "6",
"output":... | 1,661,170,231 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 3 | 46 | 0 | n=int(input())
r=n%7
q=int(n/7)
max=(2*q)+r
min=2*q
print(min,max) | Title: Holidays
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
On the planet Mars a year lasts exactly *n* days (there are no leap years on Mars). But Martians have the same weeks as earthlings — 5 work days and then 2 days off. Your task is to determine the minimum possible and the maxim... | ```python
n=int(input())
r=n%7
q=int(n/7)
max=(2*q)+r
min=2*q
print(min,max)
``` | 0 | |
476 | C | Dreamoon and Sums | PROGRAMMING | 1,600 | [
"math"
] | null | null | Dreamoon loves summing up something for no reason. One day he obtains two integers *a* and *b* occasionally. He wants to calculate the sum of all nice integers. Positive integer *x* is called nice if and , where *k* is some integer number in range [1,<=*a*].
By we denote the quotient of integer division of *x* and *... | The single line of the input contains two integers *a*, *b* (1<=≤<=*a*,<=*b*<=≤<=107). | Print a single integer representing the answer modulo 1<=000<=000<=007 (109<=+<=7). | [
"1 1\n",
"2 2\n"
] | [
"0\n",
"8\n"
] | For the first sample, there are no nice integers because <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/03b1dc6bae5180f8a2d8eb85789e8b393e585970.png" style="max-width: 100.0%;max-height: 100.0%;"/> is always zero.
For the second sample, the set of nice integers is {3, 5}. | 1,500 | [
{
"input": "1 1",
"output": "0"
},
{
"input": "2 2",
"output": "8"
},
{
"input": "4 1",
"output": "0"
},
{
"input": "4 2",
"output": "24"
},
{
"input": "4 3",
"output": "102"
},
{
"input": "4 4",
"output": "264"
},
{
"input": "3 4",
"ou... | 1,672,845,061 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 0 | 1,500 | 0 | a, b = list(map(int, input().split()))
def check(x):
if x % b != 0:
k = (x // b)/(x % b)
if k >= 1 and k <= a:
return True
return False
s = 0
for i in range(1,10**7+1):
if check(i):
print(i)
s += i
print(s)
| Title: Dreamoon and Sums
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Dreamoon loves summing up something for no reason. One day he obtains two integers *a* and *b* occasionally. He wants to calculate the sum of all nice integers. Positive integer *x* is called nice if and , where *k* ... | ```python
a, b = list(map(int, input().split()))
def check(x):
if x % b != 0:
k = (x // b)/(x % b)
if k >= 1 and k <= a:
return True
return False
s = 0
for i in range(1,10**7+1):
if check(i):
print(i)
s += i
print(s)
``` | 0 | |
540 | A | Combination Lock | PROGRAMMING | 800 | [
"implementation"
] | null | null | Scrooge McDuck keeps his most treasured savings in a home safe with a combination lock. Each time he wants to put there the treasures that he's earned fair and square, he has to open the lock.
The combination lock is represented by *n* rotating disks with digits from 0 to 9 written on them. Scrooge McDuck has to turn ... | The first line contains a single integer *n* (1<=≤<=*n*<=≤<=1000) — the number of disks on the combination lock.
The second line contains a string of *n* digits — the original state of the disks.
The third line contains a string of *n* digits — Scrooge McDuck's combination that opens the lock. | Print a single integer — the minimum number of moves Scrooge McDuck needs to open the lock. | [
"5\n82195\n64723\n"
] | [
"13\n"
] | In the sample he needs 13 moves:
- 1 disk: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/b8967f65a723782358b93eff9ce69f336817cf70.png" style="max-width: 100.0%;max-height: 100.0%;"/> - 2 disk: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/07fa58573ece0d32... | 500 | [
{
"input": "5\n82195\n64723",
"output": "13"
},
{
"input": "12\n102021090898\n010212908089",
"output": "16"
},
{
"input": "1\n8\n1",
"output": "3"
},
{
"input": "2\n83\n57",
"output": "7"
},
{
"input": "10\n0728592530\n1362615763",
"output": "27"
},
{
... | 1,664,823,529 | 2,147,483,647 | Python 3 | OK | TESTS | 43 | 93 | 0 | n = int(input())
s = int(input())
f = int(input())
count = 0
for i in range(1, n+1):
c1 = int(s%(10**i)/(10**(i-1)))
c2 = int(f%(10**i)/(10**(i-1)))
if abs(c1-c2) <= 5:
count = count+abs(c1-c2)
else:
count = count+10-abs(c1-c2)
print(count)
| Title: Combination Lock
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Scrooge McDuck keeps his most treasured savings in a home safe with a combination lock. Each time he wants to put there the treasures that he's earned fair and square, he has to open the lock.
The combination lock is ... | ```python
n = int(input())
s = int(input())
f = int(input())
count = 0
for i in range(1, n+1):
c1 = int(s%(10**i)/(10**(i-1)))
c2 = int(f%(10**i)/(10**(i-1)))
if abs(c1-c2) <= 5:
count = count+abs(c1-c2)
else:
count = count+10-abs(c1-c2)
print(count)
``` | 3 | |
817 | B | Makes And The Product | PROGRAMMING | 1,500 | [
"combinatorics",
"implementation",
"math",
"sortings"
] | null | null | After returning from the army Makes received a gift — an array *a* consisting of *n* positive integer numbers. He hadn't been solving problems for a long time, so he became interested to answer a particular question: how many triples of indices (*i*,<= *j*,<= *k*) (*i*<=<<=*j*<=<<=*k*), such that *a**i*·*a**j*·*a... | The first line of input contains a positive integer number *n* (3<=≤<=*n*<=≤<=105) — the number of elements in array *a*. The second line contains *n* positive integer numbers *a**i* (1<=≤<=*a**i*<=≤<=109) — the elements of a given array. | Print one number — the quantity of triples (*i*,<= *j*,<= *k*) such that *i*,<= *j* and *k* are pairwise distinct and *a**i*·*a**j*·*a**k* is minimum possible. | [
"4\n1 1 1 1\n",
"5\n1 3 2 3 4\n",
"6\n1 3 3 1 3 2\n"
] | [
"4\n",
"2\n",
"1\n"
] | In the first example Makes always chooses three ones out of four, and the number of ways to choose them is 4.
In the second example a triple of numbers (1, 2, 3) is chosen (numbers, not indices). Since there are two ways to choose an element 3, then the answer is 2.
In the third example a triple of numbers (1, 1, 2) ... | 0 | [
{
"input": "4\n1 1 1 1",
"output": "4"
},
{
"input": "5\n1 3 2 3 4",
"output": "2"
},
{
"input": "6\n1 3 3 1 3 2",
"output": "1"
},
{
"input": "3\n1000000000 1000000000 1000000000",
"output": "1"
},
{
"input": "4\n1 1 2 2",
"output": "2"
},
{
"input": ... | 1,561,946,234 | 734 | PyPy 3 | OK | TESTS | 80 | 249 | 15,974,400 | n = int(input())
a = list(map(int, input().strip().split()))
d = dict()
for i in range(n):
try: d[a[i]] += 1
except: d[a[i]] = 1
l = list(d.keys())
l.sort()
n = len(l)
if n == 1:
a = d[l[0]]
print(a*(a-1)*(a-2) // 6)
elif n == 2:
a, b = d[l[0]], d[l[1]]
if a >= 3:
pr... | Title: Makes And The Product
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
After returning from the army Makes received a gift — an array *a* consisting of *n* positive integer numbers. He hadn't been solving problems for a long time, so he became interested to answer a particular questi... | ```python
n = int(input())
a = list(map(int, input().strip().split()))
d = dict()
for i in range(n):
try: d[a[i]] += 1
except: d[a[i]] = 1
l = list(d.keys())
l.sort()
n = len(l)
if n == 1:
a = d[l[0]]
print(a*(a-1)*(a-2) // 6)
elif n == 2:
a, b = d[l[0]], d[l[1]]
if a >= 3:
... | 3 | |
61 | A | Ultra-Fast Mathematician | PROGRAMMING | 800 | [
"implementation"
] | A. Ultra-Fast Mathematician | 2 | 256 | Shapur was an extremely gifted student. He was great at everything including Combinatorics, Algebra, Number Theory, Geometry, Calculus, etc. He was not only smart but extraordinarily fast! He could manage to sum 1018 numbers in a single second.
One day in 230 AD Shapur was trying to find out if any one can possibly do... | There are two lines in each input. Each of them contains a single number. It is guaranteed that the numbers are made from 0 and 1 only and that their length is same. The numbers may start with 0. The length of each number doesn't exceed 100. | Write one line — the corresponding answer. Do not omit the leading 0s. | [
"1010100\n0100101\n",
"000\n111\n",
"1110\n1010\n",
"01110\n01100\n"
] | [
"1110001\n",
"111\n",
"0100\n",
"00010\n"
] | none | 500 | [
{
"input": "1010100\n0100101",
"output": "1110001"
},
{
"input": "000\n111",
"output": "111"
},
{
"input": "1110\n1010",
"output": "0100"
},
{
"input": "01110\n01100",
"output": "00010"
},
{
"input": "011101\n000001",
"output": "011100"
},
{
"input": "... | 1,654,137,170 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 15 | 0 | a = int(input(),2)
b = int(input(),2)
out = bin(a^b)
print(out[2:].zfill(len(out)-1)) | Title: Ultra-Fast Mathematician
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Shapur was an extremely gifted student. He was great at everything including Combinatorics, Algebra, Number Theory, Geometry, Calculus, etc. He was not only smart but extraordinarily fast! He could manage to sum 10... | ```python
a = int(input(),2)
b = int(input(),2)
out = bin(a^b)
print(out[2:].zfill(len(out)-1))
``` | 0 |
282 | A | Bit++ | PROGRAMMING | 800 | [
"implementation"
] | null | null | The classic programming language of Bitland is Bit++. This language is so peculiar and complicated.
The language is that peculiar as it has exactly one variable, called *x*. Also, there are two operations:
- Operation ++ increases the value of variable *x* by 1. - Operation -- decreases the value of variable *x* by... | The first line contains a single integer *n* (1<=≤<=*n*<=≤<=150) — the number of statements in the programme.
Next *n* lines contain a statement each. Each statement contains exactly one operation (++ or --) and exactly one variable *x* (denoted as letter «X»). Thus, there are no empty statements. The operation and th... | Print a single integer — the final value of *x*. | [
"1\n++X\n",
"2\nX++\n--X\n"
] | [
"1\n",
"0\n"
] | none | 500 | [
{
"input": "1\n++X",
"output": "1"
},
{
"input": "2\nX++\n--X",
"output": "0"
},
{
"input": "3\n++X\n++X\n++X",
"output": "3"
},
{
"input": "2\n--X\n--X",
"output": "-2"
},
{
"input": "5\n++X\n--X\n++X\n--X\n--X",
"output": "-1"
},
{
"input": "28\nX--\... | 1,699,606,751 | 2,147,483,647 | Python 3 | OK | TESTS | 36 | 46 | 0 | n = int(input())
x = 0
for j in range(n):
st = input()
if st[1] == "+":
x = x+1
else:
x= x-1
print(x)
| Title: Bit++
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The classic programming language of Bitland is Bit++. This language is so peculiar and complicated.
The language is that peculiar as it has exactly one variable, called *x*. Also, there are two operations:
- Operation ++ incre... | ```python
n = int(input())
x = 0
for j in range(n):
st = input()
if st[1] == "+":
x = x+1
else:
x= x-1
print(x)
``` | 3 | |
496 | B | Secret Combination | PROGRAMMING | 1,500 | [
"brute force",
"constructive algorithms",
"implementation"
] | null | null | You got a box with a combination lock. The lock has a display showing *n* digits. There are two buttons on the box, each button changes digits on the display. You have quickly discovered that the first button adds 1 to all the digits (all digits 9 become digits 0), and the second button shifts all the digits on the dis... | The first line contains a single integer *n* (1<=≤<=*n*<=≤<=1000) — the number of digits on the display.
