repo_name
stringlengths
5
100
path
stringlengths
4
231
language
stringclasses
1 value
license
stringclasses
15 values
size
int64
6
947k
score
float64
0
0.34
prefix
stringlengths
0
8.16k
middle
stringlengths
3
512
suffix
stringlengths
0
8.17k
AunShiLord/sympy
sympy/logic/boolalg.py
Python
bsd-3-clause
49,069
0.000346
""" Boolean algebra module for SymPy """ from __future__ import print_function, division from collections import defaultdict from itertools import combinations, product from sympy.core.basic import Basic from sympy.core.cache import cacheit from sympy.core.core import C from sympy.core.numbers import Number from sympy.core.decorators import deprecated from sympy.core.operations import LatticeOp from sympy.core.function import Application from sympy.core.compatibility import ordered, xrange, with_metaclass from sympy.core.sympify import converter, _sympify, sympify from sympy.core.singleton import Singleton, S class Boolean(Basic): """A boolean object is an object for which logic operations make sense.""" __slots__ = [] def __and__(self, other): """Overloading for & operator""" return And(self, other) __rand__ = __and__ def __or__(self, other): """Overloading for |""" return Or(self, other) __ror__ = __or__ def __invert__(self): """Overloading for ~""" return Not(self) def __rshift__(self, other): """Overloading for >>""" return Implies(self, other) def __lshift__(self, other): """Overloading for <<""" return Implies(other, self) __rrshift__ = __lshift__ __rlshift__ = __rshift__ def __xor__(self, other): return Xor(self, other) __rxor__ = __xor__ def equals(self, other): """ Returns if the given formulas have the same truth table. For two formulas to be equal they must have the same literals. Examples ======== >>> from sympy.abc import A, B, C >>> from sympy.logic.boolalg import And, Or, Not >>> (A >> B).equals(~B >> ~A) True >>> Not(And(A, B, C)).equals(And(Not(A), Not(B), Not(C))) False >>> Not(And(A, Not(A))).equals(Or(B, Not(B))) False """ from sympy.logic.inference import satisfiable from sympy.core.relational import Relational if self.has(Relational) or other.has(Relational): raise NotImplementedError('handling of relationals') return self.atoms() == other.atoms() and \ not satisfiable(Not(Equivalent(self, other))) # Developer note: There is liable to be some confusion as to when True should # be used and when S.true should be used in various contexts throughout SymPy. # An important thing to remember is that sympify(True) returns S.true. This # means that for the most part, you can just use True and it will # automatically be converted to S.true when necessary, similar to how you can # generally use 1 instead of S.One. # The rule of thumb is: # "If the boolean in question can be replaced by an arbitrary symbolic # Boolean, like Or(x, y) or x > 1, use S.true. Otherwise, use True" # In other words, use S.true only on those contexts where the boolean is being # used as a symbolic representation of truth. For example, if the object ends # up in the .args of any expression, then it must necessarily be S.true # instead of True, as elements of .args must be Basic. On the other hand, == # is not a symbolic operation in SymPy, since it always returns True or False, # and does so in terms of structural equality rather than mathematical, so it # should return True. The assumptions system should use True and False. Aside # from not satisfying the above rule of thumb, the assumptions system uses a # three-valued logic (True, False, None), whereas S.true and S.false represent # a two-valued logic. When it doubt, use True. # 2. "S.true == True" is True. # While "S.true is True" is False, "S.true == True" is True, so if there is # any doubt over whether a function or expression will return S.true or True, # just use "==" instead of "is" to do the comparison, and it will work in # either case. Finally, for boolean flags, it's better to just use "if x" # instead of "if x is True". To quote PEP 8: # Don't compare boo
lean values to True or False using ==. # Yes: if greeting: # No: if greeting == True: # Worse: if greeting is True: class BooleanAtom(Boolean): """ Base class of BooleanTrue and BooleanFalse. """ @property
def canonical(self): return self class BooleanTrue(with_metaclass(Singleton, BooleanAtom)): """ SymPy version of True, a singleton that can be accessed via S.true. This is the SymPy version of True, for use in the logic module. The primary advantage of using true instead of True is that shorthand boolean operations like ~ and >> will work as expected on this class, whereas with True they act bitwise on 1. Functions in the logic module will return this class when they evaluate to true. Examples ======== >>> from sympy import sympify, true, Or >>> sympify(True) True >>> ~true False >>> ~True -2 >>> Or(True, False) True See Also ======== sympy.logic.boolalg.BooleanFalse """ def __nonzero__(self): return True __bool__ = __nonzero__ def __hash__(self): return hash(True) def as_set(self): """ Rewrite logic operators and relationals in terms of real sets. Examples ======== >>> from sympy import true >>> true.as_set() UniversalSet() """ return S.UniversalSet class BooleanFalse(with_metaclass(Singleton, BooleanAtom)): """ SymPy version of False, a singleton that can be accessed via S.false. This is the SymPy version of False, for use in the logic module. The primary advantage of using false instead of False is that shorthand boolean operations like ~ and >> will work as expected on this class, whereas with False they act bitwise on 0. Functions in the logic module will return this class when they evaluate to false. Examples ======== >>> from sympy import sympify, false, Or, true >>> sympify(False) False >>> false >> false True >>> False >> False 0 >>> Or(True, False) True See Also ======== sympy.logic.boolalg.BooleanTrue """ def __nonzero__(self): return False __bool__ = __nonzero__ def __hash__(self): return hash(False) def as_set(self): """ Rewrite logic operators and relationals in terms of real sets. Examples ======== >>> from sympy import false >>> false.as_set() EmptySet() """ from sympy.sets.sets import EmptySet return EmptySet() true = BooleanTrue() false = BooleanFalse() # We want S.true and S.false to work, rather than S.BooleanTrue and # S.BooleanFalse, but making the class and instance names the same causes some # major issues (like the inability to import the class directly from this # file). S.true = true S.false = false converter[bool] = lambda x: S.true if x else S.false class BooleanFunction(Application, Boolean): """Boolean function is a function that lives in a boolean space It is used as base class for And, Or, Not, etc. """ is_Boolean = True def __call__(self, *args): return self.func(*[arg(*args) for arg in self.args]) def _eval_simplify(self, ratio, measure): return simplify_logic(self) def to_nnf(self, simplify=True): return self._to_nnf(*self.args, simplify=simplify) @classmethod def _to_nnf(cls, *args, **kwargs): simplify = kwargs.get('simplify', True) argset = set([]) for arg in args: if not is_literal(arg): arg = arg.to_nnf(simplify) if simplify: if isinstance(arg, cls): arg = arg.args else: arg = (arg,) for a in arg: if Not(a) in argset: return cls.zero argset.add(a) else: argset.add(arg) return cls(*argset) class And(LatticeOp, BooleanFunction): """ Logical AND function.
eunchong/build
scripts/slave/recipe_modules/auto_bisect/config_validation.py
Python
bsd-3-clause
3,647
0.007952
# Copyright 2016 The Chromium Au
thors. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. import re # Note: this module is tested by a unit test config_validation_test.py, # rather than recipe simulation tests. _BISECT_CONFIG_SCHEMA = { 'command': {'type': 'string', 'required': True}, 'good_revision': {'type': 'revision', 'required': True}, 'bad_revision': {'type': 'revis
ion', 'required': True}, 'bisect_bot': {'type': 'string'}, 'metric': {'type': 'string'}, 'bug_id': {'type': 'integer'}, 'repeat_count': {'type': 'integer'}, 'max_time_minutes': {'type': 'integer'}, 'bisect_mode': {'type': 'string', 'choices': ['mean', 'return_code', 'std_dev']}, 'gs_bucket': {'type': 'string'}, 'builder_host': {'type': 'string'}, 'builder_port': {'type': 'integer'}, 'test_type': {'type': 'string'}, 'improvement_direction': {'type': 'integer'}, 'recipe_tester_name': {'type': 'string'}, 'try_job_id': {'type': 'integer'}, } class ValidationFail(Exception): """An exception class that represents a failure to validate.""" def validate_bisect_config(config, schema=None): """Checks the correctness of the given bisect job config.""" schema = _BISECT_CONFIG_SCHEMA if schema is None else schema for key in set(schema): validate_key(config, schema, key) if 'good_revision' in schema and 'bad_revision' in schema: _validate_revisions(config.get('good_revision'), config.get('bad_revision')) if 'bisect_mode' in schema and 'metric' in schema: _validate_metric(config.get('bisect_mode'), config.get('metric')) def validate_key(config, schema, key): # pragma: no cover """Checks the correctness of the given field in a config.""" if schema[key].get('required') and config.get(key) is None: raise ValidationFail('Required key "%s" missing.' % key) if config.get(key) is None: return # Optional field. value = config[key] field_type = schema[key].get('type') if field_type == 'string': _validate_string(value, key) elif field_type == 'integer': _validate_integer(value, key) elif field_type == 'revision': _validate_revision(value, key) elif field_type == 'boolean': _validate_boolean(value, key) if 'choices' in schema[key] and value not in schema[key]['choices']: _fail(value, key) def _fail(value, key): raise ValidationFail('Invalid value %r for "%s".' % (value, key)) def _validate_string(value, key): # pragma: no cover if not isinstance(value, basestring): _fail(value, key) def _validate_revision(value, key): # pragma: no cover s = str(value) if not (s.isdigit() or re.match('^[0-9A-Fa-f]{40}$', s)): _fail(value, key) def _validate_integer(value, key): # pragma: no cover try: int(value) except ValueError: _fail(value, key) def _validate_boolean(value, key): # pragma: no cover if value not in (True, False): _fail(value, key) def _validate_revisions(good_revision, bad_revision): # pragma: no cover try: earlier = int(good_revision) later = int(bad_revision) except ValueError: return # The revisions could be sha1 hashes. if earlier >= later: raise ValidationFail('Order of good_revision (%d) and bad_revision(%d) ' 'is reversed.' % (earlier, later)) def _validate_metric(bisect_mode, metric): # pragma: no cover if bisect_mode not in ('mean', 'std_dev'): return if not (isinstance(metric, basestring) and metric.count('/') == 1): raise ValidationFail('Invalid value for "metric": %s' % metric)
LyzardKing/ubuntu-make
umake/frameworks/dart.py
Python
gpl-3.0
5,057
0.002768
# -*- coding: utf-8 -*- # Copyright (C) 2014 Canonical # # Authors: # Didier Roche # # This program is free software; you can redistribute it and/or modify it under # the terms of the GNU General Public License as published by the Free Software # Foundation; version 3. # # This program is distributed in the hope that it will be useful, but WITHOUT #
ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS # FOR A PARTICULAR PURPOSE. See the GNU General Public License for more # detail
s. # # You should have received a copy of the GNU General Public License along with # this program; if not, write to the Free Software Foundation, Inc., # 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA """Dartlang module""" from contextlib import suppress from gettext import gettext as _ import logging import os import re import umake.frameworks.baseinstaller from umake.interactions import DisplayMessage from umake.tools import add_env_to_user, MainLoop, get_current_arch, ChecksumType from umake.ui import UI logger = logging.getLogger(__name__) _supported_archs = ['i386', 'amd64'] class DartCategory(umake.frameworks.BaseCategory): def __init__(self): super().__init__(name="Dart", description=_("Dartlang Development Environment"), logo_path=None) class DartLangEditorRemoval(umake.frameworks.baseinstaller.BaseInstaller): def __init__(self, **kwargs): super().__init__(name="Dart Editor", description=_("Dart SDK with editor (not supported upstream anymore)"), download_page=None, only_on_archs=_supported_archs, only_for_removal=True, **kwargs) class DartLang(umake.frameworks.baseinstaller.BaseInstaller): def __init__(self, **kwargs): super().__init__(name="Dart SDK", description=_("Dart SDK (default)"), is_category_default=True, only_on_archs=_supported_archs, download_page="https://raw.githubusercontent.com/dart-lang/sdk/master/CHANGELOG.md", dir_to_decompress_in_tarball="dart-sdk", checksum_type=ChecksumType.sha256, required_files_path=[os.path.join("bin", "dart")], **kwargs) arch_trans = { "amd64": "x64", "i386": "ia32" # TODO: add arm } def parse_download_link(self, line, in_download): """Parse Dart SDK download links""" in_download = False p = re.search(r"^##\s(\d\S+)", line) if p is not None: in_download = True else: in_download = False if in_download: with suppress(AttributeError): self.new_download_url = "https://storage.googleapis.com/dart-archive/channels/stable/" +\ "release/{}/sdk/".format(p.group(1)) +\ "dartsdk-linux-{}-release.zip".format(self.arch_trans[get_current_arch()]) +\ ".sha256sum" return ((None, None), in_download) @MainLoop.in_mainloop_thread def get_sha_and_start_download(self, download_result): res = download_result[self.new_download_url] checksum = res.buffer.getvalue().decode('utf-8').split()[0] # you get and store self.download_url url = re.sub('.sha256sum', '', self.new_download_url) self.check_data_and_start_download(url, checksum) def post_install(self): """Add go necessary env variables""" add_env_to_user(self.name, {"PATH": {"value": os.path.join(self.install_path, "bin")}}) UI.delayed_display(DisplayMessage(self.RELOGIN_REQUIRE_MSG.format(self.name))) class FlutterLang(umake.frameworks.baseinstaller.BaseInstaller): def __init__(self, **kwargs): super().__init__(name="Flutter SDK", description=_("Flutter SDK"), only_on_archs=_supported_archs, download_page="https://api.flutter.dev/flutter/footer.js", dir_to_decompress_in_tarball="flutter", required_files_path=[os.path.join("bin", "flutter")], **kwargs) def parse_download_link(self, line, in_download): """Parse Flutter SDK download links""" url = None in_download = False if 'Flutter ' in line: p = re.search(r"Flutter\s(\S+)", line) if p is not None: in_download = True if in_download: with suppress(AttributeError): url = "https://storage.googleapis.com/flutter_infra/releases/stable/linux/" +\ "flutter_linux_v{}-stable.tar.xz".format(p.group(1)) return ((url, None), in_download) def post_install(self): """Add flutter necessary env variables""" add_env_to_user(self.name, {"PATH": {"value": os.path.join(self.install_path, "bin")}}) UI.delayed_display(DisplayMessage(self.RELOGIN_REQUIRE_MSG.format(self.name)))