The second line contains *n* digits — the initial state of the display. | Print a single line containing *n* digits — the desired state of the display containing the smallest possible number. | [
"3\n579\n",
"4\n2014\n"
] | [
"024\n",
"0142\n"
] | none | 1,000 | [
{
"input": "3\n579",
"output": "024"
},
{
"input": "4\n2014",
"output": "0142"
},
{
"input": "1\n1",
"output": "0"
},
{
"input": "3\n039",
"output": "014"
},
{
"input": "4\n4444",
"output": "0000"
},
{
"input": "5\n46802",
"output": "02468"
},
... | 1,418,840,486 | 6,686 | Python 3 | RUNTIME_ERROR | PRETESTS | 2 | 46 | 0 | num= int(input())
digits= [(i) for i in input()]
a= [0,1,2,3,4,5,6,7,8,9]
real= list(digits)
digits= "".join(digits)
diff= []
for i in range(len(digits)-1):
diff.append(int(digits[i+1])-int(digits[i]))
diff.append(int(digits[1])-int(digits[-1]))
diff= [a[i] for i in diff]
#print(diff)
ans= diff
fo... | Title: Secret Combination
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You got a box with a combination lock. The lock has a display showing *n* digits. There are two buttons on the box, each button changes digits on the display. You have quickly discovered that the first button adds 1 ... | ```python
num= int(input())
digits= [(i) for i in input()]
a= [0,1,2,3,4,5,6,7,8,9]
real= list(digits)
digits= "".join(digits)
diff= []
for i in range(len(digits)-1):
diff.append(int(digits[i+1])-int(digits[i]))
diff.append(int(digits[1])-int(digits[-1]))
diff= [a[i] for i in diff]
#print(diff)
ans... | -1 | |
31 | E | TV Game | PROGRAMMING | 2,400 | [
"dp"
] | E. TV Game | 2 | 256 | There is a new TV game on BerTV. In this game two players get a number *A* consisting of 2*n* digits. Before each turn players determine who will make the next move. Each player should make exactly *n* moves. On it's turn *i*-th player takes the leftmost digit of *A* and appends it to his or her number *S**i*. After th... | The first line contains integer *n* (1<=≤<=*n*<=≤<=18). The second line contains integer *A* consisting of exactly 2*n* digits. This number can have leading zeroes. | Output the line of 2*n* characters «H» and «M» — the sequence of moves of Homer and Marge, which gives them maximum possible total prize. Each player must make exactly *n* moves. If there are several solutions, output any of them. | [
"2\n1234\n",
"2\n9911\n"
] | [
"HHMM",
"HMHM"
] | none | 2,500 | [
{
"input": "2\n1234",
"output": "HHMM"
},
{
"input": "2\n9911",
"output": "HMHM"
},
{
"input": "2\n0153",
"output": "HHMM"
},
{
"input": "3\n614615",
"output": "HHHMMM"
},
{
"input": "4\n21305374",
"output": "HHHHMMMM"
},
{
"input": "4\n00013213",
... | 1,680,285,578 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 0 | 60 | 0 | n=int(input())
a=input()
g=[[0]*(n+1) for i in range(2*n+1)]
f=[[0]*(n+1) for i in range(2*n+1)]
for i in reversed(range(2*n)):
for j in range(n+1):
if j>0:
f[i][j]=max(f[i][j],f[i+1][j-1]+int(a[i])*(10**(j-1)))
if 2*n-i-j>0:
f[i][j]=max(f[i][j],f[i+1][j]+int(a[i])*(... | Title: TV Game
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
There is a new TV game on BerTV. In this game two players get a number *A* consisting of 2*n* digits. Before each turn players determine who will make the next move. Each player should make exactly *n* moves. On it's turn *i*-th pl... | ```python
n=int(input())
a=input()
g=[[0]*(n+1) for i in range(2*n+1)]
f=[[0]*(n+1) for i in range(2*n+1)]
for i in reversed(range(2*n)):
for j in range(n+1):
if j>0:
f[i][j]=max(f[i][j],f[i+1][j-1]+int(a[i])*(10**(j-1)))
if 2*n-i-j>0:
f[i][j]=max(f[i][j],f[i+1][j]+i... | 0 |
796 | B | Find The Bone | PROGRAMMING | 1,300 | [
"implementation"
] | null | null | Zane the wizard is going to perform a magic show shuffling the cups.
There are *n* cups, numbered from 1 to *n*, placed along the *x*-axis on a table that has *m* holes on it. More precisely, cup *i* is on the table at the position *x*<==<=*i*.
The problematic bone is initially at the position *x*<==<=1. Zane will co... | The first line contains three integers *n*, *m*, and *k* (2<=≤<=*n*<=≤<=106, 1<=≤<=*m*<=≤<=*n*, 1<=≤<=*k*<=≤<=3·105) — the number of cups, the number of holes on the table, and the number of swapping operations, respectively.
The second line contains *m* distinct integers *h*1,<=*h*2,<=...,<=*h**m* (1<=≤<=*h**i*<=≤<=*... | Print one integer — the final position along the *x*-axis of the bone. | [
"7 3 4\n3 4 6\n1 2\n2 5\n5 7\n7 1\n",
"5 1 2\n2\n1 2\n2 4\n"
] | [
"1",
"2"
] | In the first sample, after the operations, the bone becomes at *x* = 2, *x* = 5, *x* = 7, and *x* = 1, respectively.
In the second sample, after the first operation, the bone becomes at *x* = 2, and falls into the hole onto the ground. | 750 | [
{
"input": "7 3 4\n3 4 6\n1 2\n2 5\n5 7\n7 1",
"output": "1"
},
{
"input": "5 1 2\n2\n1 2\n2 4",
"output": "2"
},
{
"input": "10000 1 9\n55\n44 1\n2929 9292\n9999 9998\n44 55\n49 94\n55 53\n100 199\n55 50\n53 11",
"output": "55"
},
{
"input": "100000 3 7\n2 3 4\n1 5\n5 1\n1 5... | 1,545,709,172 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 5 | 124 | 3,993,600 | inp = lambda : [*map(int, input().split())]
n, m, k = inp()
f = [False] * (n + 1)
for i in inp():
f[i] = True
current = 1
for i in range(k):
if f[current]:
break
x, y = inp()
current = y
print(current)
| Title: Find The Bone
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Zane the wizard is going to perform a magic show shuffling the cups.
There are *n* cups, numbered from 1 to *n*, placed along the *x*-axis on a table that has *m* holes on it. More precisely, cup *i* is on the table at t... | ```python
inp = lambda : [*map(int, input().split())]
n, m, k = inp()
f = [False] * (n + 1)
for i in inp():
f[i] = True
current = 1
for i in range(k):
if f[current]:
break
x, y = inp()
current = y
print(current)
``` | 0 | |
960 | A | Check the string | PROGRAMMING | 1,200 | [
"implementation"
] | null | null | A has a string consisting of some number of lowercase English letters 'a'. He gives it to his friend B who appends some number of letters 'b' to the end of this string. Since both A and B like the characters 'a' and 'b', they have made sure that at this point, at least one 'a' and one 'b' exist in the string.
B now gi... | The first and only line consists of a string $S$ ($ 1 \le |S| \le 5\,000 $). It is guaranteed that the string will only consist of the lowercase English letters 'a', 'b', 'c'. | Print "YES" or "NO", according to the condition. | [
"aaabccc\n",
"bbacc\n",
"aabc\n"
] | [
"YES\n",
"NO\n",
"YES\n"
] | Consider first example: the number of 'c' is equal to the number of 'a'.
Consider second example: although the number of 'c' is equal to the number of the 'b', the order is not correct.
Consider third example: the number of 'c' is equal to the number of 'b'. | 500 | [
{
"input": "aaabccc",
"output": "YES"
},
{
"input": "bbacc",
"output": "NO"
},
{
"input": "aabc",
"output": "YES"
},
{
"input": "aabbcc",
"output": "YES"
},
{
"input": "aaacccbb",
"output": "NO"
},
{
"input": "abc",
"output": "YES"
},
{
"in... | 1,524,632,318 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 5 | 78 | 7,065,600 |
def check (y):
if y.count('a') >= 1:
if y.count('b') >= 1:
if y[0]=='a':
if y.count('a') == y.count('c') or y.count('b') == y. count('c'):
return 'YES'
else:
return 'NO'
else:
return 'N... | Title: Check the string
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A has a string consisting of some number of lowercase English letters 'a'. He gives it to his friend B who appends some number of letters 'b' to the end of this string. Since both A and B like the characters 'a' and 'b... | ```python
def check (y):
if y.count('a') >= 1:
if y.count('b') >= 1:
if y[0]=='a':
if y.count('a') == y.count('c') or y.count('b') == y. count('c'):
return 'YES'
else:
return 'NO'
else:
... | 0 | |
99 | A | Help Far Away Kingdom | PROGRAMMING | 800 | [
"strings"
] | A. Help Far Away Kingdom | 2 | 256 | In a far away kingdom lived the King, the Prince, the Shoemaker, the Dressmaker and many other citizens. They lived happily until great trouble came into the Kingdom. The ACMers settled there.
Most damage those strange creatures inflicted upon the kingdom was that they loved high precision numbers. As a result, the Ki... | The first line contains a single number to round up — the integer part (a non-empty set of decimal digits that do not start with 0 — with the exception of a case when the set consists of a single digit — in this case 0 can go first), then follows character «.» (a dot), and then follows the fractional part (any non-empt... | If the last number of the integer part is not equal to 9, print the rounded-up number without leading zeroes. Otherwise, print the message "GOTO Vasilisa." (without the quotes). | [
"0.0\n",
"1.49\n",
"1.50\n",
"2.71828182845904523536\n",
"3.14159265358979323846\n",
"12345678901234567890.1\n",
"123456789123456789.999\n"
] | [
"0",
"1",
"2",
"3",
"3",
"12345678901234567890",
"GOTO Vasilisa."
] | none | 500 | [
{
"input": "0.0",
"output": "0"
},
{
"input": "1.49",
"output": "1"
},
{
"input": "1.50",
"output": "2"
},
{
"input": "2.71828182845904523536",
"output": "3"
},
{
"input": "3.14159265358979323846",
"output": "3"
},
{
"input": "12345678901234567890.1",
... | 1,690,107,925 | 2,147,483,647 | Python 3 | OK | TESTS | 150 | 92 | 0 | def round_number(num_str):
integer_part, fractional_part = num_str.split('.')
last_digit = int(integer_part[-1])
if last_digit != 9:
if int(fractional_part[0]) < 5:
return integer_part
else:
return str(int(integer_part) + 1)
else:
return "GOTO V... | Title: Help Far Away Kingdom
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
In a far away kingdom lived the King, the Prince, the Shoemaker, the Dressmaker and many other citizens. They lived happily until great trouble came into the Kingdom. The ACMers settled there.
Most damage those stran... | ```python
def round_number(num_str):
integer_part, fractional_part = num_str.split('.')
last_digit = int(integer_part[-1])
if last_digit != 9:
if int(fractional_part[0]) < 5:
return integer_part
else:
return str(int(integer_part) + 1)
else:
retu... | 3.977 |
525 | A | Vitaliy and Pie | PROGRAMMING | 1,100 | [
"greedy",
"hashing",
"strings"
] | null | null | After a hard day Vitaly got very hungry and he wants to eat his favorite potato pie. But it's not that simple. Vitaly is in the first room of the house with *n* room located in a line and numbered starting from one from left to right. You can go from the first room to the second room, from the second room to the third ... | The first line of the input contains a positive integer *n* (2<=≤<=*n*<=≤<=105) — the number of rooms in the house.
The second line of the input contains string *s* of length 2·*n*<=-<=2. Let's number the elements of the string from left to right, starting from one.
The odd positions in the given string *s* contain ... | Print the only integer — the minimum number of keys that Vitaly needs to buy to surely get from room one to room *n*. | [
"3\naAbB\n",
"4\naBaCaB\n",
"5\nxYyXzZaZ\n"
] | [
"0\n",
"3\n",
"2\n"
] | none | 250 | [
{
"input": "3\naAbB",
"output": "0"
},
{
"input": "4\naBaCaB",
"output": "3"
},
{
"input": "5\nxYyXzZaZ",
"output": "2"
},
{
"input": "26\naAbBcCdDeEfFgGhHiIjJkKlLmMnNoOpPqQrRsStTuUvVwWxXyY",
"output": "0"
},
{
"input": "26\nzAyBxCwDvEuFtGsHrIqJpKoLnMmNlOkPjQiRhSg... | 1,635,347,032 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 7 | 108 | 4,608,000 | n = int(input())
s = input().strip()
count = 0
keys = ''
for i in range(0, len(s), 2):
if s[i+1].lower() != s[i]:
keys += s[i]
if s[i+1].lower() != s[i] and s[i+1].lower() not in keys:
count += 1
print(count)
| Title: Vitaliy and Pie
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
After a hard day Vitaly got very hungry and he wants to eat his favorite potato pie. But it's not that simple. Vitaly is in the first room of the house with *n* room located in a line and numbered starting from one from... | ```python
n = int(input())
s = input().strip()
count = 0
keys = ''
for i in range(0, len(s), 2):
if s[i+1].lower() != s[i]:
keys += s[i]
if s[i+1].lower() != s[i] and s[i+1].lower() not in keys:
count += 1
print(count)
``` | 0 | |
71 | A | Way Too Long Words | PROGRAMMING | 800 | [
"strings"
] | A. Way Too Long Words | 1 | 256 | Sometimes some words like "localization" or "internationalization" are so long that writing them many times in one text is quite tiresome.
Let's consider a word too long, if its length is strictly more than 10 characters. All too long words should be replaced with a special abbreviation.
This abbreviation is made lik... | The first line contains an integer *n* (1<=≤<=*n*<=≤<=100). Each of the following *n* lines contains one word. All the words consist of lowercase Latin letters and possess the lengths of from 1 to 100 characters. | Print *n* lines. The *i*-th line should contain the result of replacing of the *i*-th word from the input data. | [
"4\nword\nlocalization\ninternationalization\npneumonoultramicroscopicsilicovolcanoconiosis\n"
] | [
"word\nl10n\ni18n\np43s\n"
] | none | 500 | [
{
"input": "4\nword\nlocalization\ninternationalization\npneumonoultramicroscopicsilicovolcanoconiosis",
"output": "word\nl10n\ni18n\np43s"
},
{
"input": "5\nabcdefgh\nabcdefghi\nabcdefghij\nabcdefghijk\nabcdefghijklm",
"output": "abcdefgh\nabcdefghi\nabcdefghij\na9k\na11m"
},
{
"input":... | 1,690,549,575 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 31 | 0 | n, z = int(input()), []
for i in range(n):
s = input()
if len(s) > 10:
s = s[0] + str(len(s)) + s[-1]
z.append(s)
else:
z.append(s)
print(*z, sep = '\n') | Title: Way Too Long Words
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Sometimes some words like "localization" or "internationalization" are so long that writing them many times in one text is quite tiresome.
Let's consider a word too long, if its length is strictly more than 10 character... | ```python
n, z = int(input()), []
for i in range(n):
s = input()
if len(s) > 10:
s = s[0] + str(len(s)) + s[-1]
z.append(s)
else:
z.append(s)
print(*z, sep = '\n')
``` | 0 |
459 | A | Pashmak and Garden | PROGRAMMING | 1,200 | [
"implementation"
] | null | null | Pashmak has fallen in love with an attractive girl called Parmida since one year ago...