niksoc/srmconnect
app/migrations/0018_auto_20160822_1047.py
Python
gpl-3.0
4,536
0
# -*- coding: utf-8 -*- # Generated by Django 1.10 on 2016-08-22 10:47 from __future__ import unicode_literals from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('app', '0017_auto_20160821_1833'), ] operations = [ migrations.AlterField( model_name='answer', name='created', field=models.DateTimeField(auto_now_add=True), ), migrations.AlterField( model_name='answer', name='modified', field=models.DateTimeField(blank=True), ), migrations.AlterField( model_name='available', name='created', field=models.DateTimeField(auto_now_add=True), ), migrations.AlterField( model_name='available', name='modified', field=models.DateTimeField(blank=True), ), migrations.AlterField( model_name='comment_answer', name='created', field=models.DateTimeField(auto_now_add=True), ), migrations.AlterField( model_name='comment_answer', name='modified', field=models.DateTimeField(blank=True), ), migrations.AlterField( model_name='comment_availab
le', name='created', field=models.DateTimeField(auto_now_add=True), ), migrations.AlterField( model_name='comment_available', name='modified', field=models.D
ateTimeField(blank=True), ), migrations.AlterField( model_name='comment_event', name='created', field=models.DateTimeField(auto_now_add=True), ), migrations.AlterField( model_name='comment_event', name='modified', field=models.DateTimeField(blank=True), ), migrations.AlterField( model_name='comment_question', name='created', field=models.DateTimeField(auto_now_add=True), ), migrations.AlterField( model_name='comment_question', name='modified', field=models.DateTimeField(blank=True), ), migrations.AlterField( model_name='comment_story', name='created', field=models.DateTimeField(auto_now_add=True), ), migrations.AlterField( model_name='comment_story', name='modified', field=models.DateTimeField(blank=True), ), migrations.AlterField( model_name='comment_wanted', name='created', field=models.DateTimeField(auto_now_add=True), ), migrations.AlterField( model_name='comment_wanted', name='modified', field=models.DateTimeField(blank=True), ), migrations.AlterField( model_name='event', name='created', field=models.DateTimeField(auto_now_add=True), ), migrations.AlterField( model_name='event', name='modified', field=models.DateTimeField(blank=True), ), migrations.AlterField( model_name='project', name='created', field=models.DateTimeField(auto_now_add=True), ), migrations.AlterField( model_name='project', name='modified', field=models.DateTimeField(blank=True), ), migrations.AlterField( model_name='question', name='created', field=models.DateTimeField(auto_now_add=True), ), migrations.AlterField( model_name='question', name='modified', field=models.DateTimeField(blank=True), ), migrations.AlterField( model_name='story', name='created', field=models.DateTimeField(auto_now_add=True), ), migrations.AlterField( model_name='story', name='modified', field=models.DateTimeField(blank=True), ), migrations.AlterField( model_name='wanted', name='created', field=models.DateTimeField(auto_now_add=True), ), migrations.AlterField( model_name='wanted', name='modified', field=models.DateTimeField(blank=True), ), ]
ProfessorX/Config
.PyCharm30/system/python_stubs/-1247971765/PyKDE4/kio/KUrlComboBox.py
Python
gpl-2.0
1,586
0.010719
# encoding: utf-8 # module PyKDE4.kio # from /usr/lib/python3/dist-packages/PyKDE4/kio.cpython-34m-x86_64-linux-gnu.so # by generator 1.135 # no doc # imports import PyKDE4.kdeui as __PyKDE4_kdeui import PyQt4.QtCore as __PyQt4_QtCore import PyQt4.QtGui as __PyQt4_QtGui class KUrl
ComboBox(__PyKDE4_kdeui.KComboBox): # no doc def addDefaultUrl(self, *args, **kwargs): # real signatu
re unknown pass def maxItems(self, *args, **kwargs): # real signature unknown pass def mouseMoveEvent(self, *args, **kwargs): # real signature unknown pass def mousePressEvent(self, *args, **kwargs): # real signature unknown pass def removeUrl(self, *args, **kwargs): # real signature unknown pass def setCompletionObject(self, *args, **kwargs): # real signature unknown pass def setDefaults(self, *args, **kwargs): # real signature unknown pass def setMaxItems(self, *args, **kwargs): # real signature unknown pass def setUrl(self, *args, **kwargs): # real signature unknown pass def setUrls(self, *args, **kwargs): # real signature unknown pass def urlActivated(self, *args, **kwargs): # real signature unknown pass def urls(self, *args, **kwargs): # real signature unknown pass def __init__(self, *args, **kwargs): # real signature unknown pass Both = 0 Directories = 1 Files = -1 Mode = None # (!) real value is '' OverLoadResolving = None # (!) real value is '' RemoveBottom = 1 RemoveTop = 0
jvkersch/hsmmlearn
hsmmlearn/tests/test_hsmm_wrappers.py
Python
gpl-3.0
1,757
0
import unittest import numpy as np from ..emissions import GaussianEmissions, MultinomialEmissions from ..hsmm import GaussianHSMM, MultinomialHSMM class TestHSMMWrappers(unittest.TestCase): def setUp(self): # Exact values don't matter self.tmat = np.eye(3) self.durations = np.eye(3) def test_gaussian_hsmm(self): means = np.array([1.0, 2.0, 3.0]) scales = np.array([0.5, 0.4, 0.3]) hsmm = GaussianHSMM(means, scales, self.durations, self.tmat) self.assertIsInstance(hsmm.emissions, GaussianEmissions) np.testing.assert_array_equal(hsmm.emissions.means, means) np.testing.assert_array_equal(hsmm.emissions.scales, scales) def test_gaussian_hsmm_means_scales(self): me
ans = np.array([1.0, 2.0, 3.0]) scales = np.array([0.5, 0.4, 0.3]) hsmm = GaussianHSMM(means, scales, self.durations, self.tmat) # Test property getters np.testing.assert_array_equal(hsmm.means, means) np.testing.assert_array_equal(hsmm.scales, scales) # Now updat
e properties and check that the value changed on the # emissions. new_means = np.array([5.0, 5.0, 5.0]) new_scales = np.array([1.0, 1.0, 1.0]) hsmm.means = new_means hsmm.scales = new_scales emissions = hsmm.emissions np.testing.assert_array_equal(emissions.means, new_means) np.testing.assert_array_equal(emissions.scales, new_scales) def test_multinomial_hsmm(self): ps = np.ones((3, 5)) hsmm = MultinomialHSMM(ps, self.durations, self.tmat) self.assertIsInstance(hsmm.emissions, MultinomialEmissions) np.testing.assert_array_equal(hsmm.emissions._probabilities, ps)
LLNL/spack
var/spack/repos/builtin/packages/r-prodlim/package.py
Python
lgpl-2.1
1,415
0.003534
# Copyright 2013-2021 Lawrence Livermore National Security, LLC and other # Spack Project Developers. See the top-level COPYRIGHT file for details. # # SPDX-License-Identifier: (Apache-2.0 OR MIT) from spack import * class RProdlim(RPackage): """Product-Limit Estimation for Censored Event History Analysis Product-Limit Estimation for Censored Event History Analysis. Fast and user friendly implementation of nonparametric estimators for censored event history (survival) analysis. Kaplan-Meier and Aalen-Johansen method.""" homepage = "https://cloud.r-project.org/package=prodlim" url = "https://cloud.r-project.org/src/contrib/prodlim_1.5.9.tar.gz" list_url = "https://cloud.r-project.org/src/contrib/Archive/prodlim" version('2019.11.13', sha256='6809924f503a14681de84730489cdaf9240d7951c64f5b98ca37dc1ce7809b0f') version('2018.04.18', sha
256='4b22b54fdf712439309be0ff74f63cde9080464667b00e19823372ac0fc254ab') version('1.6.1', sha256='3f2665257118a3db8682731a500b1ae4d669af344672dc2037f987bee3cca154') versio
n('1.5.9', sha256='853644886c57102e7f6dd26b6e03e54bf3f9e126f54c76f8d63a3324811f7b42') depends_on('[email protected]:', type=('build', 'run')) depends_on('[email protected]:', type=('build', 'run')) depends_on('r-survival', type=('build', 'run')) depends_on('r-kernsmooth', type=('build', 'run')) depends_on('r-lava', type=('build', 'run'))
YuxuanLing/trunk
trunk/code/study/python/Fluent-Python-example-code/09-pythonic-obj/vector2d_v3_slots.py
Python
gpl-3.0
3,560
0.000281
""" A 2-dimensional vector class >>> v1 = Vector2d(3, 4) >>> print(v1.x, v1.y) 3.0 4.0 >>> x, y = v1 >>> x, y (3.0, 4.0) >>> v1 Vector2d(3.0, 4.0) >>> v1_clone = eval(repr(v1)) >>> v1 == v1_clone True >>> print(v1) (3.0, 4.0) >>> octets = bytes(v1) >>> octets b'd\\x00\\x00\\x00\\x00\\x00\\x00\\x08@\\x00\\x00\\x00\\x00\\x00\\x00\\x10@' >>> abs(v1) 5.0 >>> bool(v1), bool(Vector2d(0, 0)) (True, False) Test of ``.frombytes()`` class method: >>> v1_clone = Vector2d.frombytes(bytes(v1)) >>> v1_clone Vector2d(3.0, 4.0) >>> v1 == v1_clone True Tests of ``format()`` with Cartesian coordinates: >>> format(v1) '(3.0, 4.0)' >>> format(v1, '.2f') '(3.00, 4.00)' >>> format(v1, '.3e') '(3.000e+00, 4.000e+00)' Tests of the ``angle`` method:: >>> Vector2d(0, 0).angle() 0.0 >>> Vector2d(1, 0).angle() 0.0 >>> epsilon = 10**-8 >>> abs(Vector2d(0, 1).angle() - math.pi/2) < epsilon True >>> abs(Vector2d(1, 1).angle() - math.pi/4) < epsilon True Tests of ``format()`` with polar coordinates: >>> format(Vector2d(1, 1), 'p') # doctest:+ELLIPSIS '<1.414213..., 0.785398...>' >>> format(Vector2d(1, 1), '.3ep') '<1.414e+00, 7.854e-01>' >>> format(Vector2d(1, 1), '0.5fp') '<1.41421, 0.78540>' Tests of `x` and `y` read-only properties: >>> v1.x, v1.y (3.0, 4.0) >>> v1.x = 123 Traceback (most recent call last): ... AttributeError: can't set attribute Tests of hashing: >>> v1 = Vector2d(3, 4) >>> v2 = Vector2d(3.1, 4.2) >>> hash(v1), hash(v2) (7, 384307168202284039) >>> len(set([v1, v2])) 2 # END VECTOR2D_V3_DEMO """ from array import array import math # BEGIN VECTOR2D_V3_SLOTS class Vector2d: __slots__ = ('__x', '__y') typecode = 'd' # methods follow (omitted in book listing) # END VECTOR2D_V3_SLOTS def __init__(self, x, y): self.__x = float(x) self.__y = float(y) @property def x(self): return self.__x @property def y(self): return self.__y def __iter__(self): return (i for i in (self.x, self.y)) def __repr__(self): class_na
me = type(self).__name__ return '{}({!r}, {!r})'.format(class_name, *self) def __str__(self): return str(tuple(self)) def __bytes__(self): return (bytes([ord(self.typecode)]) + bytes(array(self.typecode, self))) def __eq__(self, other): return tuple(self) == tuple(other) def __hash__(self): return hash(self.x)
^ hash(self.y) def __abs__(self): return math.hypot(self.x, self.y) def __bool__(self): return bool(abs(self)) def angle(self): return math.atan2(self.y, self.x) def __format__(self, fmt_spec=''): if fmt_spec.endswith('p'): fmt_spec = fmt_spec[:-1] coords = (abs(self), self.angle()) outer_fmt = '<{}, {}>' else: coords = self outer_fmt = '({}, {})' components = (format(c, fmt_spec) for c in coords) return outer_fmt.format(*components) @classmethod def frombytes(cls, octets): typecode = chr(octets[0]) memv = memoryview(octets[1:]).cast(typecode) return cls(*memv)
plugaai/pytrthree
tools/request_sender.py
Python
mit
2,685
0.003724
#!/usr/bin/env python import argparse import datetime import pandas as pd import yaml from pytrthree import TRTH from pytrthree.utils import retry def make_request(daterange, criteria): request = api.factory.LargeRequestSpec(**template) short_dates = sorted([x.replace('-', '') for x in daterange.values()]) search_result = api.search_rics(daterange, criteria['ric'], refData=False) ric_list = [{'code': i['code']} for i in search_result] request['friendlyName'] = '{}-{}_{}'.format(name, *short_dates) request['instrumentList']['instrument'] = ric_list request['dateRa
nge'] = daterange if 'fields' in criteria: request['messageTypeList']['messageType'][0]['fieldList']['string'] = criteria['fields'] return request def parse_daterange(s): return dict(start=str(s.iloc[0].date()), end=str(s.iloc[-1].date())) if __name__ == '__main__': parser = argparse.ArgumentParser(description='Tool to send a series of requests to TRTH.')
parser.add_argument('--config', action='store', type=argparse.FileType('r'), required=True, help='TRTH API configuration (YAML file)') parser.add_argument('--template', action='store', type=argparse.FileType('r'), required=True, help='Base template for the requests (YAML file)') parser.add_argument('--criteria', action='store', type=argparse.FileType('r'), required=True, help='Criteria for searching RICs and modifying queried fields (YAML file)') parser.add_argument('--start', action='store', type=str, required=True, help='Start date (ISO-8601 datetime string)') parser.add_argument('--end', action='store', type=str, default=str(datetime.datetime.now().date()), help='End date (ISO-8601 datetime string). Default to today\'s date.') parser.add_argument('--group', action='store', type=str, default='1A', help='Pandas datetime frequency string for grouping requests. Defaults to "1A".') args = parser.parse_args() api = TRTH(config=args.config) api.options['raise_exception'] = True criteria = yaml.load(args.criteria) template = yaml.load(args.template) dates = pd.date_range(args.start, args.end).to_series() dateranges = [parse_daterange(i) for _, i in dates.groupby(pd.TimeGrouper(args.group))] for daterange in dateranges: for name, crit in criteria.items(): request = make_request(daterange, crit) rid = retry(api.submit_ftp_request, request, sleep=30, exp_base=2) api.logger.info(rid['requestID']) api.logger.info('All requests sent!')