Today, Pashmak set up a meeting with his partner in a romantic garden. Unfortunately, Pashmak has forgotten where the garden is. But he remembers that the garden looks like a square with sides parallel to the coordinate axes. He al... | The first line contains four space-separated *x*1,<=*y*1,<=*x*2,<=*y*2 (<=-<=100<=≤<=*x*1,<=*y*1,<=*x*2,<=*y*2<=≤<=100) integers, where *x*1 and *y*1 are coordinates of the first tree and *x*2 and *y*2 are coordinates of the second tree. It's guaranteed that the given points are distinct. | If there is no solution to the problem, print -1. Otherwise print four space-separated integers *x*3,<=*y*3,<=*x*4,<=*y*4 that correspond to the coordinates of the two other trees. If there are several solutions you can output any of them.
Note that *x*3,<=*y*3,<=*x*4,<=*y*4 must be in the range (<=-<=1000<=≤<=*x*3,<... | [
"0 0 0 1\n",
"0 0 1 1\n",
"0 0 1 2\n"
] | [
"1 0 1 1\n",
"0 1 1 0\n",
"-1\n"
] | none | 500 | [
{
"input": "0 0 0 1",
"output": "1 0 1 1"
},
{
"input": "0 0 1 1",
"output": "0 1 1 0"
},
{
"input": "0 0 1 2",
"output": "-1"
},
{
"input": "-100 -100 100 100",
"output": "-100 100 100 -100"
},
{
"input": "-100 -100 99 100",
"output": "-1"
},
{
"input... | 1,694,654,476 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 74 | 77 | 0 | #https://codeforces.com/contest/459/problem/A
x1,y1,x2,y2 = [int(elem) for elem in input().split()]
if y1 == y2:
print(x1, y1+(x2-x1), x2, y2+(x2-x1))
elif x1 == x2:
print(x1+(y2-y1), y1, x2+(y2-y1), y2)
elif abs(y2 - y1) != abs(x2 - x1):
print(-1)
else:
print(x1,y2,x2,y1)
| Title: Pashmak and Garden
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Pashmak has fallen in love with an attractive girl called Parmida since one year ago...
Today, Pashmak set up a meeting with his partner in a romantic garden. Unfortunately, Pashmak has forgotten where the garden is... | ```python
#https://codeforces.com/contest/459/problem/A
x1,y1,x2,y2 = [int(elem) for elem in input().split()]
if y1 == y2:
print(x1, y1+(x2-x1), x2, y2+(x2-x1))
elif x1 == x2:
print(x1+(y2-y1), y1, x2+(y2-y1), y2)
elif abs(y2 - y1) != abs(x2 - x1):
print(-1)
else:
print(x1,y2,x2,y1)
``` | 3 | |
456 | A | Laptops | PROGRAMMING | 1,100 | [
"sortings"
] | null | null | One day Dima and Alex had an argument about the price and quality of laptops. Dima thinks that the more expensive a laptop is, the better it is. Alex disagrees. Alex thinks that there are two laptops, such that the price of the first laptop is less (strictly smaller) than the price of the second laptop but the quality ... | The first line contains an integer *n* (1<=≤<=*n*<=≤<=105) — the number of laptops.
Next *n* lines contain two integers each, *a**i* and *b**i* (1<=≤<=*a**i*,<=*b**i*<=≤<=*n*), where *a**i* is the price of the *i*-th laptop, and *b**i* is the number that represents the quality of the *i*-th laptop (the larger the numb... | If Alex is correct, print "Happy Alex", otherwise print "Poor Alex" (without the quotes). | [
"2\n1 2\n2 1\n"
] | [
"Happy Alex\n"
] | none | 500 | [
{
"input": "2\n1 2\n2 1",
"output": "Happy Alex"
},
{
"input": "2\n1 1\n2 2",
"output": "Poor Alex"
},
{
"input": "3\n2 2\n3 3\n1 1",
"output": "Poor Alex"
},
{
"input": "3\n3 3\n1 2\n2 1",
"output": "Happy Alex"
},
{
"input": "1\n1 1",
"output": "Poor Alex"
... | 1,671,749,702 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 34 | 623 | 10,035,200 | t = int(input())
i = 0
while i<t:
s = list(map(int, input().split()))
a = s[0]
b = s[1]
c=0
if a==b:
c = c+1
i = i+1
if c==0:
print("Happy Alex")
else:
print("Poor Alex") | Title: Laptops
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One day Dima and Alex had an argument about the price and quality of laptops. Dima thinks that the more expensive a laptop is, the better it is. Alex disagrees. Alex thinks that there are two laptops, such that the price of the... | ```python
t = int(input())
i = 0
while i<t:
s = list(map(int, input().split()))
a = s[0]
b = s[1]
c=0
if a==b:
c = c+1
i = i+1
if c==0:
print("Happy Alex")
else:
print("Poor Alex")
``` | 0 | |
650 | A | Watchmen | PROGRAMMING | 1,400 | [
"data structures",
"geometry",
"math"
] | null | null | Watchmen are in a danger and Doctor Manhattan together with his friend Daniel Dreiberg should warn them as soon as possible. There are *n* watchmen on a plane, the *i*-th watchman is located at point (*x**i*,<=*y**i*).
They need to arrange a plan, but there are some difficulties on their way. As you know, Doctor Manha... | The first line of the input contains the single integer *n* (1<=≤<=*n*<=≤<=200<=000) — the number of watchmen.
Each of the following *n* lines contains two integers *x**i* and *y**i* (|*x**i*|,<=|*y**i*|<=≤<=109).
Some positions may coincide. | Print the number of pairs of watchmen such that the distance between them calculated by Doctor Manhattan is equal to the distance calculated by Daniel. | [
"3\n1 1\n7 5\n1 5\n",
"6\n0 0\n0 1\n0 2\n-1 1\n0 1\n1 1\n"
] | [
"2\n",
"11\n"
] | In the first sample, the distance between watchman 1 and watchman 2 is equal to |1 - 7| + |1 - 5| = 10 for Doctor Manhattan and <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/bcb5b7064b5f02088da0fdcf677e6fda495dd0df.png" style="max-width: 100.0%;max-height: 100.0%;"/> for Daniel. For pairs... | 500 | [
{
"input": "3\n1 1\n7 5\n1 5",
"output": "2"
},
{
"input": "6\n0 0\n0 1\n0 2\n-1 1\n0 1\n1 1",
"output": "11"
},
{
"input": "10\n46 -55\n46 45\n46 45\n83 -55\n46 45\n83 -55\n46 45\n83 45\n83 45\n46 -55",
"output": "33"
},
{
"input": "1\n-5 -90",
"output": "0"
},
{
... | 1,616,194,756 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 43 | 779 | 33,689,600 | from sys import stdin,stdout
from collections import deque
input = stdin.readline
def main():
#t = int(input())
t=1
for i in range(t):
n = int(input())
#n, k = map(int,input().split())
#ai = list(map(int,input().split()))
ans = 0
d1 = {}
d2 = {}... | Title: Watchmen
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Watchmen are in a danger and Doctor Manhattan together with his friend Daniel Dreiberg should warn them as soon as possible. There are *n* watchmen on a plane, the *i*-th watchman is located at point (*x**i*,<=*y**i*).
They n... | ```python
from sys import stdin,stdout
from collections import deque
input = stdin.readline
def main():
#t = int(input())
t=1
for i in range(t):
n = int(input())
#n, k = map(int,input().split())
#ai = list(map(int,input().split()))
ans = 0
d1 = {}
... | 0 | |
1 | A | Theatre Square | PROGRAMMING | 1,000 | [
"math"
] | A. Theatre Square | 1 | 256 | Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=×<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each flagstone is of the size *a*<=×<=*a*.
What is the least number of flagstones needed to pave the... | The input contains three positive integer numbers in the first line: *n*,<=<=*m* and *a* (1<=≤<=<=*n*,<=*m*,<=*a*<=≤<=109). | Write the needed number of flagstones. | [
"6 6 4\n"
] | [
"4\n"
] | none | 0 | [
{
"input": "6 6 4",
"output": "4"
},
{
"input": "1 1 1",
"output": "1"
},
{
"input": "2 1 1",
"output": "2"
},
{
"input": "1 2 1",
"output": "2"
},
{
"input": "2 2 1",
"output": "4"
},
{
"input": "2 1 2",
"output": "1"
},
{
"input": "1 1 3"... | 1,662,782,673 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 0 | 15 | 0 | n=int(input())
m=int(input())
a=int(input())
for i in range (a):
for j in range (a):
if n%a==0 and m%a==0:
print((m*n)/a*a)
break
else:
n+=i
m+=j
| Title: Theatre Square
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=×<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each ... | ```python
n=int(input())
m=int(input())
a=int(input())
for i in range (a):
for j in range (a):
if n%a==0 and m%a==0:
print((m*n)/a*a)
break
else:
n+=i
m+=j
``` | -1 |
246 | D | Colorful Graph | PROGRAMMING | 1,600 | [
"brute force",
"dfs and similar",
"graphs"
] | null | null | You've got an undirected graph, consisting of *n* vertices and *m* edges. We will consider the graph's vertices numbered with integers from 1 to *n*. Each vertex of the graph has a color. The color of the *i*-th vertex is an integer *c**i*.
Let's consider all vertices of the graph, that are painted some color *k*. Let... | The first line contains two space-separated integers *n*,<=*m* (1<=≤<=*n*,<=*m*<=≤<=105) — the number of vertices end edges of the graph, correspondingly. The second line contains a sequence of integers *c*1,<=*c*2,<=...,<=*c**n* (1<=≤<=*c**i*<=≤<=105) — the colors of the graph vertices. The numbers on the line are sep... | Print the number of the color which has the set of neighbours with the maximum cardinality. It there are multiple optimal colors, print the color with the minimum number. Please note, that you want to find such color, that the graph has at least one vertex with such color. | [
"6 6\n1 1 2 3 5 8\n1 2\n3 2\n1 4\n4 3\n4 5\n4 6\n",
"5 6\n4 2 5 2 4\n1 2\n2 3\n3 1\n5 3\n5 4\n3 4\n"
] | [
"3\n",
"2\n"
] | none | 2,000 | [
{
"input": "6 6\n1 1 2 3 5 8\n1 2\n3 2\n1 4\n4 3\n4 5\n4 6",
"output": "3"
},
{
"input": "5 6\n4 2 5 2 4\n1 2\n2 3\n3 1\n5 3\n5 4\n3 4",
"output": "2"
},
{
"input": "3 1\n13 13 4\n1 2",
"output": "4"
},
{
"input": "2 1\n500 300\n1 2",
"output": "300"
},
{
"input":... | 1,695,645,758 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 2 | 156 | 3,481,600 | from queue import Queue
def solve():
n,m = map(int,input().split())
color = list(map(int,input().split()))
cc = [set()for i in range(n+5)]
for i in range(m):
a,b = map(int,input().split())
if color[a-1]!=color[b-1]:
cc[color[a-1]].add(color[b-1])
cc[color[b-1]].add(color[a-1])
ma = 1
mac = len(cc[1])
... | Title: Colorful Graph
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You've got an undirected graph, consisting of *n* vertices and *m* edges. We will consider the graph's vertices numbered with integers from 1 to *n*. Each vertex of the graph has a color. The color of the *i*-th vertex i... | ```python
from queue import Queue
def solve():
n,m = map(int,input().split())
color = list(map(int,input().split()))
cc = [set()for i in range(n+5)]
for i in range(m):
a,b = map(int,input().split())
if color[a-1]!=color[b-1]:
cc[color[a-1]].add(color[b-1])
cc[color[b-1]].add(color[a-1])
ma = 1
mac = le... | 0 | |
837 | D | Round Subset | PROGRAMMING | 2,100 | [
"dp",
"math"
] | null | null | Let's call the roundness of the number the number of zeros to which it ends.
You have an array of *n* numbers. You need to choose a subset of exactly *k* numbers so that the roundness of the product of the selected numbers will be maximum possible. | The first line contains two integer numbers *n* and *k* (1<=≤<=*n*<=≤<=200,<=1<=≤<=*k*<=≤<=*n*).
The second line contains *n* space-separated integer numbers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=1018). | Print maximal roundness of product of the chosen subset of length *k*. | [
"3 2\n50 4 20\n",
"5 3\n15 16 3 25 9\n",
"3 3\n9 77 13\n"
] | [
"3\n",
"3\n",
"0\n"
] | In the first example there are 3 subsets of 2 numbers. [50, 4] has product 200 with roundness 2, [4, 20] — product 80, roundness 1, [50, 20] — product 1000, roundness 3.
In the second example subset [15, 16, 25] has product 6000, roundness 3.
In the third example all subsets has product with roundness 0. | 0 | [
{
"input": "3 2\n50 4 20",
"output": "3"
},
{
"input": "5 3\n15 16 3 25 9",
"output": "3"
},
{
"input": "3 3\n9 77 13",
"output": "0"
},
{
"input": "1 1\n200000000",
"output": "8"
},
{
"input": "1 1\n3",
"output": "0"
},
{
"input": "3 1\n10000000000000... | 1,674,923,280 | 2,147,483,647 | PyPy 3-64 | TIME_LIMIT_EXCEEDED | TESTS | 3 | 2,000 | 13,312,000 | from sys import stdin
input = stdin.buffer.readline
def main():
MAX = 3000
n, k = map(int,input().split())
a = list(map(int,input().split()))
pw2, pw5 = [], []
for i in a:
p2, p5 = 0, 0
while i % 2 == 0:
p2 += 1
i //= 2
while i % 5 == 0:
... | Title: Round Subset
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Let's call the roundness of the number the number of zeros to which it ends.