mitsuhiko/zine
zine/docs/builder.py
Python
bsd-3-clause
2,947
0.001018
# -*- coding: utf-8 -*- """ zine.docs.builder ~~~~~~~~~~~~~~~~~~~~~~ The documentation building system. This is only used by the documentation building script. :copyright: (c) 2010 by the Zine Team, see AUTHORS for more details. :license: BSD, see LICENSE for more details. """ import re import os import cPickle as pickle from urlparse import urlparse from docutils import nodes from docutils.parsers.rst import directives from docutils.core import publish_parts from docutils.writers import html4css1 _toc_re = re.compile(r'<!-- TOC -->(.*?)<!-- /TOC -->(?s)') _toc_contents_re = re.compile(r'<ul[^>]*>(.*)</ul>(?s)') def plugin_links_directive(name, arguments, options,
content, lineno, content_offset, block_text, state, state_machine): return [nodes.comment('', 'PLUGIN_LINKS')] plugin_links_directive.arguments = (0, 0, 0) plugin_links_directive.content = 1 directives.register_directi
ve('plugin_links', plugin_links_directive) def is_relative_uri(uri): if uri.startswith('/'): return False # there is no uri parser, but the url parser works mostly return not urlparse(uri)[0] class Translator(html4css1.HTMLTranslator): pass class DocumentationWriter(html4css1.Writer): def __init__(self): html4css1.Writer.__init__(self) self.translator_class = Translator def generate_documentation(data): toc = '\n\n..\n TOC\n\n.. contents::\n\n..\n /TOC' parts = publish_parts(data + toc, writer=DocumentationWriter(), settings_overrides=dict( initial_header_level=2, field_name_limit=50 ) ) toc = None body = parts['body'] match = _toc_re.search(body) body = body[:match.start()] + body[match.end():] match = _toc_contents_re.search(match.group(1)) if match is not None: toc = match.group(1) # just add the toc if there are at least two entries. if toc.count('</li>') < 2: toc = None return { 'title': parts['title'], 'body': body, 'toc': toc } def walk(directory, callback=lambda filename: None): """Walk a directory and translate all the files in there.""" directory = os.path.normpath(directory) for dirpath, dirnames, filenames in os.walk(directory): for filename in filenames: if filename.endswith('.rst'): relname = os.path.join(dirpath, filename)[len(directory) + 1:] f = file(os.path.join(dirpath, filename)) try: d = generate_documentation(f.read().decode('utf-8')) finally: f.close() f = file(os.path.join(dirpath, filename[:-3] + 'page'), 'wb') try: pickle.dump(d, f, protocol=2) finally: f.close() callback(relname)
leylabmpi/pyTecanFluent
tests/test_Utils.py
Python
mit
1,127
0.022183
#!/usr/bin/env python # -*- coding: utf-8 -*- # import ## batteries import os import sys import pytest ## 3rd party import pandas as pd ## package from pyTecanFluent import Utils # data dir test_dir = os.path.join(os.path.dirname(__file__)) data_dir = os.path.join(test_dir, 'data') # tests def test_make_range(): x = Utils.make_range('all') assert x is None x = Utils.make_range('0') assert x == [0] x = Utils.make_range('1,2,5') assert x == [1,2,5] x = Utils.make_range('1,2,5-6') assert x == [1,2,5,6] x = Utils.make_range('1-3,5-6') assert x == [1,2,3,5,6] def test_range_zeroindex(): x = Utils.make_range('all', set_zero_index=True) assert x is None with pytest.raises(ValueError): Utils.make_range('0', set_zero
_index=True) x = Utils.make_range('1,2,5', set_zero_index=True) assert x == [0,1,4] x = Utils.make_range('1,2,5
-6', set_zero_index=True) assert x == [0,1,4,5] def test_check_gwl(): gwl_file = os.path.join(data_dir, 'multi_dispense.gwl') ret = Utils.check_gwl(gwl_file) assert ret is None
mudbungie/carrieocoyle
gallery/migrations/0006_auto_20151027_1101.py
Python
mit
404
0
# -*- coding: utf-8 -*- from __future__ import unicode_literals from django.db import models, migrations class Migration(migrations.Migration):
dependencies = [ ('gallery', '0005_piece_medium'), ] operations = [ migrations.AlterField( model_name='medium', name='medium_name',
field=models.TextField(default='Medium'), ), ]
johannfaouzi/pyts
pyts/datasets/uea.py
Python
bsd-3-clause
9,597
0
""" Utility functions for the UEA multivariate time series classification archive. """ # Author: Johann Faouzi <[email protected]> # License: BSD-3-Clause import numpy as np import os import pickle from scipy.io.arff import loadarff from sklearn.utils import Bunch from urllib.request import urlretrieve import zipfile def _correct_uea_name_download(dataset): if dataset == 'Ering': return 'ERing' else: return dataset def uea_dataset_list(): """List of available UEA datasets. Returns ------- datasets : list List of available datasets from the UEA Time Series Classification Archive. References ---------- .. [1] `List of datasets on the UEA & UCR archive <http://www.timeseriesclassification.com/dataset.php>`_ Examples -------- >>> from pyts.datasets import uea_dataset_list >>> uea_dataset_list()[:3] ['ArticularyWordRecognition', 'AtrialFibrillation', 'BasicMotions'] """ module_path = os.path.dirname(__file__) finfo = os.path.join(module_path, 'info', 'uea.pickle') dictionary = pickle.load(open(finfo, 'rb')) datasets = sorted(dictionary.keys()) return datasets def uea_dataset_info(dataset=None): """Information about the UEA datasets. Parameters ---------- dataset : str, list of str or None (default = None) The data sets for which the information will be returned. If None, the information for all the datasets is returned. Returns ------- dictionary : dict Dictionary with the information for each dataset. References ---------- .. [1] `List of datasets on the UEA & UCR archive <http://www.timeseriesclassification.com/dataset.php>`_ Examples -------- >>> from pyts.datasets import uea_dataset_info >>> uea_dataset_info('AtrialFibrillation')['n_timestamps'] 640 """ module_path = os.path.dirname(__file__) finfo = os.path.join(module_path, 'info', 'uea.pickle') dictionary = pickle.load(open(finfo, 'rb')) datasets = list(dictionary.keys()) if dataset is None: return dictionary elif isinstance(dataset, str): if dataset not in datasets: raise ValueError( "{0} is not a valid name. The list of available names " "can be obtained by calling the " "'pyts.datasets.uea_dataset_list' function." .format(dataset) ) else: return dictionary[dataset] elif isinstance(dataset, (list, tuple, np.ndarray)): dataset = np.asarray(dataset) invalid_datasets = np.setdiff1d(dataset, datasets) if invalid_datasets.size > 0: raise ValueError( "The following names are not valid: {0}. The list of " "available names can be obtained by calling the " "'pyts.datasets.uea_dataset_list' function." .format(invalid_datasets) ) else: info = {} for data in dataset: info[data] = dictionary[data] return info def fetch_uea_dataset(dataset, use_cache=True, data_home=None, return_X_y=False): # noqa 207 """Fetch dataset from UEA TSC Archive by name. Fetched data sets are saved by default in the ``pyts/datasets/cached_datasets/UEA/`` folder. To avoid downloading the same data set several times, it is highly recommended not to change the default values of ``use_cache`` and ``path``. Parameters ---------- dataset : str Name of the dataset. use_cache : bool (default = True) If True, look if the data set has already been fetched and load the fetched version if it is the case. If False, download the data set from the UCR Time Series Classification Archive. data_home : None or str (default = None) The path of the folder containing the cached data set. If None, the ``pyts.datasets.cached_datasets/UEA/`` folder is used. If the data set is not found, it is downloaded and cached in this path. return_X_y : bool (default = False) If True, returns ``(data_train, data_test, target_train, target_test)`` instead of a Bunch object. See below for more information about the `data` and `target` object. Returns ------- data : Bunch Dictionary-like object, with attributes: data_train : array of floats The time series in the training set. data_test : array of floats The time series in the test set. target_train : array of integers The classification labels in the training set. target_test : array of integers The classification labels in the test set. DESCR : str The full description of the dataset. url : str The url of the dataset. (data_train, data_test, target_train, target_test) : tuple if \ ``return_X_y`` is True Notes ----- Missing values are represented as NaN's. References ---------- .. [1] A. Bagnall et al, "The UEA multivariate time series classification archive, 2018". arXiv:1811.00075 [cs, stat], 2018. .. [2] A. Bagnall et al, "The UEA & UCR Time Series Classification Repository", www.timeseriesclassification.com. """ if dataset not in uea_dataset_list(): raise ValueError( "{0} is not a valid name. The list of available names " "can be obtained with ``pyts.datasets.uea_dataset_list()``" .format(dataset)
) if data_home is None: import pyts home = '/'.join(pyts.__file__.split('/')[:-2]) + '/' relative_path = 'pyts/datasets/cached_datasets/UEA/' path = home + relative_path else: path = data_home if not os.path.exists(path): os.makedirs(path) correct_datas
et = _correct_uea_name_download(dataset) if use_cache and os.path.exists(path + correct_dataset): bunch = _load_uea_dataset(correct_dataset, path) else: url = ("http://www.timeseriesclassification.com/Downloads/{0}.zip" .format(correct_dataset)) filename = 'temp_{}'.format(correct_dataset) _ = urlretrieve(url, path + filename) zipfile.ZipFile(path + filename).extractall(path + correct_dataset) os.remove(path + filename) bunch = _load_uea_dataset(correct_dataset, path) if return_X_y: return (bunch.data_train, bunch.data_test, bunch.target_train, bunch.target_test) return bunch def _load_uea_dataset(dataset, path): """Load a UEA data set from a local folder. Parameters ---------- dataset : str Name of the dataset. path : str The path of the folder containing the cached data set. Returns ------- data : Bunch Dictionary-like object, with attributes: data_train : array of floats The time series in the training set. data_test : array of floats The time series in the test set. target_train : array The classification labels in the training set. target_test : array The classification labels in the test set. DESCR : str The full description of the dataset. url : str The url of the dataset. Notes ----- Missing values are represented as NaN's. """ new_path = path + dataset + '/' try: description_file = [ file for file in os.listdir(new_path) if ('Description.txt' in file or dataset + '.txt' in file) ][0] except IndexError: description_file = None if description_file is not None: try: with(open(new_path + description_file, encoding='utf-8')) as f: description = f.read() except UnicodeDecodeError: with(open(new_path + description_file, encoding
frappe/frappe
frappe/patches/v10_0/refactor_social_login_keys.py
Python
mit
4,935
0.024924
import frappe from frappe.utils import cstr def execute(): # Update Social Logins in User run_patch() # Create Social Login Key(s) from Social Login Keys frappe.reload_doc("integrations", "doctype", "social_login_key", force=True) if not frappe.db.exists('DocType', 'Social Login Keys'): return social_login_keys = frappe.get_doc("Social Login Keys", "Social Login Keys") if social_login_keys.get("facebook_client_id") or social_login_keys.get("facebook_client_secret"): facebook_login_key = frappe.new_doc("Social Login Key") facebook_login_key.get_social_login_provider("Facebook", initialize=True) facebook_login_key.social_login_provider = "Facebook" facebook_login_key.client_id = social_login_keys.get("facebook_client_id") facebook_login_key.client_secret = social_login_keys.get("facebook_client_secret") if not (facebook_login_key.client_secret and facebook_login_key.client_id): facebook_login_key.enable_social_login = 0 facebook_login_key.save() if social_login_keys.get("frappe_server_url"): frappe_login_key = frappe.new_doc("Social Login Key") frappe_login_key.get_social_login_provider("Frappe", initialize=True) frappe_login_key.social_login_provider = "Frappe" frappe_login_key.base_url = social_login_keys.get("frappe_server_url") frappe_login_key.client_id = social_login_keys.get("frappe_client_id") frappe_login_key.client_secret = social_login_keys.get("frappe_client_secret") if not (frappe_login_key.client_secret and frappe_login_key.client_id and frappe_login_key.base_url): frappe_login_key.enable_social_login = 0 frappe_login_key.save() if social_login_keys.get("github_client_id") or social_login_keys.get("github_client_secret"): github_login_key = frappe.new_doc("Social Login Key") github_login_key.get_social_login_provider("GitHub", initialize=True) github_login_key.social_login_provider = "GitHub" github_login_key.client_id = social_login_keys.get("github_client_id") github_login_key.client_secret = social_login_keys.get("github_cl
ient_secret") if not (github_login_key.client_secret and github_login_key.client_id): github_login_key.enable_social_login = 0 github_login_key.save() if social_login_keys.get("google_client_id") or social_login_keys.get("google_client_secret"): google_login_key = frappe.new_doc("Social Login Key") google_login_key.get_social_login_provider("Google", initialize=True) google_login_key.social_login_provider = "Google" google_login_key.client_id = social
_login_keys.get("google_client_id") google_login_key.client_secret = social_login_keys.get("google_client_secret") if not (google_login_key.client_secret and google_login_key.client_id): google_login_key.enable_social_login = 0 google_login_key.save() frappe.delete_doc("DocType", "Social Login Keys") def run_patch(): frappe.reload_doc("core", "doctype", "user", force=True) frappe.reload_doc("core", "doctype", "user_social_login", force=True) users = frappe.get_all("User", fields=["*"], filters={"name":("not in", ["Administrator", "Guest"])}) for user in users: idx = 0 if user.frappe_userid: insert_user_social_login(user.name, user.modified_by, 'frappe', idx, userid=user.frappe_userid) idx += 1 if user.fb_userid or user.fb_username: insert_user_social_login(user.name, user.modified_by, 'facebook', idx, userid=user.fb_userid, username=user.fb_username) idx += 1 if user.github_userid or user.github_username: insert_user_social_login(user.name, user.modified_by, 'github', idx, userid=user.github_userid, username=user.github_username) idx += 1 if user.google_userid: insert_user_social_login(user.name, user.modified_by, 'google', idx, userid=user.google_userid) idx += 1 def insert_user_social_login(user, modified_by, provider, idx, userid=None, username=None): source_cols = get_standard_cols() creation_time = frappe.utils.get_datetime_str(frappe.utils.get_datetime()) values = [ frappe.generate_hash(length=10), creation_time, creation_time, user, modified_by, user, "User", "social_logins", cstr(idx), provider ] if userid: source_cols.append("userid") values.append(userid) if username: source_cols.append("username") values.append(username) query = """INSERT INTO `tabUser Social Login` (`{source_cols}`) VALUES ({values}) """.format( source_cols = "`, `".join(source_cols), values= ", ".join([frappe.db.escape(d) for d in values]) ) frappe.db.sql(query) def get_provider_field_map(): return frappe._dict({ "frappe": ["frappe_userid"], "facebook": ["fb_userid", "fb_username"], "github": ["github_userid", "github_username"], "google": ["google_userid"], }) def get_provider_fields(provider): return get_provider_field_map().get(provider) def get_standard_cols(): return ["name", "creation", "modified", "owner", "modified_by", "parent", "parenttype", "parentfield", "idx", "provider"]
CxAalto/gtfspy
gtfspy/spreading/heap.py
Python
mit
2,529
0.001977
from heapq import heappush, heappop import numpy as np from gtfspy.route_types import WALK from .event import Event class EventHeap: """ EventHeap represents a container for the event heap to run time-dependent Dijkstra for public transport routing objects. """ def __init__(self, pd_df=None): """ Parameters ---------- pd_df : Pandas.Dataframe Initial list of """ self.heap = [] keys = ['arr_time_ut', 'dep_time_ut', 'from_stop_I', 'to_stop_I', 'trip_I'] # pd_df.iterrows() is slow as it creates new Series objects! n = len(pd_df) key_to_j = {} for j, key in enumerate(pd_df.columns.values): key_to_j[key] = j pd_df_values = pd_df.values for i in range(n): vals = [] for key in keys: j = key_to_j[key] vals.append(pd_df_values[i, j]) e = Event(*vals) self.add_event(e) def add_event(self, event): """ Add an event to the heap/priority queue Parameters ---------- event : Event """ assert event.dep_time_ut <= event.arr_time_ut heappush(self.heap, event) def pop_next_event(self): return heappop(self.heap) def size(self): """ Return the size of the heap """ return len(self.heap) def add_walk_events_to_heap(self, transfer_distances, e, start_time_ut, walk_speed, uninfected_stops, max_duration_ut): """ Parameters ---------- transfer_distances: e : Event start_time_ut : int walk_speed : float uninfected_stops : list max_duration_ut : int """ n = len(transfer_distances) dists_values = transfer_distances.values to_stop_I_index = np.nonzero(transfer_distances.columns == 'to_stop_I')[0][0] d_index = np.nonzero(transfer_distances.columns == 'd')[0][0] for i in range(n): transfer_to_stop_I = dists_values[i, to_stop_I_index] if transfer_to_stop_I in uninfected_stops: d = dists_values[i, d_index] transfer_arr_time = e.arr_time_ut + int(d/float(walk_speed)) if transfer_arr_time > s
tart_time_ut+max_duration_ut: continue te = Event(transfer_arr_time, e.arr_time_ut, e.to_stop_I, transfe
r_to_stop_I, WALK) self.add_event(te)
OpenNetworkingFoundation/PIF-Open-Intermediate-Representation
pif_ir/meta_ir/validate.py
Python
apache-2.0
4,103
0.006581
""" @file @brief Validator for MetaIR Does semantic validation of the MetaIR instance """ from common import * def meta_ir_validate_parser(instance): """ @brief Semantic validation of an MetaIR instance @param instance The MetaIR instance map @returns Boolean, True if instance is valid. The instance is assumed to be a syntactically valid instance. This routine checks: The Parser: Each edge connects two declared states In so doing, the validator generates additional structures and binds them to the IR. These inc """ pass def meta_ir_validate_instance(instance): """ @brief Semantic validatio
n of an MetaIR instance @param instance The MetaIR in
stance map @returns Boolean, True if instance is valid. The instance is assumed to be a syntactically valid instance. This routine calls the object specific validators: parser tables The Parser: Each edge connects two declared states In so doing, the validator generates additional structures and binds them to the IR. These inc """ pass def meta_ir_check_object(meta_ir_instance, obj_type_name, name, type, implementation_type=None): """ @brief Check basic MetaIR characteristics for an object reference @param meta_ir_instance The top level mapping for the IR @param obj_type_name The name of the object to report on error @param name The name of the top level object @param type The expected MetaIR type for the object @param implementation_type If not None, check impl is present and has type TODO Support a set for implementation type """ meta_ir_assert(name in meta_ir_instance.keys(), "%s: %s is not in top level for type %s" % (obj_type_name, name, type)) meta_ir_assert("type" in meta_ir_instance[name].keys(), "%s: %s is not an MetaIR object" % (obj_type_name, name)) meta_ir_assert(meta_ir_instance[name]["type"] == type, "%s: %s is not the expected type. Got %s, expected %s" % (obj_type_name, name, meta_ir_instance[name]["type"], type)) if implementation_type is not None: meta_ir_assert("format" in meta_ir_instance[name].keys(), "%s: Expected format indication for %s" % (obj_type_name, name)) meta_ir_assert(meta_ir_instance[name]["format"] == implementation_type, "%s: implementation format for %s is %s, expected %s" % (obj_type_name, name, meta_ir_instance[name]["format"], implementation_type)) meta_ir_assert("implementation" in meta_ir_instance[name].keys(), "%s: Expected implemenation for %s" % (obj_type_name, name)) meta_ir_assert("implementation" in meta_ir_instance[name].keys(), "%s: Expected implemenation for %s" % (obj_type_name, name)) def meta_ir_check_header(meta_ir_instance, name): """ @brief Validate a reference to an MetaIR header @param meta_ir_instance The top level MetaIR instance map @param name The name of the header @returns Boolean, True if a valid reference """ if name not in meta_ir_instance.keys(): return False if "type" not in meta_ir_instance[name].keys(): return False if meta_ir_instance[name]["type"] != "header": return False return True def meta_ir_validate_data_ref(meta_ir_instance, name): """ @brief Validate a reference to an MetaIR field @param meta_ir_instance The top level MetaIR instance map @param name The reference being checked @returns Boolean, True if a valid reference Currently only supports header and header.fld """ parts = name.split(".") if len(parts) == 1: return meta_ir_check_header(meta_ir_instance, parts[0]) elif len(parts) == 2: return meta_ir_find_field(meta_ir_instance, parts[0], parts[1]) is not None return False
alvason/probability-insighter
code/mutation-drift-selection.py
Python
gpl-2.0
11,460
0.006457
# -*- coding: utf-8 -*- # <nbformat>3.0</nbformat> # <headingcell level=1> # Wright-Fisher model of mutation, selection and random genetic drift # <markdowncell> # A Wright-Fisher model has a fixed population size *N* and discrete non-overlapping generations. Each generation, each individual has a random number of offspring whose mean is proportional to the individual's fitness. Each generation, mutation may occur. Mutations may increase or decrease individual's fitness, which affects the chances of that individual's offspring in subsequent generations. # <markdowncell> # Here, I'm using a fitness model where some proportion of the time a mutation will have a fixed fitness effect, increasing or decreasing fitness by a fixed amount. # <headingcell level=2> # Setup # <codecell> import numpy as np import itertools # <headingcell level=2> # Make population dynamic model # <headingcell level=3> # Basic parameters # <codecell> pop_size = 100 # <codecell> seq_length = 10 # <codecell> alphabet = ['A', 'T'] # <codecell> base_haplotype = "AAAAAAAAAA" # <codecell> fitness_effect = 1.1 # fitness effect if a functional mutation occurs # <codecell> fitness_chance = 0.1 # chance that a mutation has a fitness effect # <headingcell level=3> # Population of haplotypes maps to counts and fitnesses # <markdowncell> # Store this as a lightweight Dictionary that maps a string to a count. All the sequences together will have count *N*. # <codecell> pop = {} # <codecell> pop["AAAAAAAAAA"] = 40 # <codecell> pop["AAATAAAAAA"] = 30 # <codecell> pop["AATTTAAAAA"] = 30 # <markdowncell> # *Map haplotype string to fitness float.* # <codecell> fitness = {} # <codecell> fitness["AAAAAAAAAA"] = 1.0 # <codecell> fitness["AAATAAAAAA"] = 1.05 # <codecell> fitness["AATTTAAAAA"] = 1.10 # <codecell> pop["AAATAAAAAA"] # <codecell> fitness["AAATAAAAAA"] # <headingcell level=3> # Add mutation # <codecell> mutation_rate = 0.005 # per gen per individual per site # <codecell> def get_mutation_count(): mean = mutation_rate * pop_size * seq_length return np.random.poisson(mean) # <codecell> def get_random_haplotype(): haplotypes = pop.keys() frequencies = [x/float(pop_size) for x in pop.values()] total = sum(frequencies) frequencies = [x / total for x in frequencies] return np.random.choice(haplotypes, p=frequencies) # <codecell> def get_mutant(haplotype): site = np.random.randint(seq_length) possible_mutations = list(alphabet) possible_mutations.remove(haplotype[site]) mutation = np.random.choice(possible_mutations) new_haplotype = haplotype[:site] + mutation + haplotype[site+1:] return new_haplotype # <markdowncell> # *Mutations have fitness effects* # <codecell> def get_fitness(haplotype): old_fitness = fitness[haplotype] if (np.random.random() < fitness_chance): return old_fitness * fitness_effect else: return old_fitness # <codecell> get_fitness("AAAAAAAAAA") # <markdowncell> # *If a mutation event creates a new haplotype, assign it a random fitness.* # <codecell> def mutation_event(): haplotype = get_random_haplotype() if pop[haplotype] > 1: pop[haplotype] -= 1 new_haplotype = get_mutant(haplotype) if new_haplotype in pop: pop[new_haplotype] += 1 else: pop[new_haplotype] = 1 if new_haplotype not in fitness: fitness[new_haplotype] = get_fitness(haplotype) # <codecell> mutation_event() # <codecell> pop # <codecell> fitness # <codecell> def mutation_step(): mutation_count = get_mutation_count() for i in range(mutation_count): mutation_event() # <headingcell level=3> # Genetic drift and fitness affect which haplotypes make it to the next generation # <markdowncell> # *Fitness weights the multinomial draw.* # <codecell> def get_offspring_counts(): haplotypes = pop.keys() frequencies = [pop[haplotype]/float(pop_size) for haplotype in haplotypes] fitnesses = [fitness[haplotype] for haplotype in haplotypes] weights = [x * y for x,y in zip(frequencies, fitnesses)] total = sum(weights) weig
hts = [x / total for x in weights] return list(np.random.multinomial(pop_size, weights)) # <codecell> get_offspring_counts() # <codecell> def offspring_step(): counts = get_offspring_counts() for (haplotype, count) in zip(pop.keys(), counts): if (count > 0): pop[haplotype] = count else: del pop[haplotype] # <h
eadingcell level=3> # Combine and iterate # <codecell> def time_step(): mutation_step() offspring_step() # <codecell> generations = 5 # <codecell> def simulate(): for i in range(generations): time_step() # <headingcell level=3> # Record # <markdowncell> # We want to keep a record of past population frequencies to understand dynamics through time. At each step in the simulation, we append to a history object. # <codecell> history = [] # <codecell> def simulate(): clone_pop = dict(pop) history.append(clone_pop) for i in range(generations): time_step() clone_pop = dict(pop) history.append(clone_pop) # <codecell> simulate() # <headingcell level=2> # Analyze trajectories # <headingcell level=3> # Calculate diversity # <codecell> def get_distance(seq_a, seq_b): diffs = 0 length = len(seq_a) assert len(seq_a) == len(seq_b) for chr_a, chr_b in zip(seq_a, seq_b): if chr_a != chr_b: diffs += 1 return diffs / float(length) # <codecell> def get_diversity(population): haplotypes = population.keys() haplotype_count = len(haplotypes) diversity = 0 for i in range(haplotype_count): for j in range(haplotype_count): haplotype_a = haplotypes[i] haplotype_b = haplotypes[j] frequency_a = population[haplotype_a] / float(pop_size) frequency_b = population[haplotype_b] / float(pop_size) frequency_pair = frequency_a * frequency_b diversity += frequency_pair * get_distance(haplotype_a, haplotype_b) return diversity # <codecell> def get_diversity_trajectory(): trajectory = [get_diversity(generation) for generation in history] return trajectory # <headingcell level=3> # Plot diversity # <codecell> %matplotlib inline import matplotlib.pyplot as plt import matplotlib as mpl # <codecell> def diversity_plot(): mpl.rcParams['font.size']=14 trajectory = get_diversity_trajectory() plt.plot(trajectory, "#447CCD") plt.ylabel("diversity") plt.xlabel("generation") # <headingcell level=3> # Analyze and plot divergence # <codecell> def get_divergence(population): haplotypes = population.keys() divergence = 0 for haplotype in haplotypes: frequency = population[haplotype] / float(pop_size) divergence += frequency * get_distance(base_haplotype, haplotype) return divergence # <codecell> def get_divergence_trajectory(): trajectory = [get_divergence(generation) for generation in history] return trajectory # <codecell> def divergence_plot(): mpl.rcParams['font.size']=14 trajectory = get_divergence_trajectory() plt.plot(trajectory, "#447CCD") plt.ylabel("divergence") plt.xlabel("generation") # <headingcell level=3> # Plot haplotype trajectories # <codecell> def get_frequency(haplotype, generation): pop_at_generation = history[generation] if haplotype in pop_at_generation: return pop_at_generation[haplotype]/float(pop_size) else: return 0 # <codecell> def get_trajectory(haplotype): trajectory = [get_frequency(haplotype, gen) for gen in range(generations)] return trajectory # <codecell> def get_all_haplotypes(): haplotypes = set() for generation in history: for haplotype in generation: haplotypes.add(haplotype) return haplotypes # <codecell> colors = ["#781C86", "#571EA2", "#462EB9", "#3F47C9", "#3F63CF", "#447CCD", "#4C90C0", "#56A0AE", "#63AC9A", "#72B485", "#83BA70", "#96BD60", "#AABD52",
colobas/gerador-horarios
bs4/builder/_html5lib.py
Python
mit
6,730
0.027637