You have an array of *n* numbers. You need to choose a subset of exactly *k* numbers so that the roundness of the product of the selected number... | ```python
from sys import stdin
input = stdin.buffer.readline
def main():
MAX = 3000
n, k = map(int,input().split())
a = list(map(int,input().split()))
pw2, pw5 = [], []
for i in a:
p2, p5 = 0, 0
while i % 2 == 0:
p2 += 1
i //= 2
while i % 5 == 0:
... | 0 | |
1,003 | A | Polycarp's Pockets | PROGRAMMING | 800 | [
"implementation"
] | null | null | Polycarp has $n$ coins, the value of the $i$-th coin is $a_i$. Polycarp wants to distribute all the coins between his pockets, but he cannot put two coins with the same value into the same pocket.
For example, if Polycarp has got six coins represented as an array $a = [1, 2, 4, 3, 3, 2]$, he can distribute the coins i... | The first line of the input contains one integer $n$ ($1 \le n \le 100$) — the number of coins.
The second line of the input contains $n$ integers $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 100$) — values of coins. | Print only one integer — the minimum number of pockets Polycarp needs to distribute all the coins so no two coins with the same value are put into the same pocket. | [
"6\n1 2 4 3 3 2\n",
"1\n100\n"
] | [
"2\n",
"1\n"
] | none | 0 | [
{
"input": "6\n1 2 4 3 3 2",
"output": "2"
},
{
"input": "1\n100",
"output": "1"
},
{
"input": "100\n100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100... | 1,667,393,728 | 2,147,483,647 | Python 3 | OK | TESTS | 37 | 46 | 0 | n = int(input())
a=[int(d) for d in input().split()]
max=0
for i in range(n):
if a.count(a[i])>max:
max=a.count(a[i])
print(max) | Title: Polycarp's Pockets
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Polycarp has $n$ coins, the value of the $i$-th coin is $a_i$. Polycarp wants to distribute all the coins between his pockets, but he cannot put two coins with the same value into the same pocket.
For example, if Po... | ```python
n = int(input())
a=[int(d) for d in input().split()]
max=0
for i in range(n):
if a.count(a[i])>max:
max=a.count(a[i])
print(max)
``` | 3 | |
50 | A | Domino piling | PROGRAMMING | 800 | [
"greedy",
"math"
] | A. Domino piling | 2 | 256 | You are given a rectangular board of *M*<=×<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=×<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as possible on the board so as to meet the following conditions:
1. Each domino completely covers ... | In a single line you are given two integers *M* and *N* — board sizes in squares (1<=≤<=*M*<=≤<=*N*<=≤<=16). | Output one number — the maximal number of dominoes, which can be placed. | [
"2 4\n",
"3 3\n"
] | [
"4\n",
"4\n"
] | none | 500 | [
{
"input": "2 4",
"output": "4"
},
{
"input": "3 3",
"output": "4"
},
{
"input": "1 5",
"output": "2"
},
{
"input": "1 6",
"output": "3"
},
{
"input": "1 15",
"output": "7"
},
{
"input": "1 16",
"output": "8"
},
{
"input": "2 5",
"outpu... | 1,687,633,037 | 2,147,483,647 | Python 3 | OK | TESTS | 35 | 92 | 0 | m, n = [*open(0)][0].split();print(int(m)*int(n) // 2) | Title: Domino piling
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
You are given a rectangular board of *M*<=×<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=×<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as p... | ```python
m, n = [*open(0)][0].split();print(int(m)*int(n) // 2)
``` | 3.977 |
2 | A | Winner | PROGRAMMING | 1,500 | [
"hashing",
"implementation"
] | A. Winner | 1 | 64 | The winner of the card game popular in Berland "Berlogging" is determined according to the following rules. If at the end of the game there is only one player with the maximum number of points, he is the winner. The situation becomes more difficult if the number of such players is more than one. During each round a pla... | The first line contains an integer number *n* (1<=<=≤<=<=*n*<=<=≤<=<=1000), *n* is the number of rounds played. Then follow *n* lines, containing the information about the rounds in "name score" format in chronological order, where name is a string of lower-case Latin letters with the length from 1 to 32, and score is ... | Print the name of the winner. | [
"3\nmike 3\nandrew 5\nmike 2\n",
"3\nandrew 3\nandrew 2\nmike 5\n"
] | [
"andrew\n",
"andrew\n"
] | none | 0 | [
{
"input": "3\nmike 3\nandrew 5\nmike 2",
"output": "andrew"
},
{
"input": "3\nandrew 3\nandrew 2\nmike 5",
"output": "andrew"
},
{
"input": "5\nkaxqybeultn -352\nmgochgrmeyieyskhuourfg -910\nkaxqybeultn 691\nmgochgrmeyieyskhuourfg -76\nkaxqybeultn -303",
"output": "kaxqybeultn"
},... | 1,612,805,671 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 5 | 122 | 307,200 | from math import inf
def solve(n, lines):
members = {}
now = 0
for line in lines:
line_sp = line.split()
try:
members[line_sp[0]] += int(line_sp[1]) - now
except:
members[line_sp[0]] = int(line_sp[1]) - now
now += 1
max = -inf
ma... | Title: Winner
Time Limit: 1 seconds
Memory Limit: 64 megabytes
Problem Description:
The winner of the card game popular in Berland "Berlogging" is determined according to the following rules. If at the end of the game there is only one player with the maximum number of points, he is the winner. The situation becomes... | ```python
from math import inf
def solve(n, lines):
members = {}
now = 0
for line in lines:
line_sp = line.split()
try:
members[line_sp[0]] += int(line_sp[1]) - now
except:
members[line_sp[0]] = int(line_sp[1]) - now
now += 1
max = -i... | 0 |
141 | A | Amusing Joke | PROGRAMMING | 800 | [
"implementation",
"sortings",
"strings"
] | null | null | So, the New Year holidays are over. Santa Claus and his colleagues can take a rest and have guests at last. When two "New Year and Christmas Men" meet, thear assistants cut out of cardboard the letters from the guest's name and the host's name in honor of this event. Then the hung the letters above the main entrance. O... | The input file consists of three lines: the first line contains the guest's name, the second line contains the name of the residence host and the third line contains letters in a pile that were found at the door in the morning. All lines are not empty and contain only uppercase Latin letters. The length of each line do... | Print "YES" without the quotes, if the letters in the pile could be permuted to make the names of the "New Year and Christmas Men". Otherwise, print "NO" without the quotes. | [
"SANTACLAUS\nDEDMOROZ\nSANTAMOROZDEDCLAUS\n",
"PAPAINOEL\nJOULUPUKKI\nJOULNAPAOILELUPUKKI\n",
"BABBONATALE\nFATHERCHRISTMAS\nBABCHRISTMASBONATALLEFATHER\n"
] | [
"YES\n",
"NO\n",
"NO\n"
] | In the first sample the letters written in the last line can be used to write the names and there won't be any extra letters left.
In the second sample letter "P" is missing from the pile and there's an extra letter "L".
In the third sample there's an extra letter "L". | 500 | [
{
"input": "SANTACLAUS\nDEDMOROZ\nSANTAMOROZDEDCLAUS",
"output": "YES"
},
{
"input": "PAPAINOEL\nJOULUPUKKI\nJOULNAPAOILELUPUKKI",
"output": "NO"
},
{
"input": "BABBONATALE\nFATHERCHRISTMAS\nBABCHRISTMASBONATALLEFATHER",
"output": "NO"
},
{
"input": "B\nA\nAB",
"output": ... | 1,686,761,273 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 8 | 92 | 0 | s1=input()
s2=input()
s3=input()
t=False
for i in s1+s2:
try:
s3=s3.replace(i,"",1)
except:
t=True
break
if t:
print("NO")
else:
if s3=="":
print("YES")
else:
print("NO") | Title: Amusing Joke
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
So, the New Year holidays are over. Santa Claus and his colleagues can take a rest and have guests at last. When two "New Year and Christmas Men" meet, thear assistants cut out of cardboard the letters from the guest's nam... | ```python
s1=input()
s2=input()
s3=input()
t=False
for i in s1+s2:
try:
s3=s3.replace(i,"",1)
except:
t=True
break
if t:
print("NO")
else:
if s3=="":
print("YES")
else:
print("NO")
``` | 0 | |
1 | A | Theatre Square | PROGRAMMING | 1,000 | [
"math"
] | A. Theatre Square | 1 | 256 | Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=×<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each flagstone is of the size *a*<=×<=*a*.
What is the least number of flagstones needed to pave the... | The input contains three positive integer numbers in the first line: *n*,<=<=*m* and *a* (1<=≤<=<=*n*,<=*m*,<=*a*<=≤<=109). | Write the needed number of flagstones. | [
"6 6 4\n"
] | [
"4\n"
] | none | 0 | [
{
"input": "6 6 4",
"output": "4"
},
{
"input": "1 1 1",
"output": "1"
},
{
"input": "2 1 1",
"output": "2"
},
{
"input": "1 2 1",
"output": "2"
},
{
"input": "2 2 1",
"output": "4"
},
{
"input": "2 1 2",
"output": "1"
},
{
"input": "1 1 3"... | 1,684,657,904 | 2,147,483,647 | PyPy 3-64 | WRONG_ANSWER | TESTS | 1 | 46 | 0 | # Ввод данных
n, m, a = map(int, input().split())
# Проверка, можно ли покрыть площадь одной плитой
if a >= n and a >= m:
total_tiles = 0
else:
# Вычисление количества плит
tiles_width = (n + a - 1) // a # округление вверх
tiles_length = (m + a - 1) // a
total_tiles = tiles_width * tiles_length
#... | Title: Theatre Square
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=×<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each ... | ```python
# Ввод данных
n, m, a = map(int, input().split())
# Проверка, можно ли покрыть площадь одной плитой
if a >= n and a >= m:
total_tiles = 0
else:
# Вычисление количества плит
tiles_width = (n + a - 1) // a # округление вверх
tiles_length = (m + a - 1) // a
total_tiles = tiles_width * tiles... | 0 |
755 | A | PolandBall and Hypothesis | PROGRAMMING | 800 | [
"brute force",
"graphs",
"math",
"number theory"
] | null | null | PolandBall is a young, clever Ball. He is interested in prime numbers. He has stated a following hypothesis: "There exists such a positive integer *n* that for each positive integer *m* number *n*·*m*<=+<=1 is a prime number".
Unfortunately, PolandBall is not experienced yet and doesn't know that his hypothesis is inc... | The only number in the input is *n* (1<=≤<=*n*<=≤<=1000) — number from the PolandBall's hypothesis. | Output such *m* that *n*·*m*<=+<=1 is not a prime number. Your answer will be considered correct if you output any suitable *m* such that 1<=≤<=*m*<=≤<=103. It is guaranteed the the answer exists. | [
"3\n",
"4\n"
] | [
"1",
"2"
] | A prime number (or a prime) is a natural number greater than 1 that has no positive divisors other than 1 and itself.
For the first sample testcase, 3·1 + 1 = 4. We can output 1.
In the second sample testcase, 4·1 + 1 = 5. We cannot output 1 because 5 is prime. However, *m* = 2 is okay since 4·2 + 1 = 9, which is not... | 500 | [
{
"input": "3",
"output": "1"
},
{
"input": "4",
"output": "2"
},
{
"input": "10",
"output": "2"
},
{
"input": "153",
"output": "1"
},
{
"input": "1000",
"output": "1"
},
{
"input": "1",
"output": "3"
},
{
"input": "2",
"output": "4"
... | 1,691,174,043 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 1 | 30 | 0 | def primo(a):
for j in range(0, a):
if a%j == 0:
return False
return True
n = int(input())
if n%2 == 1:
print("1")
else:
for i in 1000:
a = (n*i)+1
vf = primo(a)
if vf == False:
print(i)
break
| Title: PolandBall and Hypothesis
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
PolandBall is a young, clever Ball. He is interested in prime numbers. He has stated a following hypothesis: "There exists such a positive integer *n* that for each positive integer *m* number *n*·*m*<=+<=1 is... | ```python
def primo(a):
for j in range(0, a):
if a%j == 0:
return False
return True
n = int(input())
if n%2 == 1:
print("1")
else:
for i in 1000:
a = (n*i)+1
vf = primo(a)
if vf == False:
print(i)
break
... | -1 | |
553 | B | Kyoya and Permutation | PROGRAMMING | 1,900 | [
"binary search",
"combinatorics",
"constructive algorithms",
"greedy",
"implementation",
"math"
] | null | null | Let's define the permutation of length *n* as an array *p*<==<=[*p*1,<=*p*2,<=...,<=*p**n*] consisting of *n* distinct integers from range from 1 to *n*. We say that this permutation maps value 1 into the value *p*1, value 2 into the value *p*2 and so on.