__all__ = [ 'HTML5TreeBuilder', ] import warnings from bs4.builder import ( PERMISSIVE, HTML, HTML_5, HTMLTreeBuilder, ) from bs4.element import NamespacedAttribute import html5lib from html5lib.constants import namespaces from bs4.element import ( Comment, Doctype, NavigableString, Tag, ) class HTML5TreeBuilder(HTMLTreeBuilder): """Use html5lib to build a tree.""" features = ['html5lib', PERMISSIVE, HTML_5, HTML] def prepare_markup(self, markup, user_specified_encoding): # Store the user-specified encoding for use later on. self.user_specified_encoding = user_specified_encoding return markup, None, None, False # These methods are defined by Beautiful Soup. def feed(self, markup): if self.soup.parse_only is not None: warnings.warn("You provided a value for parse_only, but the html5lib tree builder doesn't support parse_only. The entire document will be parsed.") parser = html5lib.HTMLParser(tree=self.create_treebuilder) doc = parser.parse(markup, encoding=self.user_specified_encoding) # Set the character encoding detected by the tokenizer. if isinstance(markup, unicode): # We need to special-case this because html5lib sets # charEncoding to UTF-8 if it gets Unicode input. doc.original_encoding = None else: doc.original_encoding = parser.tokenizer.stream.charEncoding[0] def create_treebuilder(self, namespaceHTMLElements): self.underlying_builder = TreeBuilderForHtml5lib( self.soup, namespaceHTMLElements) return self.underlying_builder def test_fragment_to_document(self, fragment): """See `TreeBuilder`.""" return u'<html><head></head><body>%s</body></html>' % fragment class TreeBuilderForHtml5lib(html5lib.treebuilders._base.TreeBuilder): def __init__(self, soup, namespaceHTMLElements): self.soup = soup super(TreeBuilderForHtml5lib, self).__init__(namespaceHTMLElements) def documentClass(self): self.soup.reset() return Element(self.soup, self.soup, None) def insertDoctype(self, token): name = token["name"] publicId = token["publicId"] systemId = token["systemId"] doctype = Doctype.for_name_and_ids(name, publicId, systemId) self.soup.object_was_parsed(doctype) def elementClass(self, name, namespace): tag = self.soup.new_tag(name, namespace) return Element(tag, self.soup, namespace) def commentClass(self, data): return TextNode(Comment(data), self.soup) def fragmentClass(self): self.soup = BeautifulSoup("") self.soup.name = "[document_fragment]" return Element(self.soup, self.soup, None) def appendChild(self, node): # XXX This code is not covered by the BS4 tests. self.soup.append(node.element) def getDocument(self): return self.soup def getFragment(self): return html5lib.treebuilders._base.TreeBuilder.getFragment(self).element class AttrList(object): def __init__(self, element): self.element = element self.attrs = dict(self.element.attrs) def __iter__(self): return list(self.attrs.items()).__iter__() def __setitem__(self, name, value): "set attr", name, value self.element[name] = value def items(self): return list(self.attrs.items()) def keys(self): return list(self.attrs.keys()) def __len__(self): return len(self.attrs) def __getitem__(self, name): return self.attrs[name] def __contains__(self, name): return name in list(self.attrs.keys()) class Element(html5lib.treebuilders._base.Node): def __init__(self, element, soup, namespace): html5lib.treebuilders._base.Node.__init__(self, element.name) self.element = element self.soup = soup self.namespace = namespace def appendChild(self, node): if (node.element.__class__ == NavigableString and self.element.contents and self.element.contents[-1].__class__ == NavigableString): # Concatenate new text onto old text node # XXX This has O(n^2) performance, for input like # "a</a>a</a>a</a>..." old_element = self.element.contents[-1] new_element = self.soup.new_string(old_element + node.element) old_element.replace_with(new_element) self.soup._most_recent_element = new_element else: self.soup.object_was_parsed(node.element, parent=self.element) def getAttributes(self): return AttrList(self.element) def setAttributes(self, attributes): if attributes is not None and len(attributes) > 0: converted_attributes = [] for name, value in list(attributes.items()): if isinstance(name, tuple): new_name = NamespacedAttribute(*name) del attributes[name] attributes[new_name] = value self.soup.builder._replace_cdata_list_attribute_values( self.name, attributes) for name, value in attributes.items(): self.element[name] = value # The attributes may contain variables that need substitution. # Call set_up_substitutions manually. # # The Tag constructor called this method when the Tag was created, # but we just set/changed the attributes, so call it again. self.soup.builder.set_up_substitutions(self.element) attributes = property(getAttributes, setAttributes) def insertText(self, data, insertBefore=None): text = TextNode(self.soup.new_string(data), self.soup) if insertBefore: self.insertBefore(text, insertBefore) else: self.appendChild(text) def insertBefore(self, node, refNode): index = self.element.index(refNode.element) if (node.element.__class__ == NavigableString and self.element.contents and self.element.contents[index-1].__class__ == NavigableString): # (See comments in appendChild) old_node = self.element.contents[index-1] new_str = self.soup.new_string(old_node + node.element) old_node.replace_with(new_str) else: self.element.insert(index, node.element) node.parent = self def removeChild(self, node): node.element.extract() def reparentChildren(self, newParent): while self.element.contents: child = self.element.contents[0] child.extract() if isinstance(child, Tag): newParent.appendChild( Element(child, self.soup
, namespaces["html"])) else: newParent.appendChild( TextNode(child, self.soup)) def cloneNode(self): tag = self.soup.new_tag(self.element.name, self.namespace) node = Element(tag, self.soup, self.namespa
ce) for key,value in self.attributes: node.attributes[key] = value return node def hasContent(self): return self.element.contents def getNameTuple(self): if self.namespace == None: return namespaces["html"], self.name else: return self.namespace, self.name nameTuple = property(getNameTuple) class TextNode(Element): def __init__(self, element, soup): html5lib.treebuilders._base.Node.__init__(self, None) self.element = element self.soup = soup def cloneNode(self): raise NotImplementedError
erickeller/edi
tests/lib/test_playbookrunner.py
Python
lgpl-3.0
2,684
0.000373
# -*- coding: utf-8 -*- # Copyright (C) 2016 Matthias Luescher # # Authors: # Matthias Luescher # # This file is part of edi. # # edi is free software: you can redistribute it and/or modify # it under the terms of the GNU Lesser General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # edi is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public License # along with edi. If not, see <http://www.gnu.org/licenses/>. from edi.lib.configurationparser import ConfigurationParser from edi.lib.playbookrunner import PlaybookRunner from tests.libtesting.fixtures.configfiles import config_files from tests.libtesting.helpers import get_command_parameter from edi.lib import mockablerun import shutil import subprocess from codecs import open import yaml def verify_inventory(file): with open(file, encoding='utf-8') as f: assert 'fake-container' in f.read() def verify_extra_vars(file): print(file) with open(file, encoding='utf-8') as f: extra_vars = yaml.load(f) assert extra_vars['edi_config_management_user_name'] == 'edicfgmgmt' mountpoints = extra_vars['edi_shared_folder_mountpoints'] assert len(mountpoints) == 2 assert mountpoints[0] == '/foo/bar/target_mountpoint' def test_lxd_connection(config_files, monkeypatch): def fake_ansible_playbook_run(*popenargs, **kwargs): command = popenargs[0] if command[0] == 'ansible-playbook': assert 'lxd' == get_command_parameter(command, '--connection') verify_inventory(get_command_parameter(command, '--inventory')) verify_extra_vars(get_command_parameter(command, '--extra-vars').lstrip('@')) # TODO: verify --user for ssh connection return subprocess.CompletedProcess("fakerun", 0, '') else: return subprocess.run(*popenargs, **kwargs) monkeypatch.setattr(mockablerun, 'run_mockable', fake_ansible_playbook_run) def fakechown(*_): pass monkeypatch.setattr(shutil, 'chown', fakechown) with open(config_files, "r") as ma
in_file: parser = ConfigurationParser(main_file) runner = PlaybookRunner(parser, "fake-container", "lxd") playbooks = runner.run_all() expected_playbooks = ['10_base_system', '20_networking', '30_foo'] assert playbooks == expected_playbook
s
RemuTeam/Remu
project/tests/GUI/PopUps/test_remove_presentations_pop_up.py
Python
mit
1,094
0.002742
import unittest from GUI.PopUps.RemovePresentationsPopUp import RemovePresentationsPopUp class TestBindPresentat
ionToSlavePopup(unittest.TestCase): def setUp(self): self.presentations = ["Slave1", "Slave2"] self.remove_popup = RemovePresentationsPopUp(self.presentations, None) def test_init_setups_properly(self): self.assertEquals(len(self.remove_popup.selected_presentations), 0) self.assertIsNone(self.remove_popup.listener) def test_init_populates_presentation_list_properly(self): s
elf.assertEqual(len(self.remove_popup.ids.presentation_list.children), 2) def test_selected_presentations_is_empty_at_first(self): self.assertEqual(len(self.remove_popup.selected_presentations), 0) # # def test_checkbox_selects(self): # self.bind_popup.on_checkbox_active(self.bind_popup.checkboxes[0].ids.checker, True) # self.assertEquals(self.bind_popup.selected_slave, self.slave_name) # # def test_confirm(self): # self.bind_popup.confirm() # self.assertEquals(self.button.text, '')
undefinedv/Jingubang
sqlmap/lib/utils/crawler.py
Python
gpl-3.0
8,802
0.002272
#!/usr/bin/env python """ Copyright (c) 2006-2016 sqlmap developers (http://sqlmap.org/) See the file 'doc/COPYING' for copying permission """ import httplib import os import re import urlparse import tempfile import time from lib.core.common import clearConsoleLine from lib.core.common import dataToStdout from lib.core.common import findPageForms from lib.core.common import getSafeExString from lib.core.common import openFile from lib.core.common import readInput from lib.core.common import safeCSValue from lib.core.data import conf from lib.core.data import kb from lib.core.data import logger from lib.core.enums import MKSTEMP_PREFIX from lib.core.exception import SqlmapConnectionException from lib.core.exception import SqlmapSyntaxException from lib.core.settings import CRAWL_EXCLUDE_EXTENSIONS from lib.core.threads import getCurrentThreadData from lib.core.threads import runThreads from lib.parse.sitemap import parseSitemap from lib.request.connect import Connect as Request from thirdparty.beautifulsoup.beautifulsoup import BeautifulSoup from thirdparty.oset.pyoset import oset def crawl(target): try: visited = set() threadData = getCurrentThreadData() threadData.shared.value = oset() def crawlThread(): threadData = getCurrentThreadData() while kb.threadContinue: with kb.locks.limit: if threadData.shared.unprocessed: current = threadData.shared.unprocessed.pop() if current in visited: continue elif conf.crawlExclude and re.search(conf.crawlExclude, current): dbgMsg = "skipping '%s'" % current logger.debug(dbgMsg) continue else: visited.add(current) else: break content = None try: if current: content = Request.getPage(url=current, crawling=True, raise404=False)[0] except SqlmapConnectionException, ex: errMsg = "connection exception detected (%s). skipping " % ex errMsg += "URL '%s'" % current logger.critical(errMsg) except SqlmapSyntaxException: errMsg = "invalid URL detected. skipping '%s'" % current logger.critical(errMsg) except httplib.InvalidURL, ex: errMsg = "invalid URL detected (%s). skipping " % ex errMsg += "URL '%s'" % current logger.critical(errMsg) if not kb.threadContinue: break if isinstance(content, unicode): try: match = re.search(r"(?si)<html[^>]*>(.+)</html>", content) if match: content = "<html>%s</html>" % match.group(1) soup = BeautifulSoup(content) tags = soup('a') if not tags: tags = re.finditer(r'(?si)<a[^>]+href="(?P<href>[^>"]+)"', content) for tag in tags: href = tag.get("href") if hasattr(tag, "get") else tag.group("href") if href: if threadData.lastRedirectURL and threadData.lastRedirectURL[0] == threadData.lastRequestUID: current = threadData.lastRedirectURL[1] url = urlparse.urljoin(current, href) # flag to know if we are dealing with the same target host
_ = red
uce(lambda x, y: x == y, map(lambda x: urlparse.urlparse(x).netloc.split(':')[0], (url, target))) if conf.scope: if not re.search(conf.scope, url, re.I): continue elif not _: continue if url.split('.')[-1].lower() not in CRAWL_EXCLUDE_EXTENSIONS: with kb.locks.value: threadData.shared.deeper.add(url) if re.search(r"(.*?)\?(.+)", url): threadData.shared.value.add(url) except UnicodeEncodeError: # for non-HTML files pass finally: if conf.forms: findPageForms(content, current, False, True) if conf.verbose in (1, 2): threadData.shared.count += 1 status = '%d/%d links visited (%d%%)' % (threadData.shared.count, threadData.shared.length, round(100.0 * threadData.shared.count / threadData.shared.length)) dataToStdout("\r[%s] [INFO] %s" % (time.strftime("%X"), status), True) threadData.shared.deeper = set() threadData.shared.unprocessed = set([target]) if not conf.sitemapUrl: message = "do you want to check for the existence of " message += "site's sitemap(.xml) [y/N] " test = readInput(message, default="n") if test[0] in ("y", "Y"): found = True items = None url = urlparse.urljoin(target, "/sitemap.xml") try: items = parseSitemap(url) except SqlmapConnectionException, ex: if "page not found" in getSafeExString(ex): found = False logger.warn("'sitemap.xml' not found") except: pass finally: if found: if items: for item in items: if re.search(r"(.*?)\?(.+)", item): threadData.shared.value.add(item) if conf.crawlDepth > 1: threadData.shared.unprocessed.update(items) logger.info("%s links found" % ("no" if not items else len(items))) infoMsg = "starting crawler" if conf.bulkFile: infoMsg += " for target URL '%s'" % target logger.info(infoMsg) for i in xrange(conf.crawlDepth): threadData.shared.count = 0 threadData.shared.length = len(threadData.shared.unprocessed) numThreads = min(conf.threads, len(threadData.shared.unprocessed)) if not conf.bulkFile: logger.info("searching for links with depth %d" % (i + 1)) runThreads(numThreads, crawlThread, threadChoice=(i>0)) clearConsoleLine(True) if threadData.shared.deeper: threadData.shared.unprocessed = set(threadData.shared.deeper) else: break except KeyboardInterrupt: warnMsg = "user aborted during crawling. sqlmap " warnMsg += "will use partial list" logger.warn(warnMsg) finally: clearConsoleLine(True) if not threadData.shared.value: warnMsg = "no usable links found (with GET parameters)" logger.warn(warnMsg) else: for url in threadData.shared.value: kb.targets.add((url, None, None, None, None)) storeResultsToFile(kb.targets) def storeResultsToFile(results): if not results: return if kb.storeCrawlingChoice is None: message = "do you want to store crawling results to a temporary file " message += "for eventual further processing with other tools [y/N] " test = readInput(message, default="N") kb.storeCrawlingChoice = test[0] in ("y", "Y")