Kyota Ootori has just learned about cyclic representation of a ... | The first line will contain two integers *n*, *k* (1<=≤<=*n*<=≤<=50, 1<=≤<=*k*<=≤<=*min*{1018,<=*l*} where *l* is the length of the Kyoya's list). | Print *n* space-separated integers, representing the permutation that is the answer for the question. | [
"4 3\n",
"10 1\n"
] | [
"1 3 2 4\n",
"1 2 3 4 5 6 7 8 9 10\n"
] | The standard cycle representation is (1)(32)(4), which after removing parenthesis gives us the original permutation. The first permutation on the list would be [1, 2, 3, 4], while the second permutation would be [1, 2, 4, 3]. | 500 | [
{
"input": "4 3",
"output": "1 3 2 4"
},
{
"input": "10 1",
"output": "1 2 3 4 5 6 7 8 9 10"
},
{
"input": "1 1",
"output": "1"
},
{
"input": "50 1",
"output": "1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 ... | 1,696,776,460 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 31 | 0 | import math
n, k = map(int, input().split())
# Initialize the permutation array
permutation = [0] * n
# Initialize k_remaining
k_remaining = k - 1
for i in range(n, 0, -1):
# Calculate the number of cycles starting with i
cycles = k_remaining // math.factorial(i - 1)
# Calculate the p... | Title: Kyoya and Permutation
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Let's define the permutation of length *n* as an array *p*<==<=[*p*1,<=*p*2,<=...,<=*p**n*] consisting of *n* distinct integers from range from 1 to *n*. We say that this permutation maps value 1 into the value *p... | ```python
import math
n, k = map(int, input().split())
# Initialize the permutation array
permutation = [0] * n
# Initialize k_remaining
k_remaining = k - 1
for i in range(n, 0, -1):
# Calculate the number of cycles starting with i
cycles = k_remaining // math.factorial(i - 1)
# Calcu... | 0 | |
177 | A1 | Good Matrix Elements | PROGRAMMING | 800 | [
"implementation"
] | null | null | The Smart Beaver from ABBYY got hooked on square matrices. Now he is busy studying an *n*<=×<=*n* size matrix, where *n* is odd. The Smart Beaver considers the following matrix elements good:
- Elements of the main diagonal. - Elements of the secondary diagonal. - Elements of the "middle" row — the row which ha... | The first line of input data contains a single odd integer *n*. Each of the next *n* lines contains *n* integers *a**ij* (0<=≤<=*a**ij*<=≤<=100) separated by single spaces — the elements of the given matrix.
The input limitations for getting 30 points are:
- 1<=≤<=*n*<=≤<=5
The input limitations for getting 100 po... | Print a single integer — the sum of good matrix elements. | [
"3\n1 2 3\n4 5 6\n7 8 9\n",
"5\n1 1 1 1 1\n1 1 1 1 1\n1 1 1 1 1\n1 1 1 1 1\n1 1 1 1 1\n"
] | [
"45\n",
"17\n"
] | In the first sample all matrix elements will be good. Good elements in the second sample are shown on the figure. | 30 | [
{
"input": "3\n1 2 3\n4 5 6\n7 8 9",
"output": "45"
},
{
"input": "5\n1 1 1 1 1\n1 1 1 1 1\n1 1 1 1 1\n1 1 1 1 1\n1 1 1 1 1",
"output": "17"
},
{
"input": "1\n3",
"output": "3"
},
{
"input": "5\n27 7 3 11 72\n19 49 68 19 59\n41 25 37 64 65\n8 39 96 62 90\n13 37 43 26 33",
... | 1,563,124,773 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS1 | 0 | 186 | 0 | # import sys
# sys.stdin=open("input.in","r")
n=int(input())
l=[]
s=0
for i in range(n):
l.append(list(map(int,input().split())))
if i!=n//2:
s+=l[i][i]+l[i][n-1-i]+l[i][n//2]
else:
s+=sum(l[i])
print(l)
print(s)
| Title: Good Matrix Elements
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The Smart Beaver from ABBYY got hooked on square matrices. Now he is busy studying an *n*<=×<=*n* size matrix, where *n* is odd. The Smart Beaver considers the following matrix elements good:
- Elements of the ... | ```python
# import sys
# sys.stdin=open("input.in","r")
n=int(input())
l=[]
s=0
for i in range(n):
l.append(list(map(int,input().split())))
if i!=n//2:
s+=l[i][i]+l[i][n-1-i]+l[i][n//2]
else:
s+=sum(l[i])
print(l)
print(s)
``` | 0 | |
921 | 01 | Labyrinth-1 | PROGRAMMING | 3,200 | [] | null | null | You have a robot in a two-dimensional labyrinth which consists of *N*<=×<=*M* cells. Some pairs of cells adjacent by side are separated by a wall or a door. The labyrinth itself is separated from the outside with walls around it. Some labyrinth cells are the exits. In order to leave the labyrinth the robot should reach... | The first line contains integers *i*,<= *W*,<= *N*,<= *M*,<= *x*0,<= *y*0,<= *C*,<= *D*,<= *K*,<= *E*.
- 1<=≤<=*i*<=≤<=14 – labyrinth’s number, which is needed for a checking program. - 1<=≤<=*W*<=≤<=1018 – labyrinth’s weight, which is needed for a checking program. - 2<=≤<=*N*,<=*M*<=≤<=1000 – labyrinth’s height ... | Print a program in *abc* language which passes the given labyrinth. Commands have to be separated by at least one space symbol. You can use arbitrary formatting for the program. | [
"1 1 30 30 1 1 1 1 1 1\n1 1 1 2\n2 2 2 3\n1 4\n9 0\n"
] | [
"for-1111\n take\n open-up\n open-left\n open-right\n open-down\n move-left\n if-ok\n for-11\n move-left\n take\n open-up\n open-left\n open-right\n open-down\n end\n else\n move-right\n if-ok\n for-11\n move-right\n take\n open-up\n open-left\n open-right\n open-down\... | none | 15.025 | [] | 1,517,503,074 | 2,274 | Python 3 | PARTIAL | TESTS | 1 | 31 | 5,632,000 | print('''move-left
move-down
move-down
move-down
move-down
move-down
move-down
move-down
move-down
terminate
''') | Title: Labyrinth-1
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You have a robot in a two-dimensional labyrinth which consists of *N*<=×<=*M* cells. Some pairs of cells adjacent by side are separated by a wall or a door. The labyrinth itself is separated from the outside with walls arou... | ```python
print('''move-left
move-down
move-down
move-down
move-down
move-down
move-down
move-down
move-down
terminate
''')
``` | 2 | |
322 | A | Ciel and Dancing | PROGRAMMING | 1,000 | [
"greedy"
] | null | null | Fox Ciel and her friends are in a dancing room. There are *n* boys and *m* girls here, and they never danced before. There will be some songs, during each song, there must be exactly one boy and one girl are dancing. Besides, there is a special rule:
- either the boy in the dancing pair must dance for the first time ... | The first line contains two integers *n* and *m* (1<=≤<=*n*,<=*m*<=≤<=100) — the number of boys and girls in the dancing room. | In the first line print *k* — the number of songs during which they can dance. Then in the following *k* lines, print the indexes of boys and girls dancing during songs chronologically. You can assume that the boys are indexed from 1 to *n*, and the girls are indexed from 1 to *m*. | [
"2 1\n",
"2 2\n"
] | [
"2\n1 1\n2 1\n",
"3\n1 1\n1 2\n2 2\n"
] | In test case 1, there are 2 boys and 1 girl. We can have 2 dances: the 1st boy and 1st girl (during the first song), the 2nd boy and 1st girl (during the second song).
And in test case 2, we have 2 boys with 2 girls, the answer is 3. | 500 | [
{
"input": "2 1",
"output": "2\n1 1\n2 1"
},
{
"input": "2 2",
"output": "3\n1 1\n1 2\n2 2"
},
{
"input": "1 1",
"output": "1\n1 1"
},
{
"input": "2 3",
"output": "4\n1 1\n1 2\n1 3\n2 3"
},
{
"input": "4 4",
"output": "7\n1 1\n1 2\n1 3\n1 4\n4 4\n3 4\n2 4"
}... | 1,615,821,651 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 3 | 92 | 0 | def solve(n,m):
max_val = max(n,m)
min_val = min(n,m)
count = max_val+min_val-1
print(count)
for i in range(1,max_val+1):
print(i,1)
for j in range(2,min_val+1):
print(1,j)
def main() :
# x = int(input())
arr = list(map(int, input().split(' ')))
# arr = []
# for _ in range(n):
... | Title: Ciel and Dancing
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Fox Ciel and her friends are in a dancing room. There are *n* boys and *m* girls here, and they never danced before. There will be some songs, during each song, there must be exactly one boy and one girl are dancing. B... | ```python
def solve(n,m):
max_val = max(n,m)
min_val = min(n,m)
count = max_val+min_val-1
print(count)
for i in range(1,max_val+1):
print(i,1)
for j in range(2,min_val+1):
print(1,j)
def main() :
# x = int(input())
arr = list(map(int, input().split(' ')))
# arr = []
# for _ in r... | 0 | |
169 | A | Chores | PROGRAMMING | 800 | [
"sortings"
] | null | null | Petya and Vasya are brothers. Today is a special day for them as their parents left them home alone and commissioned them to do *n* chores. Each chore is characterized by a single parameter — its complexity. The complexity of the *i*-th chore equals *h**i*.
As Petya is older, he wants to take the chores with complexit... | The first input line contains three integers *n*,<=*a* and *b* (2<=≤<=*n*<=≤<=2000; *a*,<=*b*<=≥<=1; *a*<=+<=*b*<==<=*n*) — the total number of chores, the number of Petya's chores and the number of Vasya's chores.
The next line contains a sequence of integers *h*1,<=*h*2,<=...,<=*h**n* (1<=≤<=*h**i*<=≤<=109), *h**i* ... | Print the required number of ways to choose an integer value of *x*. If there are no such ways, print 0. | [
"5 2 3\n6 2 3 100 1\n",
"7 3 4\n1 1 9 1 1 1 1\n"
] | [
"3\n",
"0\n"
] | In the first sample the possible values of *x* are 3, 4 or 5.
In the second sample it is impossible to find such *x*, that Petya got 3 chores and Vasya got 4. | 500 | [
{
"input": "5 2 3\n6 2 3 100 1",
"output": "3"
},
{
"input": "7 3 4\n1 1 9 1 1 1 1",
"output": "0"
},
{
"input": "2 1 1\n10 2",
"output": "8"
},
{
"input": "2 1 1\n7 7",
"output": "0"
},
{
"input": "2 1 1\n1 1000000000",
"output": "999999999"
},
{
"inp... | 1,554,903,752 | 2,147,483,647 | Python 3 | MEMORY_LIMIT_EXCEEDED | TESTS | 4 | 1,263 | 268,390,400 | #input
def findX(list_chores, a, b):
first = list_chores[b -1]
second = list_chores[-a]
result = []
for i in range(first, second):
result.append(i)
return len(result)
n, a, b = list(map(int, input().split()))
list_chores = list(map(int, input().split()))
list_chores.sort()
#print(list... | Title: Chores
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Petya and Vasya are brothers. Today is a special day for them as their parents left them home alone and commissioned them to do *n* chores. Each chore is characterized by a single parameter — its complexity. The complexity of th... | ```python
#input
def findX(list_chores, a, b):
first = list_chores[b -1]
second = list_chores[-a]
result = []
for i in range(first, second):
result.append(i)
return len(result)
n, a, b = list(map(int, input().split()))
list_chores = list(map(int, input().split()))
list_chores.sort()
#... | 0 | |
841 | B | Godsend | PROGRAMMING | 1,100 | [
"games",
"math"
] | null | null | Leha somehow found an array consisting of *n* integers. Looking at it, he came up with a task. Two players play the game on the array. Players move one by one. The first player can choose for his move a subsegment of non-zero length with an odd sum of numbers and remove it from the array, after that the remaining parts... | First line of input data contains single integer *n* (1<=≤<=*n*<=≤<=106) — length of the array.
Next line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≤<=*a**i*<=≤<=109). | Output answer in single line. "First", if first player wins, and "Second" otherwise (without quotes). | [
"4\n1 3 2 3\n",
"2\n2 2\n"
] | [
"First\n",
"Second\n"
] | In first sample first player remove whole array in one move and win.
In second sample first player can't make a move and lose. | 1,000 | [
{
"input": "4\n1 3 2 3",
"output": "First"
},
{
"input": "2\n2 2",
"output": "Second"
},
{
"input": "4\n2 4 6 8",
"output": "Second"
},
{
"input": "5\n1 1 1 1 1",
"output": "First"
},
{
"input": "4\n720074544 345031254 849487632 80870826",
"output": "Second"
... | 1,586,205,777 | 2,147,483,647 | PyPy 3 | WRONG_ANSWER | TESTS | 4 | 124 | 0 | n = int(input())
a = list(map(int,input().split()))
open = False
s = 0 # num of odd islands
for x in a:
if x%2 == 1:
if not open:
open = True
l = 1
else:
l += 1
else:
if open:
open = False
if l%2 == 0:
... | Title: Godsend
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Leha somehow found an array consisting of *n* integers. Looking at it, he came up with a task. Two players play the game on the array. Players move one by one. The first player can choose for his move a subsegment of non-zero l... | ```python
n = int(input())
a = list(map(int,input().split()))
open = False
s = 0 # num of odd islands
for x in a:
if x%2 == 1:
if not open:
open = True
l = 1
else:
l += 1
else:
if open:
open = False
if l%2 == 0:
... | 0 | |
731 | A | Night at the Museum | PROGRAMMING | 800 | [
"implementation",
"strings"
] | null | null | Grigoriy, like the hero of one famous comedy film, found a job as a night security guard at the museum. At first night he received embosser and was to take stock of the whole exposition.
Embosser is a special devise that allows to "print" the text of a plastic tape. Text is printed sequentially, character by character... | The only line of input contains the name of some exhibit — the non-empty string consisting of no more than 100 characters. It's guaranteed that the string consists of only lowercase English letters. | Print one integer — the minimum number of rotations of the wheel, required to print the name given in the input. | [
"zeus\n",
"map\n",
"ares\n"
] | [
"18\n",
"35\n",
"34\n"
] | To print the string from the first sample it would be optimal to perform the following sequence of rotations:
1. from 'a' to 'z' (1 rotation counterclockwise), 1. from 'z' to 'e' (5 clockwise rotations), 1. from 'e' to 'u' (10 rotations counterclockwise), 1. from 'u' to 's' (2 counterclockwise rotations). | 500 | [
{
"input": "zeus",
"output": "18"
},
{
"input": "map",
"output": "35"
},
{
"input": "ares",
"output": "34"
},
{
"input": "l",
"output": "11"
},
{
"input": "abcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuv",
"... | 1,686,907,230 | 2,147,483,647 | Python 3 | OK | TESTS | 44 | 46 | 0 | lst = [chr(i) for i in range(97, 123)]
s = input()
count = 0
current = 'a'
for i in s:
count += min(26 - abs(lst.index(current) - lst.index(i)), abs(lst.index(current) - lst.index(i)))
current = i
print(count) | Title: Night at the Museum
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Grigoriy, like the hero of one famous comedy film, found a job as a night security guard at the museum. At first night he received embosser and was to take stock of the whole exposition.
Embosser is a special devis... | ```python
lst = [chr(i) for i in range(97, 123)]
s = input()
count = 0
current = 'a'
for i in s:
count += min(26 - abs(lst.index(current) - lst.index(i)), abs(lst.index(current) - lst.index(i)))
current = i
print(count)
``` | 3 | |
41 | A | Translation | PROGRAMMING | 800 | [
"implementation",
"strings"
] | A. Translation | 2 | 256 | The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc.... | The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols. | If the word *t* is a word *s*, written reversely, print YES, otherwise print NO. | [
"code\nedoc\n",
"abb\naba\n",
"code\ncode\n"
] | [
"YES\n",
"NO\n",
"NO\n"
] | none | 500 | [
{
"input": "code\nedoc",
"output": "YES"
},
{
"input": "abb\naba",
"output": "NO"
},
{
"input": "code\ncode",
"output": "NO"
},
{
"input": "abacaba\nabacaba",
"output": "YES"
},
{
"input": "q\nq",
"output": "YES"
},
{
"input": "asrgdfngfnmfgnhweratgjkk... | 1,669,230,004 | 2,147,483,647 | Python 3 | OK | TESTS | 40 | 92 | 0 | n=input()
a=input()
s=""
for i in range(1,len(n)+1):
s=s+n[-i]
if s in a:
print("YES")
else:
print("NO")
| Title: Translation
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pron... | ```python
n=input()
a=input()
s=""
for i in range(1,len(n)+1):
s=s+n[-i]
if s in a:
print("YES")
else:
print("NO")
``` | 3.977 |
379 | C | New Year Ratings Change | PROGRAMMING | 1,400 | [
"greedy",
"sortings"
] | null | null | One very well-known internet resource site (let's call it X) has come up with a New Year adventure. Specifically, they decided to give ratings to all visitors.
There are *n* users on the site, for each user we know the rating value he wants to get as a New Year Present. We know that user *i* wants to get at least *a**... | The first line contains integer *n* (1<=≤<=*n*<=≤<=3·105) — the number of users on the site. The next line contains integer sequence *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109). | Print a sequence of integers *b*1,<=*b*2,<=...,<=*b**n*. Number *b**i* means that user *i* gets *b**i* of rating as a present. The printed sequence must meet the problem conditions.
If there are multiple optimal solutions, print any of them. | [
"3\n5 1 1\n",
"1\n1000000000\n"
] | [
"5 1 2\n",
"1000000000\n"
] | none | 1,500 | [
{
"input": "3\n5 1 1",
"output": "5 1 2"
},
{
"input": "1\n1000000000",
"output": "1000000000"
},
{
"input": "10\n1 1 1 1 1 1 1 1 1 1",
"output": "1 2 3 4 5 6 7 8 9 10"
},
{
"input": "10\n1 10 1 10 1 1 7 8 6 7",
"output": "1 10 2 11 3 4 7 9 6 8"
},
{
"input": "10\... | 1,693,365,914 | 2,147,483,647 | PyPy 3-64 | TIME_LIMIT_EXCEEDED | TESTS | 4 | 1,000 | 29,593,600 | n = int(input())
#for i in range(n):
want = [int(n) for n in input().split()]
for i in range(len(want)):
while want.count(want[i]) > 1:
want[i] += 1
wantstr = [str(i) for i in want]
print(' '.join(wantstr))
| Title: New Year Ratings Change
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One very well-known internet resource site (let's call it X) has come up with a New Year adventure. Specifically, they decided to give ratings to all visitors.
There are *n* users on the site, for each user we ... | ```python
n = int(input())
#for i in range(n):
want = [int(n) for n in input().split()]
for i in range(len(want)):
while want.count(want[i]) > 1:
want[i] += 1
wantstr = [str(i) for i in want]
print(' '.join(wantstr))
``` | 0 | |
754 | A | Lesha and array splitting | PROGRAMMING | 1,200 | [
"constructive algorithms",
"greedy",
"implementation"
] | null | null | One spring day on his way to university Lesha found an array *A*. Lesha likes to split arrays into several parts. This time Lesha decided to split the array *A* into several, possibly one, new arrays so that the sum of elements in each of the new arrays is not zero. One more condition is that if we place the new arrays... | The first line contains single integer *n* (1<=≤<=*n*<=≤<=100) — the number of elements in the array *A*.
The next line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (<=-<=103<=≤<=*a**i*<=≤<=103) — the elements of the array *A*. | If it is not possible to split the array *A* and satisfy all the constraints, print single line containing "NO" (without quotes).
Otherwise in the first line print "YES" (without quotes). In the next line print single integer *k* — the number of new arrays. In each of the next *k* lines print two integers *l**i* and *... | [
"3\n1 2 -3\n",
"8\n9 -12 3 4 -4 -10 7 3\n",
"1\n0\n",
"4\n1 2 3 -5\n"
] | [
"YES\n2\n1 2\n3 3\n",
"YES\n2\n1 2\n3 8\n",
"NO\n",
"YES\n4\n1 1\n2 2\n3 3\n4 4\n"
] | none | 500 | [
{
"input": "3\n1 2 -3",
"output": "YES\n3\n1 1\n2 2\n3 3"
},
{
"input": "8\n9 -12 3 4 -4 -10 7 3",
"output": "YES\n8\n1 1\n2 2\n3 3\n4 4\n5 5\n6 6\n7 7\n8 8"
},
{
"input": "1\n0",
"output": "NO"
},
{
"input": "4\n1 2 3 -5",
"output": "YES\n4\n1 1\n2 2\n3 3\n4 4"
},
{
... | 1,640,669,008 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 7 | 46 | 0 | n = int(input())
arr = list(map(int, input().split()))
inc = 0
for i in arr:
if (i == 0):
inc += 1
inc2 = 0
i = n - 1
while i >= 0:
if (arr[i] == 0):
inc2 += 1
else:
break
i -= 1
if(inc == n):
print('NO')
else:
arr2 = []
count = 0
i = 0
w... | Title: Lesha and array splitting
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One spring day on his way to university Lesha found an array *A*. Lesha likes to split arrays into several parts. This time Lesha decided to split the array *A* into several, possibly one, new arrays so that t... | ```python
n = int(input())
arr = list(map(int, input().split()))
inc = 0
for i in arr:
if (i == 0):
inc += 1
inc2 = 0
i = n - 1
while i >= 0:
if (arr[i] == 0):
inc2 += 1
else:
break
i -= 1
if(inc == n):
print('NO')
else:
arr2 = []
count = 0
i ... | 0 | |
37 | A | Towers | PROGRAMMING | 1,000 | [
"sortings"
] | A. Towers | 2 | 256 | Little Vasya has received a young builder’s kit. The kit consists of several wooden bars, the lengths of all of them are known. The bars can be put one on the top of the other if their lengths are the same.
Vasya wants to construct the minimal number of towers from the bars. Help Vasya to use the bars in the best way ... | The first line contains an integer *N* (1<=≤<=*N*<=≤<=1000) — the number of bars at Vasya’s disposal. The second line contains *N* space-separated integers *l**i* — the lengths of the bars. All the lengths are natural numbers not exceeding 1000. | In one line output two numbers — the height of the largest tower and their total number. Remember that Vasya should use all the bars. | [
"3\n1 2 3\n",
"4\n6 5 6 7\n"
] | [
"1 3\n",
"2 3\n"
] | none | 500 | [
{
"input": "3\n1 2 3",
"output": "1 3"
},
{
"input": "4\n6 5 6 7",
"output": "2 3"
},
{
"input": "4\n3 2 1 1",
"output": "2 3"
},
{
"input": "4\n1 2 3 3",
"output": "2 3"
},
{
"input": "3\n20 22 36",
"output": "1 3"
},
{
"input": "25\n47 30 94 41 45 20... | 1,583,298,601 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 23 | 218 | 512,000 | n=int(input())
a = list(map(int,input().strip().split()))[:n]
h=0
b=[]
c=[0]
c=c*n
for j in range(0,n):
if(a[j] not in b):
b.append(a[j])
c[j]+=1
else:
for i in range(0,len(b)):
if(a[j]==b[i]):
c[i]+=1
print(max(c),len(b))
| Title: Towers
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Little Vasya has received a young builder’s kit. The kit consists of several wooden bars, the lengths of all of them are known. The bars can be put one on the top of the other if their lengths are the same.
Vasya wants to construct... | ```python
n=int(input())
a = list(map(int,input().strip().split()))[:n]
h=0
b=[]
c=[0]
c=c*n
for j in range(0,n):
if(a[j] not in b):
b.append(a[j])
c[j]+=1
else:
for i in range(0,len(b)):
if(a[j]==b[i]):
c[i]+=1
print(max(c),len(b))... | 0 |
593 | A | 2Char | PROGRAMMING | 1,200 | [
"brute force",
"implementation"
] | null | null | Andrew often reads articles in his favorite magazine 2Char. The main feature of these articles is that each of them uses at most two distinct letters. Andrew decided to send an article to the magazine, but as he hasn't written any article, he just decided to take a random one from magazine 26Char. However, before sendi... | The first line of the input contains number *n* (1<=≤<=*n*<=≤<=100) — the number of words in the article chosen by Andrew. Following are *n* lines, each of them contains one word. All the words consist only of small English letters and their total length doesn't exceed 1000. The words are not guaranteed to be distinct,... | Print a single integer — the maximum possible total length of words in Andrew's article. | [
"4\nabb\ncacc\naaa\nbbb\n",
"5\na\na\nbcbcb\ncdecdecdecdecdecde\naaaa\n"
] | [
"9",
"6"
] | In the first sample the optimal way to choose words is {'abb', 'aaa', 'bbb'}.
In the second sample the word 'cdecdecdecdecdecde' consists of three distinct letters, and thus cannot be used in the article. The optimal answer is {'a', 'a', 'aaaa'}. | 250 | [
{
"input": "4\nabb\ncacc\naaa\nbbb",
"output": "9"
},
{
"input": "5\na\na\nbcbcb\ncdecdecdecdecdecde\naaaa",
"output": "6"
},
{
"input": "1\na",
"output": "1"
},
{
"input": "2\nz\nz",
"output": "2"
},
{
"input": "5\nabcde\nfghij\nklmno\npqrst\nuvwxy",
"output"... | 1,446,668,674 | 2,147,483,647 | Python 3 | OK | TESTS | 49 | 93 | 0 | n = int(input())
a = []
b = []
for i in range(n):
s = input()
a.append(sorted(list(set(s))))
b.append(len(s))
v = 0
for i in range(97,97+25):
for j in range(98,97+26):
u = 0
for k in range(n):
for c in a[k]:
if ord(c) != i and ord(c) != j:
... | Title: 2Char
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Andrew often reads articles in his favorite magazine 2Char. The main feature of these articles is that each of them uses at most two distinct letters. Andrew decided to send an article to the magazine, but as he hasn't written an... | ```python
n = int(input())
a = []
b = []
for i in range(n):
s = input()
a.append(sorted(list(set(s))))
b.append(len(s))
v = 0
for i in range(97,97+25):
for j in range(98,97+26):
u = 0
for k in range(n):
for c in a[k]:
if ord(c) != i and ord(c) != j... | 3 | |
32 | B | Borze | PROGRAMMING | 800 | [
"expression parsing",
"implementation"
] | B. Borze | 2 | 256 | Ternary numeric notation is quite popular in Berland. To telegraph the ternary number the Borze alphabet is used. Digit 0 is transmitted as «.», 1 as «-.» and 2 as «--». You are to decode the Borze code, i.e. to find out the ternary number given its representation in Borze alphabet. | The first line contains a number in Borze code. The length of the string is between 1 and 200 characters. It's guaranteed that the given string is a valid Borze code of some ternary number (this number can have leading zeroes). | Output the decoded ternary number. It can have leading zeroes. | [
".-.--\n",
"--.\n",
"-..-.--\n"
] | [
"012",
"20",
"1012"
] | none | 1,000 | [
{
"input": ".-.--",
"output": "012"
},
{
"input": "--.",
"output": "20"
},
{
"input": "-..-.--",
"output": "1012"
},
{
"input": "---..",
"output": "210"
},
{
"input": "..--.---..",
"output": "0020210"
},
{
"input": "-.....----.",
"output": "1000022... | 1,689,411,982 | 2,147,483,647 | Python 3 | OK | TESTS | 30 | 92 | 0 | code = input()
i = 0
n = len(code)
result = ''
while i < n:
if code[i] == '.':
result += '0'
elif code[i] == '-' and code[i+1] == '.':
result += '1'
i += 1
elif code[i] == '-' and code[i+1] == '-':
result += '2'
i += 1
i += 1
print(result)
| Title: Borze
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Ternary numeric notation is quite popular in Berland. To telegraph the ternary number the Borze alphabet is used. Digit 0 is transmitted as «.», 1 as «-.» and 2 as «--». You are to decode the Borze code, i.e. to find out the ternary ... | ```python
code = input()
i = 0
n = len(code)
result = ''
while i < n:
if code[i] == '.':
result += '0'
elif code[i] == '-' and code[i+1] == '.':
result += '1'
i += 1
elif code[i] == '-' and code[i+1] == '-':
result += '2'
i += 1
i += 1
print(resu... | 3.977 |
0 | none | none | none | 0 | [
"none"
] | null | null | There are *n* people and *k* keys on a straight line. Every person wants to get to the office which is located on the line as well. To do that, he needs to reach some point with a key, take the key and then go to the office. Once a key is taken by somebody, it couldn't be taken by anybody else.