anhaidgroup/py_entitymatching
py_entitymatching/dask/dask_black_box_blocker.py
Python
bsd-3-clause
22,385
0.00344
from collections import OrderedDict import logging import time import sys import pandas as pd import numpy as np import pyprind import dask from dask import delayed from dask.diagnostics import ProgressBar import cloudpickle as cp import pickle from py_entitymatching.blocker.blocker import Blocker import py_entitymatching.catalog.catalog_manager as cm from py_entitymatching.utils.catalog_helper import log_info, get_name_for_key, \ add_key_column from py_entitymatching.utils.validation_helper import validate_object_type from py_entitymatching.dask.utils import validate_chunks, get_num_partitions, \ get_num_cores, wrap logger = logging.getLogger(__name__) class DaskBlackBoxBlocker(Blocker): """ WARNING THIS BLOCKER IS EXPERIMENTAL AND NOT TESTED. USE A0T YOUR OWN RISK. Blocks based on a black box function specified by the user. """ def __init__(self, *args, **kwargs): logg
er.warning( "WARNING THIS BLOCKER IS EXPERIMENTAL AND NOT TESTED. USE AT
YOUR OWN " "RISK.") super(Blocker, self).__init__(*args, **kwargs) self.black_box_function = None def set_black_box_function(self, function): """Sets black box function to be used for blocking. Args: function (function): the black box function to be used for blocking . """ self.black_box_function = function def block_tables(self, ltable, rtable, l_output_attrs=None, r_output_attrs=None, l_output_prefix='ltable_', r_output_prefix='rtable_', verbose=False, show_progress=True, n_ltable_chunks=1, n_rtable_chunks=1): """ WARNING THIS COMMAND IS EXPERIMENTAL AND NOT TESTED. USE AT YOUR OWN RISK. Blocks two tables based on a black box blocking function specified by the user. Finds tuple pairs from left and right tables that survive the black box function. A tuple pair survives the black box blocking function if the function returns False for that pair, otherwise the tuple pair is dropped. Args: ltable (DataFrame): The left input table. rtable (DataFrame): The right input table. l_output_attrs (list): A list of attribute names from the left table to be included in the output candidate set (defaults to None). r_output_attrs (list): A list of attribute names from the right table to be included in the output candidate set (defaults to None). l_output_prefix (string): The prefix to be used for the attribute names coming from the left table in the output candidate set (defaults to 'ltable\_'). r_output_prefix (string): The prefix to be used for the attribute names coming from the right table in the output candidate set (defaults to 'rtable\_'). verbose (boolean): A flag to indicate whether the debug information should be logged (defaults to False). show_progress (boolean): A flag to indicate whether progress should be displayed to the user (defaults to True). n_ltable_chunks (int): The number of partitions to split the left table ( defaults to 1). If it is set to -1, then the number of partitions is set to the number of cores in the machine. n_rtable_chunks (int): The number of partitions to split the right table ( defaults to 1). If it is set to -1, then the number of partitions is set to the number of cores in the machine. Returns: A candidate set of tuple pairs that survived blocking (DataFrame). Raises: AssertionError: If `ltable` is not of type pandas DataFrame. AssertionError: If `rtable` is not of type pandas DataFrame. AssertionError: If `l_output_attrs` is not of type of list. AssertionError: If `r_output_attrs` is not of type of list. AssertionError: If values in `l_output_attrs` is not of type string. AssertionError: If values in `r_output_attrs` is not of type string. AssertionError: If `l_output_prefix` is not of type string. AssertionError: If `r_output_prefix` is not of type string. AssertionError: If `verbose` is not of type boolean. AssertionError: If `show_progress` is not of type boolean. AssertionError: If `n_ltable_chunks` is not of type int. AssertionError: If `n_rtable_chunks` is not of type int. AssertionError: If `l_out_attrs` are not in the ltable. AssertionError: If `r_out_attrs` are not in the rtable. Examples: >>> def match_last_name(ltuple, rtuple): # assume that there is a 'name' attribute in the input tables # and each value in it has two words l_last_name = ltuple['name'].split()[1] r_last_name = rtuple['name'].split()[1] if l_last_name != r_last_name: return True else: return False >>> import py_entitymatching as em >>> from py_entitymatching.dask.dask_black_box_blocker DaskBlackBoxBlocker >>> bb = DaskBlackBoxBlocker() >>> bb.set_black_box_function(match_last_name) >>> C = bb.block_tables(A, B, l_output_attrs=['name'], r_output_attrs=['name'] ) """ logger.warning( "WARNING THIS COMMAND IS EXPERIMENTAL AND NOT TESTED. USE AT YOUR OWN RISK.") # validate data types of standard input parameters self.validate_types_params_tables(ltable, rtable, l_output_attrs, r_output_attrs, l_output_prefix, r_output_prefix, verbose, 1) # validate data type of show_progress self.validate_show_progress(show_progress) # validate black box function assert self.black_box_function != None, 'Black box function is not set' # validate output attributes self.validate_output_attrs(ltable, rtable, l_output_attrs, r_output_attrs) # get and validate metadata log_info(logger, 'Required metadata: ltable key, rtable key', verbose) # # get metadata l_key, r_key = cm.get_keys_for_ltable_rtable(ltable, rtable, logger, verbose) # # validate metadata cm._validate_metadata_for_table(ltable, l_key, 'ltable', logger, verbose) cm._validate_metadata_for_table(rtable, r_key, 'rtable', logger, verbose) # validate number of ltable and rtable chunks validate_object_type(n_ltable_chunks, int, 'Parameter n_ltable_chunks') validate_object_type(n_rtable_chunks, int, 'Parameter n_rtable_chunks') validate_chunks(n_ltable_chunks) validate_chunks(n_rtable_chunks) # # determine the number of chunks n_ltable_chunks = get_num_partitions(n_ltable_chunks, len(ltable)) n_rtable_chunks = get_num_partitions(n_rtable_chunks, len(rtable)) # do blocking # # set index for convenience l_df = ltable.set_index(l_key, drop=False) r_df = rtable.set_index(r_key, drop=False)
ppizarror/korektor
bin/easyprocess/examples/log.py
Python
gpl-2.0
447
0
from easyprocess import EasyPro
cess # @UnresolvedImport import logging # turn on logging logging.basicConfig(level=logging.DEBUG) EasyProcess('python --version').call() EasyProcess('ping localhost').start().sleep(1).stop() EasyProcess('python --version').check() try: EasyProcess('bad_command').check() except Exception, detail: print detai
l try: EasyProcess('sh -c bad_command').check() except Exception, detail: print detail
SnowOnion/ero
acfunh.py
Python
mit
353
0.002882
#!/usr/bin/python2 #coding=utf8 import httplib import urllib im
port urllib2 import json req = urllib2.Request('http://h.acfun.tv/综合版1.json') res = urllib2.urlopen(req) json_str = res.read() json_dic = json.loads(json_str) print json.dumps(json_dic, indent=4, encoding='utf-8') # print json.dumps(json_dic['data']['replys']
.items()[0], indent=4)
klavinslab/coral
tests/tests/test_design/test_gibson.py
Python
mit
2,083
0
'''Test gibson design module.''' from nose.tools import assert_equal, assert_raises from coral import design, DNA, Primer def test_gibson_primers(): '''Test gibson_primers function.''' # Fuse tdh3 promoter sequence to yfp (trimmed for readability) tdh3_3prime = DNA('aaccagttccctgaaattattcccctacttgactaataagtat' + 'ataaagacggtaggtattgattgtaattctgtaaatctatttc' + 'ttaaacttc') yfp_nterm = DNA('atggtgagcaagggcgaggagctgttcaccggggtggtgcccatc' + 'ctggtcgagctggacggcgacgtaaacggccacaagttcagcgtg' + 'tccggcgagggcgagggcgatgccacctacggcaagctgaccctg' + 'aag') # Expected annealing sequences and their Tms fwd_anneal = DNA('atggtgagcaagggcg') fwd_tm = 64.64172107821065 rev_anneal = DNA('gaagtttaagaaatagatttacagaattacaatcaatac') rev_tm = 64.24536287254085 # Expected overlaps all_right = DNA('TCGCCCTTGCTCACCAT') all_left = DNA('GGTATTGATTGTAATTCTGTAAATCTATTTCTTAAACTTC') mixed_fwd = DNA('TTCTTAAACTTC') mixed_
rev = DNA('CCTTGCTCACCAT') # Design primers - with homology all on left side, right side, or mixed # All on the 'right' - i.e. fwd primer right = design.gibson_primers(tdh3_3prime, yfp_nterm, 'right') right_rev = Primer(rev_anneal, tm=rev_tm, overhang=all_right) right_fwd = Primer(fwd_anneal, tm=fwd_tm) ass
ert_equal(right, (right_rev, right_fwd)) # All on the 'left' - i.e. rev primer left = design.gibson_primers(tdh3_3prime, yfp_nterm, 'left') left_rev = Primer(rev_anneal, tm=rev_tm) left_fwd = Primer(fwd_anneal, tm=fwd_tm, overhang=all_left) assert_equal(left, (left_rev, left_fwd)) # On both primers mixed = design.gibson_primers(tdh3_3prime, yfp_nterm, 'mixed') mixed_primer1 = Primer(rev_anneal, tm=rev_tm, overhang=mixed_rev) mixed_primer2 = Primer(fwd_anneal, tm=fwd_tm, overhang=mixed_fwd) assert_equal(mixed, (mixed_primer1, mixed_primer2)) assert_raises(ValueError, design.gibson_primers, tdh3_3prime, yfp_nterm, 'duck')
aewallin/allantools
tests/functional_tests/test_noise.py
Python
lgpl-3.0
556
0.01259
#!/usr/bin/python import sys sys.path.append("..") from allantools import noise import numpy import pytest def test_noise(): N = 500 #rate = 1.0 w = noise.white(N) b = noise.brown(N) v = noise.violet(N) p = noise.pink(N) # check output length assert len(w) == N assert len(b) == N assert len(v) == N assert len(p)
== N # check output type for x in [w, b, v, p]: assert type(x)
== numpy.ndarray, "%s is not numpy.ndarray" % (type(x)) if __name__ == "__main__": test_noise()
Hastu/educ_plateform
educ/authentification/admin.py
Python
mit
152
0.006579
from django.contrib import admin from forum.models import * admin.site.reg
ister(Student) admi
n.site.register(Professor) admin.site.register(Classroom)
Tackitt/flask-apispec
examples/petstore.py
Python
mit
2,262
0.007515
# -*- coding: utf-8 -*- import six import marshmallow as ma from flask_apispec import ResourceMeta, Ref, doc, marshal_with, use_kwargs class Pet: def __init__(self, name, type): self.name = name self.type = type class PetSchema(ma.Schema): name = ma.fields.Str() type = ma.fields.Str() class PetResource(six.with_metaclass(ResourceMeta)): @use_kwargs({ 'category': ma.fields.Str(), 'name': ma.fields.Str(), }) @marshal_with(PetSchema(), code=200) def get(self): return Pet('calici', 'cat') class CatResource(PetResource): @use_kwargs({'category': ma.fields.Int()}) @marshal_with(PetSchema(), code=201) def get(self): return Pet('calici', 'cat'), 200 ### class CrudResource(six.w
ith_metaclass(ResourceMeta)): schema = None @marshal_with(Ref('schema'), code=200) def get(self, id): pass
@marshal_with(Ref('schema'), code=200) @marshal_with(Ref('schema'), code=201) def post(self): pass @marshal_with(Ref('schema'), code=200) def put(self, id): pass @marshal_with(None, code=204) def delete(self, id): pass class PetResource(CrudResource): schema = PetSchema ### import flask import flask.views from flask_apispec import FlaskApiSpec app = flask.Flask(__name__) docs = FlaskApiSpec(app) @app.route('/pets/<pet_id>') @doc(params={'pet_id': {'description': 'pet id'}}) @marshal_with(PetSchema) @use_kwargs({'breed': ma.fields.Str()}) def get_pet(pet_id): return Pet('calici', 'cat') docs.register(get_pet) class MethodResourceMeta(ResourceMeta, flask.views.MethodViewType): pass class MethodResource(six.with_metaclass(MethodResourceMeta, flask.views.MethodView)): methods = None @doc( tags=['pets'], params={'pet_id': {'description': 'the pet name'}}, ) class CatResource(MethodResource): @marshal_with(PetSchema) def get(self, pet_id): return Pet('calici', 'cat') @marshal_with(PetSchema) def put(self, pet_id): return Pet('calici', 'cat') app.add_url_rule('/cat/<pet_id>', view_func=CatResource.as_view('CatResource')) docs.register(CatResource, endpoint='CatResource') if __name__ == '__main__': app.run(debug=True)
yebrahim/pydatalab
datalab/utils/_gcp_job.py
Python
apache-2.0
1,521
0.006575
# Copyright 2016 Google Inc. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except # in compliance with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software distributed under the License # is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express # or implied. See the License for the specific language governing permissions and limitations under # the License. """Implements GCP Job functionality.""" from __future__ import absolute_import from __future__ import unicode_literals import datalab.context from . import _job class GCPJob(_job.Job): """Represents a BigQuery Job. """ def __init__(self, job_id, context): """Initializes an instance of a Job. Args: job_id: the BigQuery job ID corresponding to this job. context: a Context object providing project_id and credentials. """ super(GCPJob, self).__init__(job_id) if context is None:
context = datalab.context.Context.default() self._context = context self._api = self._create_api(context) def _create_api(self, context): raise Exception('_create_api must be defined in a derived class') def __repr__(self): """Returns a representation for the job for showing in the notebook. """ return 'Job %s/%s %s' %
(self._context.project_id, self._job_id, self.state)
jfrancis71/TensorFlowApps
CZFaceDetection.py
Python
mit
9,947
0.036594
# # The weights for this model come from training in a neural network library called CognitoNet which is now retired. # # That training session used images from the Face Scrub data set: # http: http://vintage.winklerbros.net/facescrub.html # H.-W. Ng, S. Winkler. # A data-driven approach to cleaning large face datasets. # Proc. IEEE International Conference on Image Processing (ICIP), Paris, France, Oct. 27-30, 2014. # # Example use: # output = CZFaceDetection.CZHighlightImage( img, cnor.CZDetectFaces( img ) ) # # You need to download the following two files and install them somewhere on youe search path. # FaceNet2Convolve.json from https://drive.google.com/file/d/0Bzhe0pgVZtNUMFhfcGJwRE9sRWc/view?usp=sharing # GenderNet.json from https://drive.google.com/file/d/0Bzhe0pgVZtNUaDY5ZzFiN2ZfTFU/view?usp=sharing # #Public Interfaces #Timing: Approx 0.85s for 240x320 on MacOSX CPU #Works like FindFaces, ie returns { {{x1,y1},{x2,y2}},... } # On the Caltech 1999 face dataset, we achieve a recognition rate of around 92% with # an average of 14% of false positives/image. # The Caltech dataset has 450 images where most faces are quite close to camera, # where images are of size 896x592. Most of these images are of good quality, but some # are challenging, eg. cartoon, significant obscuring of face or poor lighting conditions. # Reference comparison, FindFaces achieves 99.6% recognition, but 56% average false positive rate/image def CZDetectFaces( pilImage, threshold=0.997 ): return CZDeleteOverlappingWindows( CZMultiScaleDetectObjects( pilImage, CZFaceNet, threshold ) ) def CZHighlightImage( pilImage, rectangles ): img = pilImage.copy() draw = ImageDraw.Draw( img ) draw.rectangle for obj in rectangles: draw.rectangle( [ obj[0][0], obj[0][1], obj[1][0], obj[1][1] ], outline = 'green' ) draw.rectangle( [ obj[0][0]-1, obj[0][1]-1, obj[1][0]+1, obj[1][1]+1 ], outline = 'green' ) draw.rectangle( [ obj[0][0]-2, obj[0][1]-2, obj[1][0]+2, obj[1][1]+2 ], outline = 'green' ) return img #returns a gender score ranging from 0 (most likely female) to 1 (most likely male def CZGender( pilImage ): norm = pilImage.convert( 'L' ).resize( ( 32, 32 ) ) tfImage = [ np.array( [ np.array( norm ) ] ).transpose( (1,2,0) ) / 255. ] return CZFaceDetectSession.run( CZGenderNet[1], feed_dict = { CZGenderNet[0] : tfImage } )[0][0] #Draws bounding boxes around detected faces and attempts to determine likely gender def CZHighlightFaces( pilImage, threshold = .997 ): objs = CZDetectFaces( pilImage, threshold ) img = pilImage.copy() draw = ImageDraw.Draw( img ) draw.rectangle for obj in objs: crp = pilImage.crop( ( obj[0][0], obj[0][1], obj[1][0], obj[1][1] ) ) gender = CZGender( crp ) c1 = np.array( [ 255., 105., 180. ] ) c2 = np.array( [ 0., 0., 255. ] ) bld = blend( gender, c1, c2 ) color = "#%02x%02x%02x"%( (int)(bld[0]), (int)(bld[1]), (int)(bld[2]) ) draw.rectangle( [ obj[0][0], obj[0][1], obj[1][0], obj[1][1] ], outline = color ) draw.rectangle( [ obj[0][0]-1, obj[0][1]-1, obj[1][0]+1, obj[1][1]+1 ], outline = color ) draw.rectangle( [ obj[0][0]-2, obj[0][1]-2, obj[1][0]+2, obj[1][1]+2 ], outline = color ) return img #Private Implementation Code import tensorflow as tf import numpy as np from PIL import ImageDraw import json import math import os def CZReadNN( fileName ): with open( fileName, 'r' ) as infile: j = json.load( infile ) return j CZFaceNetParameters = CZReadNN( os.path.join(os.path.expanduser('~'), 'FaceNet.json' ) ) #Takes a TensorFlow image array and builds a TensorFlow graph to process #that image using the model parameters specified in modelFilename. def buildObjectRecognitionGraph(): x_image = tf.placeholder( tf.float32, shape=[ 1, None, None, 1 ] ) h_conv1 = tf.nn.tanh( conv2d( x_image, CZFaceNetParameters[0] ) ) h_pool1 = max_pool_2x2(h_conv1) h_conv2 = tf.nn.tanh( conv2d( h_pool1, CZFaceNetParameters[1] ) ) h_pool2 = max_pool_2x2(h_conv2) h_conv3 = tf.nn.tanh( conv2d( h_pool2, CZFaceNetParameters[2] ) ) h_conv4 = tf.nn.sigmoid( conv2d( h_conv3, CZFaceNetParameters[3] ) ) return ( x_image, h_conv4 ) # Note the first part of w is the biases, the second is the weights def conv2d(x, w): return w[0] + tf.nn.conv2d(x, w[1], strides=[1, 1, 1, 1], padding='VALID') def max_pool_2x2(x): return tf.nn.max_pool(x, ksize=[1, 3, 3, 1], strides=[1, 2, 2, 1], padding='SAME') CZFaceNet = buildObjectRecognitionGraph() CZFaceDetectSession = tf.Session() # Conceptually it is a sliding window (32x32) object detector running at a single scale. # In practice it is implemented convolutionally ( for performance reasons ) so the net # should be fully convolutional, ie no fully connected layers. # The net output should be a 2D array of numbers indicating a metric for likelihood of object being present. # The net filter should accept an array of real numbers (ie this works on greyscale images). You can supply a # colour image as input to the function, but this is just converted to greyscale before being fed to the neural net # Note the geometric factor 4 in mapping from the output array to the input array, this is because we have # downsampled twice in the neural network, so there is a coupling from this algorithm to the architecture # of the neural net supplied. # The rational for using a greyscale neural net is that I am particularly fascinated by shape (much more # than colour), so wanted to look at performance driven by that factor alone. A commercial use might take # a different view. def CZSingleScaleDetectObjects( pilImage, tfGraph, threshold=0.997 ): npImage = np.array( pilImage.convert( 'L' ) ) / 255.0 image = [ np.array( [ npImage ] ).transpose( 1,2,0 ) ] outputMap = CZFaceDetectSession.run( tfGraph[1], feed_dict = { tfGraph[0] : image } ) extractPositions = np.transpose( np.nonzero( outputMap[0][:,:,0] > threshold ) ) objs = list( map( lambda x: (outputMap[0][:,:,0][x[0],x[1]],x[1]*4,x[0]*4), extractPositions ) ) return objs # Implements a sliding window object detector at multiple scales. # The function resamples the image at scales ranging from a minimum width of 32 up to 800 at 20% scale increments. # The maximum width of 800 was chosen for 2 reasons: to limit inference run time and to limit the number of likely # false positives / image, implying the detector's limit is to recognise faces larger than 32/800 (4%) of the image width. # Note that if for example you had high resolution images with faces in the far distance and wanted to detect those and were # willing to accept false positives within the image, you might reconsider that tradeoff. # However, the main use case was possibly high resolution images where faces are not too distant with objective of limiting # false positives across the image as a whole. def CZMultiScaleDetectObjects( pilImage, tfGraph, threshold=0.997 ): objRet = [] for s in range( -1 + int( ( math.log( 32 ) - math.log( pilImage.width ) ) / math.log (.8 ) ) ): height = pilImage.height * .8**s width = pilImage.width * .8**s print( "idx = ", s, " width = ", width
) image = pilImage.resize( ( int(width), int(height) ) ) objs = CZSingleScaleDetectObjects( image, tfGraph, threshold ) scale = pilImage.width / image.width for obj in objs: objRet.append( ( obj[0], ( scale*(16 + obj[1]
-16), scale*(16 + obj[2]-16) ), ( scale*(16 + obj[1]+16), scale*(16 + obj[2]+16) ) ) ) return objRet def CZIntersection( a, b ): xa=max(a[0][0],b[0][0]) ya=max(a[0][1],b[0][1]) xb=min(a[1][0],b[1][0]) yb=min(a[1][1],b[1][1]), if ( xa>xb or ya>yb ): ans = 0 else: ans = (xb-xa+1)*(yb-ya+1) return ans def CZArea( a ): return ( a[0][0]-a[1][0] ) * ( a[0][1]-a[1][1] ) def CZUnion( a, b ): return CZArea( a ) + CZArea( b ) - CZIntersection( a, b ) def CZIntersectionOverUnion
michielkauwatjoe/Meta
meta/rgb.py
Python
mit
524
0.009542
#!/usr/bin/env python3 ''' bm = sd.Bitmap(Width,Height) for x in xrange(Height*Width): j= x // Width i= x % Width col = Color[x] bm.SetPixel(i,j,col) bm.Save(PathWrite,sd.Imaging.ImageFormat.Bmp) ''' from PIL import Image w = h = 255 img = Image.new( 'RGB', (w, h), "black") # Create a new black image pixels = img.
load() # Create the pixel map for i in range(img.size[0]): # For every pixel:
for j in range(img.size[1]): pixels[i,j] = (i, j, 100) # Set the colour accordingly img.show()
rx2130/Leetcode
python/7 Reverse Integer.py
Python
apache-2.0
710
0.002817
class Solution(object): def reverse(self, x): """ :type x: int :rtype: int """ # Op1: isNegative = False if x < 0: isNegative = True x *= -1 x = int(str(x)[::-1]) if isNegative: x *= -1 return x if abs(x) < 2**31-1 else 0 def reverse2(self, x): sign = 1 if x < 0:
sign = -1 x *= -1 num = 0 while x: if abs(num) > 214748364: return 0 num = num * 10 + x % 10
x //= 10 return num * sign test = Solution() print(test.reverse(1000000003)) print(test.reverse2(-1000000003))
mathemage/h2o-3
h2o-py/h2o/expr.py
Python
apache-2.0
15,701
0.004204
# -*- encoding: utf-8 -*- """ Rapids expressions. These are helper classes for H2OFrame. :copyright: (c) 2016 H2O.ai :license: Apache License Version 2.0 (see LICENSE for details) """ from __future__ import division, print_function, absolute_import, unicode_literals import collections import copy import gc import math import sys import time import tabulate import h2o from h2o.backend.connection import H2OConnectionError from h2o.utils.compatibility import * # NOQA from h2o.utils.compatibility import repr2, viewitems, viewvalues from h2o.utils.shared_utils import _is_fr, _py_tmp_key from h2o.model.model_base import ModelBase from h2o.expr_optimizer import optimize class ExprNode(object): """ Composable Expressions: This module contains code for the lazy expression DAG. Execution Overview ------------------ The job of ExprNode is to provide a layer of indirection to H2OFrame instances that are built of arbitrarily large, lazy expression DAGs. In order to do this job well, ExprNode must also track top-level entry points to the such DAGs, maintain a sane amount of state to know which H2OFrame instances are temporary (or not), and maintain a cache of H2OFrame properties (nrows, ncols, types, names, few rows of data). Top-Level Entry Points ---------------------- An expression is declared top-level if it A) Computes and returns an H2OFrame to some on-demand call from somewhere B) An H2OFrame instance has more referrers than the 4 needed for the usual flow of python execution (see MAGIC_REF_COUNT below for more details). Sane Amount of State -------------------- Instances of H2OFrame live and die by the state contained in the _ex field. The three pieces of state -- _op, _children, _cache -- are the fewest pieces of state (and no fewer) needed to unambiguously track temporary H2OFrame instances and prune them according to the usual scoping laws of python. If _cache._id is None, then this DAG has never been sent over to H2O, and there's nothing more to do when the object goes out of scope. If _cache._id is not None, then there has been some work done by H2O to compute the big data object sitting in H2O to which _id points. At the time that __del__ is called on this object, a determination to throw out the corresponding data in H2O or to keep that data is made by the None'ness of _children. tl;dr: If _cache._id is not None and _children is None, then do not delete in H2O cluster If _cache._id is not None and _children is not None, then do delete in H2O cluster H2OCache -------- To prevent several unnecessary REST calls and unnecessary execution, a few of the oft-needed attributes of the H2OFrame are cached for convenience. The primary consumers of these cached values are __getitem__, __setitem__, and a few other H2OFrame ops that do argument validation or exchange (e.g. colnames for indices). There are more details available under the H2OCache class declaration. """ # Magical count-of-5: (get 2 more when looking at it in debug mode) # 2 for _get_ast_str frame, 2 for _get_ast_str local dictionary list, 1 for parent MAGIC_REF_COUNT = 5 if sys.gettrace() is None else 7 # M = debug ? 7 : 5 # Flag to control application of local expression tree optimizations __ENABLE_EXPR_OPTIMIZATIONS__ = True def __init__(self, op="", *args): # assert isinstance(op, str), op self._op = op # Base opcode string self._children = tuple( a._ex if _is_fr(a) else a for a in args) # ast children; if not None and _cache._id is not None then tmp self._cache = H2OCache() # ncols, nrows, names, types # try to fuse/simplify expression if self.__ENABLE_EXPR_OPTIMIZATIONS__: self._optimize() def _eager_frame(self): if not self._cache.is_empty(): return if self._cache._id is not None: return # Data already computed under ID, but not cached locally self._eval_driver(True) def _eager_scalar(self): # returns a scalar (or a list of scalars) if not self._cache.is_empty(): assert self._cache.is_scalar() return self assert self._cache._id is None self._eval_driver(False) assert self._cache._id is None assert self._cache.is_scalar() return self._cache._data def _eval_driver(self, top): exec_str = self._get_ast_str(top) res = ExprNode.rapids(exec_str) if 'scalar' in res: if isinstance(res['scalar'], list): self._cache._data = [float(x) for x in res['scalar']] else: self._cache._data = None if res['scalar'] is None else float(res['scalar']) if 'string' in res: self._cache._data = res['string'] if 'funstr' in res: raise NotImplementedError if 'key' in res: self._cache.nrows = res['num_rows'] self._cache.ncols = res['num_cols'] return self def _optimize(self): while True: opt = optimize(self) if opt is not None: opt(ctx=None) else: break # Recursively build a rapids execution string. Any object with more than # MAGIC_REF_COUNT referrers will be cached as a temp until the next client GC # cycle - consuming memory. Do Not Call This except when you need to do some # other cluster opera
tion on the evaluated object. Examples might be: lazy # dataset time parse vs changing the global timezone. Global timezone change # is eager, so the time parse as to occur in the correct order relative to # the timezone change, so cannot be lazy. # def _get_ast_str(self, top): if not self._cache.is_empty(): # Data already computed and cached; could a "false-like" cached value