You are to determine th... | The first line contains three integers *n*, *k* and *p* (1<=≤<=*n*<=≤<=1<=000, *n*<=≤<=*k*<=≤<=2<=000, 1<=≤<=*p*<=≤<=109) — the number of people, the number of keys and the office location.
The second line contains *n* distinct integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≤<=*a**i*<=≤<=109) — positions in which people are ... | Print the minimum time (in seconds) needed for all *n* to reach the office with keys. | [
"2 4 50\n20 100\n60 10 40 80\n",
"1 2 10\n11\n15 7\n"
] | [
"50\n",
"7\n"
] | In the first example the person located at point 20 should take the key located at point 40 and go with it to the office located at point 50. He spends 30 seconds. The person located at point 100 can take the key located at point 80 and go to the office with it. He spends 50 seconds. Thus, after 50 seconds everybody is... | 0 | [
{
"input": "2 4 50\n20 100\n60 10 40 80",
"output": "50"
},
{
"input": "1 2 10\n11\n15 7",
"output": "7"
},
{
"input": "2 5 15\n10 4\n29 23 21 22 26",
"output": "23"
},
{
"input": "3 10 1500\n106 160 129\n1333 1532 1181 1091 1656 1698 1291 1741 1242 1163",
"output": "1394... | 1,675,787,672 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 0 | 15 | 0 | *_, office = map(int, input().split())
people = list(map(int, input().split()))
keys = list(map(int, input().split()))
def solve(office, people, key):
dists = []
for i in range(len(people)):
for keyidx in range(len(key)):
dists.append((abs(people[i]-key)+abs(key-office), i, keyi... | Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There are *n* people and *k* keys on a straight line. Every person wants to get to the office which is located on the line as well. To do that, he needs to reach some point with a key, take the key and then go to the office. Once ... | ```python
*_, office = map(int, input().split())
people = list(map(int, input().split()))
keys = list(map(int, input().split()))
def solve(office, people, key):
dists = []
for i in range(len(people)):
for keyidx in range(len(key)):
dists.append((abs(people[i]-key)+abs(key-office... | -1 | |
743 | C | Vladik and fractions | PROGRAMMING | 1,500 | [
"brute force",
"constructive algorithms",
"math",
"number theory"
] | null | null | Vladik and Chloe decided to determine who of them is better at math. Vladik claimed that for any positive integer *n* he can represent fraction as a sum of three distinct positive fractions in form .
Help Vladik with that, i.e for a given *n* find three distinct positive integers *x*, *y* and *z* such that . Because ... | The single line contains single integer *n* (1<=≤<=*n*<=≤<=104). | If the answer exists, print 3 distinct numbers *x*, *y* and *z* (1<=≤<=*x*,<=*y*,<=*z*<=≤<=109, *x*<=≠<=*y*, *x*<=≠<=*z*, *y*<=≠<=*z*). Otherwise print -1.
If there are multiple answers, print any of them. | [
"3\n",
"7\n"
] | [
"2 7 42\n",
"7 8 56\n"
] | none | 1,250 | [
{
"input": "3",
"output": "2 7 42"
},
{
"input": "7",
"output": "7 8 56"
},
{
"input": "2",
"output": "2 3 6"
},
{
"input": "5",
"output": "5 6 30"
},
{
"input": "4",
"output": "4 5 20"
},
{
"input": "7",
"output": "7 8 56"
},
{
"input": "8... | 1,656,892,561 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 0 | 46 | 0 | n=int(input())
print(n,2*n,2*n) | Title: Vladik and fractions
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vladik and Chloe decided to determine who of them is better at math. Vladik claimed that for any positive integer *n* he can represent fraction as a sum of three distinct positive fractions in form .
Help Vladik ... | ```python
n=int(input())
print(n,2*n,2*n)
``` | 0 | |
746 | B | Decoding | PROGRAMMING | 900 | [
"implementation",
"strings"
] | null | null | Polycarp is mad about coding, that is why he writes Sveta encoded messages. He calls the median letter in a word the letter which is in the middle of the word. If the word's length is even, the median letter is the left of the two middle letters. In the following examples, the median letter is highlighted: contest, inf... | The first line contains a positive integer *n* (1<=≤<=*n*<=≤<=2000) — the length of the encoded word.
The second line contains the string *s* of length *n* consisting of lowercase English letters — the encoding. | Print the word that Polycarp encoded. | [
"5\nlogva\n",
"2\nno\n",
"4\nabba\n"
] | [
"volga\n",
"no\n",
"baba\n"
] | In the first example Polycarp encoded the word volga. At first, he wrote down the letter l from the position 3, after that his word looked like voga. After that Polycarp wrote down the letter o from the position 2, his word became vga. Then Polycarp wrote down the letter g which was at the second position, the word bec... | 1,000 | [
{
"input": "5\nlogva",
"output": "volga"
},
{
"input": "2\nno",
"output": "no"
},
{
"input": "4\nabba",
"output": "baba"
},
{
"input": "51\nkfsmpaeviowvkdbuhdagquxxqniselafnfbrgbhmsugcbbnlrvv",
"output": "vlbcumbrfflsnxugdudvovamfkspeiwkbhaqxqieanbghsgbnrv"
},
{
"... | 1,622,944,143 | 2,147,483,647 | Python 3 | OK | TESTS | 34 | 109 | 0 | n=int(input())
li=list(input())
ans=['']*n
i=0
while n!=0:
if n==0:
break
elif n%2!=0:
m=n//2+i
elif n%2==0:
m=n//2-1
ans[m]=li[i]
n-=1
i+=1
ans=''.join(ans)
print(ans) | Title: Decoding
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Polycarp is mad about coding, that is why he writes Sveta encoded messages. He calls the median letter in a word the letter which is in the middle of the word. If the word's length is even, the median letter is the left of the... | ```python
n=int(input())
li=list(input())
ans=['']*n
i=0
while n!=0:
if n==0:
break
elif n%2!=0:
m=n//2+i
elif n%2==0:
m=n//2-1
ans[m]=li[i]
n-=1
i+=1
ans=''.join(ans)
print(ans)
``` | 3 | |
471 | A | MUH and Sticks | PROGRAMMING | 1,100 | [
"implementation"
] | null | null | Two polar bears Menshykov and Uslada from the St.Petersburg zoo and elephant Horace from the Kiev zoo got six sticks to play with and assess the animals' creativity. Menshykov, Uslada and Horace decided to make either an elephant or a bear from those sticks. They can make an animal from sticks in the following way:
-... | The single line contains six space-separated integers *l**i* (1<=≤<=*l**i*<=≤<=9) — the lengths of the six sticks. It is guaranteed that the input is such that you cannot make both animals from the sticks. | If you can make a bear from the given set, print string "Bear" (without the quotes). If you can make an elephant, print string "Elephant" (wıthout the quotes). If you can make neither a bear nor an elephant, print string "Alien" (without the quotes). | [
"4 2 5 4 4 4\n",
"4 4 5 4 4 5\n",
"1 2 3 4 5 6\n"
] | [
"Bear",
"Elephant",
"Alien"
] | If you're out of creative ideas, see instructions below which show how to make a bear and an elephant in the first two samples. The stick of length 2 is in red, the sticks of length 4 are in green, the sticks of length 5 are in blue. | 500 | [
{
"input": "4 2 5 4 4 4",
"output": "Bear"
},
{
"input": "4 4 5 4 4 5",
"output": "Elephant"
},
{
"input": "1 2 3 4 5 6",
"output": "Alien"
},
{
"input": "5 5 5 5 5 5",
"output": "Elephant"
},
{
"input": "1 1 1 2 3 5",
"output": "Alien"
},
{
"input": "... | 1,443,961,280 | 380 | PyPy 3 | WRONG_ANSWER | TESTS | 3 | 93 | 0 | import sys
try:
while True:
val = list(map(int, input().split(" ")))
cnt = [0 for i in range(100)]
for i in range(6):
cnt[val[i]] += 1
leg = -1
head = []
for i in range(1, 10):
if cnt[i] == 4:
leg = i
e... | Title: MUH and Sticks
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Two polar bears Menshykov and Uslada from the St.Petersburg zoo and elephant Horace from the Kiev zoo got six sticks to play with and assess the animals' creativity. Menshykov, Uslada and Horace decided to make either an... | ```python
import sys
try:
while True:
val = list(map(int, input().split(" ")))
cnt = [0 for i in range(100)]
for i in range(6):
cnt[val[i]] += 1
leg = -1
head = []
for i in range(1, 10):
if cnt[i] == 4:
leg = i
... | 0 | |
22 | A | Second Order Statistics | PROGRAMMING | 800 | [
"brute force"
] | A. Second Order Statistics | 2 | 256 | Once Bob needed to find the second order statistics of a sequence of integer numbers. Lets choose each number from the sequence exactly once and sort them. The value on the second position is the second order statistics of the given sequence. In other words it is the smallest element strictly greater than the minimum. ... | The first input line contains integer *n* (1<=≤<=*n*<=≤<=100) — amount of numbers in the sequence. The second line contains *n* space-separated integer numbers — elements of the sequence. These numbers don't exceed 100 in absolute value. | If the given sequence has the second order statistics, output this order statistics, otherwise output NO. | [
"4\n1 2 2 -4\n",
"5\n1 2 3 1 1\n"
] | [
"1\n",
"2\n"
] | none | 0 | [
{
"input": "4\n1 2 2 -4",
"output": "1"
},
{
"input": "5\n1 2 3 1 1",
"output": "2"
},
{
"input": "1\n28",
"output": "NO"
},
{
"input": "2\n-28 12",
"output": "12"
},
{
"input": "3\n-83 40 -80",
"output": "-80"
},
{
"input": "8\n93 77 -92 26 21 -48 53 ... | 1,526,910,369 | 2,147,483,647 | Python 3 | OK | TESTS | 31 | 186 | 0 | n = int(input())
a = list(map(int,input().split()))
a = set(a)
a = list(a)
a.sort()
if not len(a) ==1:
print(a[1])
else:
print('NO') | Title: Second Order Statistics
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Once Bob needed to find the second order statistics of a sequence of integer numbers. Lets choose each number from the sequence exactly once and sort them. The value on the second position is the second order statis... | ```python
n = int(input())
a = list(map(int,input().split()))
a = set(a)
a = list(a)
a.sort()
if not len(a) ==1:
print(a[1])
else:
print('NO')
``` | 3.9535 |
899 | C | Dividing the numbers | PROGRAMMING | 1,300 | [
"constructive algorithms",
"graphs",
"math"
] | null | null | Petya has *n* integers: 1,<=2,<=3,<=...,<=*n*. He wants to split these integers in two non-empty groups in such a way that the absolute difference of sums of integers in each group is as small as possible.
Help Petya to split the integers. Each of *n* integers should be exactly in one group. | The first line contains a single integer *n* (2<=≤<=*n*<=≤<=60<=000) — the number of integers Petya has. | Print the smallest possible absolute difference in the first line.
In the second line print the size of the first group, followed by the integers in that group. You can print these integers in arbitrary order. If there are multiple answers, print any of them. | [
"4\n",
"2\n"
] | [
"0\n2 1 4 \n",
"1\n1 1 \n"
] | In the first example you have to put integers 1 and 4 in the first group, and 2 and 3 in the second. This way the sum in each group is 5, and the absolute difference is 0.
In the second example there are only two integers, and since both groups should be non-empty, you have to put one integer in the first group and on... | 1,500 | [
{
"input": "4",
"output": "0\n2 1 4 "
},
{
"input": "2",
"output": "1\n1 1 "
},
{
"input": "3",
"output": "0\n1\n3 "
},
{
"input": "5",
"output": "1\n3\n1 2 5 "
},
{
"input": "59998",
"output": "1\n29999 1 4 5 8 9 12 13 16 17 20 21 24 25 28 29 32 33 36 37 40 4... | 1,693,821,896 | 2,147,483,647 | PyPy 3-64 | OK | TESTS | 60 | 93 | 4,505,600 |
def solve():
n = int(input())
if n==1:
print(1)
print(1,1)
return
gsum = n*(n+1)//2
tt = gsum
gsum/=2
t = gsum
g1 = []
for i in range(n,0,-1):
if gsum-i>=0:
gsum-=i
g1.append(i)
gsum = t-gsum
ts = tt-gsum
print(abs(int(ts-gsum)))
print(len(g1),*g1)
# number of test cases
#t = i... | Title: Dividing the numbers
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Petya has *n* integers: 1,<=2,<=3,<=...,<=*n*. He wants to split these integers in two non-empty groups in such a way that the absolute difference of sums of integers in each group is as small as possible.
Help P... | ```python
def solve():
n = int(input())
if n==1:
print(1)
print(1,1)
return
gsum = n*(n+1)//2
tt = gsum
gsum/=2
t = gsum
g1 = []
for i in range(n,0,-1):
if gsum-i>=0:
gsum-=i
g1.append(i)
gsum = t-gsum
ts = tt-gsum
print(abs(int(ts-gsum)))
print(len(g1),*g1)
# number of test ca... | 3 | |
1 | A | Theatre Square | PROGRAMMING | 1,000 | [
"math"
] | A. Theatre Square | 1 | 256 | Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=×<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each flagstone is of the size *a*<=×<=*a*.
What is the least number of flagstones needed to pave the... | The input contains three positive integer numbers in the first line: *n*,<=<=*m* and *a* (1<=≤<=<=*n*,<=*m*,<=*a*<=≤<=109). | Write the needed number of flagstones. | [
"6 6 4\n"
] | [
"4\n"
] | none | 0 | [
{
"input": "6 6 4",
"output": "4"
},
{
"input": "1 1 1",
"output": "1"
},
{
"input": "2 1 1",
"output": "2"
},
{
"input": "1 2 1",
"output": "2"
},
{
"input": "2 2 1",
"output": "4"
},
{
"input": "2 1 2",
"output": "1"
},
{
"input": "1 1 3"... | 1,694,159,869 | 2,147,483,647 | Python 3 | OK | TESTS | 20 | 46 | 0 | import math
# Read input values for n, m, and b
n, m, b = map(int, input().split())
# Calculate the number of flagstones needed for the rows (lengthwise)
row = math.ceil(n / b)
# Calculate the number of flagstones needed for the columns (widthwise)
col = math.ceil(m / b)
# Calculate the total number of flagstones n... | Title: Theatre Square
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=×<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each ... | ```python
import math
# Read input values for n, m, and b
n, m, b = map(int, input().split())
# Calculate the number of flagstones needed for the rows (lengthwise)
row = math.ceil(n / b)
# Calculate the number of flagstones needed for the columns (widthwise)
col = math.ceil(m / b)
# Calculate the total number of fl... | 3.977 |
443 | A | Anton and Letters | PROGRAMMING | 800 | [
"constructive algorithms",
"implementation"
] | null | null | Recently, Anton has found a set. The set consists of small English letters. Anton carefully wrote out all the letters from the set in one line, separated by a comma. He also added an opening curved bracket at the beginning of the line and a closing curved bracket at the end of the line.
Unfortunately, from time to ti... | The first and the single line contains the set of letters. The length of the line doesn't exceed 1000. It is guaranteed that the line starts from an opening curved bracket and ends with a closing curved bracket. Between them, small English letters are listed, separated by a comma. Each comma is followed by a space. | Print a single number — the number of distinct letters in Anton's set. | [
"{a, b, c}\n",
"{b, a, b, a}\n",
"{}\n"
] | [
"3\n",
"2\n",
"0\n"
] | none | 500 | [
{
"input": "{a, b, c}",
"output": "3"
},
{
"input": "{b, a, b, a}",
"output": "2"
},
{
"input": "{}",
"output": "0"
},
{
"input": "{a, a, c, b, b, b, c, c, c, c}",
"output": "3"
},
{
"input": "{a, c, b, b}",
"output": "3"
},
{
"input": "{a, b}",
"o... | 1,684,260,178 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 2 | 30 | 0 | n=input()
lst=[]
for i in range(1,len(n),3):
if i!=" ":
lst.append(n[i])
lst=set(lst)
print(len(lst))
| Title: Anton and Letters
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Recently, Anton has found a set. The set consists of small English letters. Anton carefully wrote out all the letters from the set in one line, separated by a comma. He also added an opening curved bracket at the begi... | ```python
n=input()
lst=[]
for i in range(1,len(n),3):
if i!=" ":
lst.append(n[i])
lst=set(lst)
print(len(lst))
``` | 0 | |
455 | A | Boredom | PROGRAMMING | 1,500 | [
"dp"
] | null | null | Alex doesn't like boredom. That's why whenever he gets bored, he comes up with games. One long winter evening he came up with a game and decided to play it.
Given a sequence *a* consisting of *n* integers. The player can make several steps. In a single step he can choose an element of the sequence (let's denote it *a*... | The first line contains integer *n* (1<=≤<=*n*<=≤<=105) that shows how many numbers are in Alex's sequence.
The second line contains *n* integers *a*1, *a*2, ..., *a**n* (1<=≤<=*a**i*<=≤<=105). | Print a single integer — the maximum number of points that Alex can earn. | [
"2\n1 2\n",
"3\n1 2 3\n",
"9\n1 2 1 3 2 2 2 2 3\n"
] | [
"2\n",
"4\n",
"10\n"
] | Consider the third test example. At first step we need to choose any element equal to 2. After that step our sequence looks like this [2, 2, 2, 2]. Then we do 4 steps, on each step we choose any element equals to 2. In total we earn 10 points. | 500 | [
{
"input": "2\n1 2",
"output": "2"
},
{
"input": "3\n1 2 3",
"output": "4"
},
{
"input": "9\n1 2 1 3 2 2 2 2 3",
"output": "10"
},
{
"input": "5\n3 3 4 5 4",
"output": "11"
},
{
"input": "5\n5 3 5 3 4",
"output": "16"
},
{
"input": "5\n4 2 3 2 5",
... | 1,700,123,888 | 2,147,483,647 | Python 3 | TIME_LIMIT_EXCEEDED | TESTS | 10 | 1,000 | 13,721,600 | n=int(input())
nums=list(map(int,input().split()))
dp=[0]*(max(nums)+1)
dp[1]=nums.count(1)
for i in range(1,max(nums)+1):
dp[i]=max(dp[i-2]+i*nums.count(i),dp[i-1])
print(dp[max(nums)]) | Title: Boredom
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Alex doesn't like boredom. That's why whenever he gets bored, he comes up with games. One long winter evening he came up with a game and decided to play it.
Given a sequence *a* consisting of *n* integers. The player can make ... | ```python
n=int(input())
nums=list(map(int,input().split()))
dp=[0]*(max(nums)+1)
dp[1]=nums.count(1)
for i in range(1,max(nums)+1):
dp[i]=max(dp[i-2]+i*nums.count(i),dp[i-1])
print(dp[max(nums)])
``` | 0 | |
120 | F | Spiders | PROGRAMMING | 1,400 | [
"dp",
"greedy",
"trees"
] | null | null | One day mum asked Petya to sort his toys and get rid of some of them. Petya found a whole box of toy spiders. They were quite dear to him and the boy didn't want to throw them away. Petya conjured a cunning plan: he will glue all the spiders together and attach them to the ceiling. Besides, Petya knows that the lower t... | The first input file line contains one integer *n* (1<=≤<=*n*<=≤<=100) — the number of spiders. Next *n* lines contain the descriptions of each spider: integer *n**i* (2<=≤<=*n**i*<=≤<=100) — the number of beads, then *n**i*<=-<=1 pairs of numbers denoting the numbers of the beads connected by threads. The beads that m... | Print a single number — the length of the required construction. | [
"1\n3 1 2 2 3\n",
"2\n3 1 2 1 3\n4 1 2 2 3 2 4\n",
"2\n5 1 2 2 3 3 4 3 5\n7 3 4 1 2 2 4 4 6 2 7 6 5\n"
] | [
"2\n",
"4\n",
"7\n"
] | none | 0 | [
{
"input": "1\n3 1 2 2 3",
"output": "2"
},
{
"input": "2\n3 1 2 1 3\n4 1 2 2 3 2 4",
"output": "4"
},
{
"input": "2\n5 1 2 2 3 3 4 3 5\n7 3 4 1 2 2 4 4 6 2 7 6 5",
"output": "7"
},
{
"input": "3\n3 1 2 2 3\n5 2 5 5 3 3 4 5 1\n9 6 5 5 9 4 8 4 7 2 1 2 6 2 4 6 3",
"output":... | 1,543,220,074 | 2,147,483,647 | PyPy 3 | OK | TESTS | 30 | 404 | 3,891,200 | import math
import sys
from bisect import bisect_right, bisect_left, insort_right
from collections import Counter, defaultdict
from heapq import heappop, heappush
from itertools import accumulate
from sys import stdout
R = lambda: map(int, input().split())
sys.stdin = open('input.txt', 'r')
sys.stdout = open... | Title: Spiders
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One day mum asked Petya to sort his toys and get rid of some of them. Petya found a whole box of toy spiders. They were quite dear to him and the boy didn't want to throw them away. Petya conjured a cunning plan: he will glue a... | ```python
import math
import sys
from bisect import bisect_right, bisect_left, insort_right
from collections import Counter, defaultdict
from heapq import heappop, heappush
from itertools import accumulate
from sys import stdout
R = lambda: map(int, input().split())
sys.stdin = open('input.txt', 'r')
sys.std... | 3 | |
43 | A | Football | PROGRAMMING | 1,000 | [
"strings"
] | A. Football | 2 | 256 | One day Vasya decided to have a look at the results of Berland 1910 Football Championship’s finals. Unfortunately he didn't find the overall score of the match; however, he got hold of a profound description of the match's process. On the whole there are *n* lines in that description each of which described one goal. E... | The first line contains an integer *n* (1<=≤<=*n*<=≤<=100) — the number of lines in the description. Then follow *n* lines — for each goal the names of the teams that scored it. The names are non-empty lines consisting of uppercase Latin letters whose lengths do not exceed 10 symbols. It is guaranteed that the match di... | Print the name of the winning team. We remind you that in football the team that scores more goals is considered the winner. | [
"1\nABC\n",
"5\nA\nABA\nABA\nA\nA\n"
] | [
"ABC\n",
"A\n"
] | none | 500 | [
{
"input": "1\nABC",
"output": "ABC"
},
{
"input": "5\nA\nABA\nABA\nA\nA",
"output": "A"
},
{
"input": "2\nXTSJEP\nXTSJEP",
"output": "XTSJEP"
},
{
"input": "3\nXZYDJAEDZ\nXZYDJAEDZ\nXZYDJAEDZ",
"output": "XZYDJAEDZ"
},
{
"input": "3\nQCCYXL\nQCCYXL\nAXGLFQDD",
... | 1,532,534,270 | 2,147,483,647 | Python 3 | WRONG_ANSWER | TESTS | 1 | 186 | 0 | def main():
n=int(input())
d=dict()
for i in range(n):
a=input()
if(a in d):
d[a]+=1
else:
d[a]=1
val=0
for key,value in d.items():
if(val<value):
ans=key
print(ans)
if __name__=='__main__':
main() | Title: Football
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
One day Vasya decided to have a look at the results of Berland 1910 Football Championship’s finals. Unfortunately he didn't find the overall score of the match; however, he got hold of a profound description of the match's process... | ```python
def main():
n=int(input())
d=dict()
for i in range(n):
a=input()
if(a in d):
d[a]+=1
else:
d[a]=1
val=0
for key,value in d.items():
if(val<value):
ans=key
print(ans)
if __name__=='__main__':
main()
``` | 0 |
372 | A | Counting Kangaroos is Fun | PROGRAMMING | 1,600 | [
"binary search",
"greedy",
"sortings",
"two pointers"
] | null | null | There are *n* kangaroos with pockets. Each kangaroo has a size (integer number). A kangaroo can go into another kangaroo's pocket if and only if the size of kangaroo who hold the kangaroo is at least twice as large as the size of kangaroo who is held.
Each kangaroo can hold at most one kangaroo, and the kangaroo who i... | The first line contains a single integer — *n* (1<=≤<=*n*<=≤<=5·105). Each of the next *n* lines contains an integer *s**i* — the size of the *i*-th kangaroo (1<=≤<=*s**i*<=≤<=105). | Output a single integer — the optimal number of visible kangaroos. | [
"8\n2\n5\n7\n6\n9\n8\n4\n2\n",
"8\n9\n1\n6\n2\n6\n5\n8\n3\n"
] | [
"5\n",
"5\n"
] | none | 500 | [
{
"input": "8\n2\n5\n7\n6\n9\n8\n4\n2",
"output": "5"
},
{
"input": "8\n9\n1\n6\n2\n6\n5\n8\n3",
"output": "5"
},
{
"input": "12\n3\n99\n24\n46\n75\n63\n57\n55\n10\n62\n34\n52",
"output": "7"
},
{
"input": "12\n55\n75\n1\n98\n63\n64\n9\n39\n82\n18\n47\n9",
"output": "6"
... | 1,678,368,224 | 2,147,483,647 | Python 3 | RUNTIME_ERROR | TESTS | 0 | 46 | 3,993,600 | import math
import sys
import collections
import heapq
import itertools
def main():
N = 100001
a = [0] * (N * 5)
vis = [False] * (N * 5)
n = int(input())
a = [int(x) for x in input().split()]
vis = [False] * len(vis)
a.sort()
k, m = n - 1, 0
for i in range(k - 1, -1, -1):
... | Title: Counting Kangaroos is Fun
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There are *n* kangaroos with pockets. Each kangaroo has a size (integer number). A kangaroo can go into another kangaroo's pocket if and only if the size of kangaroo who hold the kangaroo is at least twice as ... | ```python
import math
import sys
import collections
import heapq
import itertools
def main():
N = 100001
a = [0] * (N * 5)
vis = [False] * (N * 5)
n = int(input())
a = [int(x) for x in input().split()]
vis = [False] * len(vis)
a.sort()
k, m = n - 1, 0
for i in range(k - 1, -1, -1... | -1 |
Subsets and Splits
Successful Python Submissions
Retrieves all records from the train dataset where the verdict is 'OK', providing basic filtering but limited analytical value.
SQL Console for MatrixStudio/Codeforces-Python-Submissions
Retrieves records of users with a rating of 1600 or higher and a verdict of 'OK', providing basic filtering but limited analytical value.
SQL Console for MatrixStudio/Codeforces-Python-Submissions
Counts the number of entries with a rating above 2000 and a verdict of 'OK', providing basic filtering but limited analytical value.
SQL Console for MatrixStudio/Codeforces-Python-Submissions
Counts the number of entries with a 'OK' verdict, providing a basic overview of a specific category within the dataset.