return str(self._cache._data) if self._cache.is_scalar() else self._cache._id if self._cache._id is not None: return self._cache._id # Data already computed under ID, but not cached # assert isinstance(self._children,tuple) exec_str = "({} {})".format(self._op, " ".join([ExprNode._arg_to_expr(ast) for ast in self._children])) gc_ref_cnt = len(gc.get_referrers(self)) if top or gc_ref_cnt >= ExprNode.MAGIC_REF_COUNT: self._cache._id = _py_tmp_key(append=h2o.connection().session_id) exec_str = "(tmp= {} {})".format(self._cache._id, exec_str) return exec_str @staticmethod def _arg_to_expr(arg): if arg is None: return "[]" # empty list if isinstance(arg, ExprNode): return arg._get_ast_str(False) if isinstance(arg, ASTId): return str(arg) if isinstance(arg, (list, tuple, range)): return "[%s]" % " ".join(repr2(x) for x in arg) if isinstance(arg, slice): start = 0 if arg.start is None else arg.start stop = float("nan") if arg.stop is None else arg.stop step = 1 if arg.step is None else arg.step assert start >= 0 and step >= 1 and (math.isnan(stop) or stop >= start + step) if step == 1: return "[%d:%s]" % (start, str(stop - start)) else: return "[%d:%s:%d]" % (start, str((stop - start + step - 1) // step), step) if isinstance(arg, ModelBase): return arg.model_id return repr2(arg) def __del__(self): try: if self._cache._id is not None and self._children is not None: ExprNode.rapids("(rm {})".format(self._cache._id)) except (AttributeError, H2OConnectionError): pass def arg(self, idx): return self._children[idx] def args(self): return self._children def narg(self): return len(self._children) @staticmethod def _collapse_sb(sb): return ' '.join(""
itoijala/pyfeyner
tests/test-bend90a.py
Python
gpl-2.0
1,085
0.000922
# # pyfeyner - a simple Python interface for making Fey
nman diagrams. # Copyright (C) 2005-2010 Andy Buckley, Georg von Hippel # Copyright (C) 2013 Ismo Toijala # # pyfeyner is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # # pyfeyner is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of #
MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License along # with pyfeyner; if not, write to the Free Software Foundation, Inc., # 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301 USA. # from pyfeyner import * from pyfeyner.user import * fd = FeynDiagram() pt_in = Vertex(0, 0) pt_out = Vertex(0, 6) #pt_out = Vertex(6, 0) vtx = Vertex(3, 3) f = Fermion(pt_in, pt_out).arcThru(vtx) fd.draw("test-bend90a.pdf")
coolcooldool/tencent-weibo-exporter
loginver4/tencent_util.py
Python
apache-2.0
10,110
0.006012
# -*- coding: utf-8 -*- ''' Created on 2017/09/14 @author: yuyang ''' import os import urllib import uuid import re import docx_ext from docx.shared import Pt from docx.shared import RGBColor from docx.shared import Inches JPEG_EXTENSION = '.jpg' PNG_EXTENSION = '.png' GIF_EXTENSION = '.gif' SPLIT_STRING = '///' TOPIC_STRING = 'TTOOPPIICC' EMOJI_STRING = 'EEMMOOJJII' FRIEND_STRING = 'FFRRIIEENNDD' URL_STRING = 'UURRLL' QQEMO_STRING = 'QQEEMMOO' OTHEREMO_STRING = 'OOTTHHEERR' def add_author(document, author): para = document.add_paragraph() run = para.add_run(author) font = run.font #font.name = 'Microsoft YaHei' font.size = Pt(12) font.color.rgb = RGBColor(0x43, 0x6E, 0xEE) def add_content(document, content, para = None, font_size = 16): print content if content.__contains__('k.t.qq.com'): pattern = re.compile(r'(<a href="http://k.t.qq.com.*?</a>)', re.S) topics = re.findall(pattern, content) for topic in topics: topic_word = topic.split('#')[1] content = content.replace(topic, SPLIT_STRING + TOPIC_STRING + '#' + topic_word + '#' + SPLIT_STRING) if content.__contains__('www/mb/images/emoji'): pattern_emoji = re.compile(r'(<img.*?>)', re.S) pattern_emoji_img = re.compile(r'crs="(.*?)"', re.S) emojis = re.findall(pattern_emoji, content) for emoji in emojis: emoji_url = re.findall(pattern_emoji_img, emoji)[0] filename = download_pic(emoji_url, PNG_EXTENSION) content = content.replace(emoji, SPLIT_STRING + EMOJI_STRING + filename + SPLIT_STRING) if content.__contains__('em rel="@'): pattern_friend = re.compile(r'(<em rel=.*?</em>)', re.S) pattern_friend_name = re.compile(r'<em.*?title="(.*?)"', re.S) friends = re.findall(pattern_friend, content) for friend in friends: friend_name = re.findall(pattern_friend_name, friend)[0] content = content.replace(friend, SPLIT_STRING + FRIEND_STRING + friend_name + SPLIT_STRING) if content.__contains__('http://url.cn'): pattern_url = re.compile(r'(<a href=.*?</a>)', re.S) pattern_url_str = re.compile(r'<a href="(.*?)"', re.S) urls = re.findall(pattern_url, content) for url in urls: url_str = re.findall(pattern_url_str, url)[0] content = content.replace(url, SPLIT_STRING + URL_STRING + url_str + SPLIT_STRING) if content.__contains__('www/mb/images/face'): pattern_qqemo = re.compile(r'(<img.*?>)', re.S) pattern_qqemo_img = re.compile(r'crs="(.*?)"', re.S) qqemos = re.findall(pattern_qqemo, content) for qqemo in qqemos: qqemo_url = re.findall(pattern_qqemo_img, qqemo)[0] filename = download_pic(qqemo_url, GIF_EXTENSION) content = content.replace(qqemo, SPLIT_STRING + QQEMO_STRING + filename + SPLIT_STRING) if content.__contains__('<img class='): pattern_other_emo = re.compile(r'(<img.*?>)', re.S) pattern_other_emo_img = re.compile(r'<img.*?crs=(.*?) title=', re.S) pattern_other_emo_img_only = re.compile(r'<img.*?crs=(.*?)>', re.S) pattern_other_emos = re.findall(pattern_other_emo, content) for other_emo in pattern_other_emos: other_emo_match = re.findall(pattern_other_emo_img, other_emo) if not other_emo_match:# some emoji have special pattern other_emo_match = re.findall(pattern_other_emo_img_only, other_emo) other_emo_url = other_emo_match[0] other_emo_url = other_emo_url[1:-1]# delete start and end mark ' " filename = download_pic(other_emo_url, other_emo_url[-4:]) content = content.replace(other_emo, SPLIT_STRING + OTHEREMO_STRING + filename + SPLIT_STRING) content_parts = content.split(SPLIT_STRING) if not para: para = document.add_paragraph() for content_part in content_parts: # delete first <div> mark if content_part.startswith('<div>'): content_part = content_part[5:] if content_part.endswith('</div>'): content_part = content_part[:-6] if content_part.startswith(TOPIC_STRING): run = para.add_run(content_part.replace(TOPIC_STRING, '')) font = run.font font.italic = True font.bold = False font.size = Pt(font_size) font.color.rgb = RGBColor(0x00, 0x00, 0xCD) elif content_part.startswith(EMOJI_STRING): run = para.add_run() filename = content_part.replace(EMOJI_STRING, '') run.add_picture(filename) elif content_part.startswith(FRIEND_STRING): run = para.add_run(content_part.replace(FRIEND_STRING, '')) font = run.font font.italic = True font.bold = False font.size = Pt(font_size - 2) font.color.rgb = RGBColor(0xFF, 0x45, 0x00) elif content_part.startswith(URL_STRING): docx_ext.add_hyperlink(para, content_part.replace(URL_STRING, ''), content_part.replace(URL_STRING, ''), '1E90FF', True) elif content_part.startswith(QQEMO_STRING): run = para.add_run() filename = content_part.replace(QQEMO_STRING, '') run.add_picture(filename) elif content_part.startswith(OTHEREMO_STRING): run = para.add_run() filename = content_part.replace(OTHEREMO_STRING, '') run.add_picture(filename) else: content_part = content_part.replace('&amp;', '&') content_part = content_part.replace('&gt;', '>') content_part = content_part.replace('&quot;', '"') content_part = content_part.replace('&lt;', '<') run = para.add_run(content_part) font = run.font font.bold = False font.size = Pt(font_size) font.color.
rgb = RGBColor(0x08, 0x08, 0x08) def add_picture(document, story): filenames = analyze_pic(story) for filename
in filenames: try: document.add_picture(filename, width=Inches(5)) except: print '插入图片出错:' + filename def add_time(document, time): para = document.add_paragraph() run = para.add_run(time) font = run.font font.italic = True #font.name = 'Microsoft YaHei' font.size = Pt(10) font.color.rgb = RGBColor(0x7A, 0x7A, 0x7A) def add_location(document, story): location_items = analyze_loc(story) if len(location_items) <= 0: return link_name = location_items[2] google_map_url = 'https://maps.google.com/maps?q=' + location_items[0] + ',' + location_items[1] para = document.add_paragraph() run = para.add_run(u'位置:') font = run.font font.size = Pt(10) font.color.rgb = RGBColor(0x7A, 0x7A, 0x7A) docx_ext.add_hyperlink(para, google_map_url, link_name, '4169E1', False) def add_video(document, story): video_items = analyze_video(story) if not video_items: return para = document.add_paragraph() run = para.add_run() font = run.font font.size = Pt(10) font.color.rgb = RGBColor(0x7A, 0x7A, 0x7A) docx_ext.add_hyperlink(para, video_items[0], video_items[1], '4169E1', False) try: document.add_picture(video_items[3], width=Inches(3)) except: print '视频封面插入出错:' + video_items[3] def download_pic(url, extension): try: if not os.path.exists('.//pics'): os.mkdir('.//pics') filename = '.\\pics\\' + str(uuid.uuid4()) + extension urllib.urlretrieve(url, filename) except Exception: print '下载图片出错: ' + url return filename def analyze_pic(story): filenames = [] picBox = None imgGroup = None try: picBox = story.find_element_by_class_name('picBox') except: None try: imgGroup = story.find_element_by_class_name('tl_imgGroup') except: None if picBox:# one pictu
stack-of-tasks/rbdlpy
tutorial/lib/python2.7/site-packages/OpenGL/GLES2/NV/read_depth_stencil.py
Python
lgpl-3.0
785
0.008917
'''OpenGL extension NV.read_depth_stencil This module customises the behaviour of the OpenGL.raw.GLES2.NV.read_depth_stencil to provide a more Python-friendly API The official definition of this extension is available here: http://www.opengl.org/registry/specs/NV/read_depth_stencil.txt ''' from OpenGL import platform, constant, arrays from OpenGL import extensions, wrapper import ctypes from OpenGL.raw.GLES2 import _types, _glgets from OpenGL.raw.GLES2.NV.r
ead_depth_stencil import * from OpenGL.raw.GLES2.NV.read_depth_stencil import _EXTENSION_NAME def glInitReadDepthStencilNV(): '''R
eturn boolean indicating whether this extension is available''' from OpenGL import extensions return extensions.hasGLExtension( _EXTENSION_NAME ) ### END AUTOGENERATED SECTION
TimeSynth/TimeSynth
timesynth/signals/car.py
Python
mit
1,472
0.001359
import numpy as np from .base_signal import BaseSignal __all__ = ['CAR'] class CAR(BaseSignal): """Signal generatpr for continuously autoregressive (CAR) signals. Parameters ---------- ar_param : number (default 1.0) Parameter of the AR(1) process
sigma
: number (default 1.0) Standard deviation of the signal start_value : number (default 0.0) Starting value of the AR process """ def __init__(self, ar_param=1.0, sigma=0.5, start_value=0.01): self.vectorizable = False self.ar_param = ar_param self.sigma = sigma self.start_value = start_value self.previous_value = None self.previous_time = None def sample_next(self, time, samples, errors): """Sample a single time point Parameters ---------- time : number Time at which a sample was required Returns ------- float sampled signal for time t """ if self.previous_value is None: output = self.start_value else: time_diff = time - self.previous_time noise = np.random.normal(loc=0.0, scale=1.0, size=1) output = (np.power(self.ar_param, time_diff))*self.previous_value+\ self.sigma*np.sqrt(1-np.power(self.ar_param, time_diff))*noise self.previous_time = time self.previous_value = output return output
jhgg/discord.py
discord/colour.py
Python
mit
6,401
0.003749
# -*- coding: utf-8 -*- """ The MIT License (MIT) Copyright (c) 2015-2016 Rapptz Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. """ class Colour: """Represents a Discord role colour. This class is similar to an (red, green, blue) tuple. There is an alias for this called Color. Supported operations: +-----------+----------------------------------------+ | Operation | Description | +===========+========================================+ | x == y | Checks if two colours are equal. | +-----------+----------------------------------------+ | x != y | Checks if two colours are not equal. | +-----------+----------------------------------------+ | hash(x) | Return the colour's hash. | +-----------+----------------------------------------+ | str(x) | Returns the hex format for the colour. | +-----------+----------------------------------------+ Attributes ------------ value : int The raw integer colour value. """ __slots__ = [ 'value' ] def __init__(self, value): self.value = value def _get_byte(self, byte): return (self.value >> (8 * byte)) & 0xff def __eq__(self, other): return isinstance(other, Colour) and self.value == other.value def __ne__(self, other): return not self.__eq__(other) def __str__(self): return '#' + format(self.value, 'x') def __hash__(self): return hash(self.value) @property def r(self): """Returns the red component of the colour.""" return self._get_byte(2) @property def g(self): """Returns the green component of the colour.""" return self._get_byte(1) @property def b(self): """Returns the blue component of the colour.""" return self._get_byte(0) def to_tuple(self): """Returns an (r, g, b) tuple representing the colour.""" return (self.r, self.g, self.b) @classmethod def default(cls): """A factory method that returns a :class:`Colour` with a value of 0.""" return cls(0) @classmethod def teal(cls): """A factory method that returns a :class:`Colour` with a value of ``0x1abc9c``.""" return cls(0x1abc9c) @classmethod def dark_teal(cls): """A factory method that returns a :class:`Colour` with a value of ``0x11806a``.""" return cls(0x11806a) @classmethod def green(cls): """A factory method that returns a :class:`Colour` with a value of ``0x2ecc71``.""" return cls(0x2ecc71) @classmethod def dark_green(cls): """A fa
ctory method that returns a :class:`Colour` with a value of ``0x1f8b4c``.""" ret
urn cls(0x1f8b4c) @classmethod def blue(cls): """A factory method that returns a :class:`Colour` with a value of ``0x3498db``.""" return cls(0x3498db) @classmethod def dark_blue(cls): """A factory method that returns a :class:`Colour` with a value of ``0x206694``.""" return cls(0x206694) @classmethod def purple(cls): """A factory method that returns a :class:`Colour` with a value of ``0x9b59b6``.""" return cls(0x9b59b6) @classmethod def dark_purple(cls): """A factory method that returns a :class:`Colour` with a value of ``0x71368a``.""" return cls(0x71368a) @classmethod def magenta(cls): """A factory method that returns a :class:`Colour` with a value of ``0xe91e63``.""" return cls(0xe91e63) @classmethod def dark_magenta(cls): """A factory method that returns a :class:`Colour` with a value of ``0xad1457``.""" return cls(0xad1457) @classmethod def gold(cls): """A factory method that returns a :class:`Colour` with a value of ``0xf1c40f``.""" return cls(0xf1c40f) @classmethod def dark_gold(cls): """A factory method that returns a :class:`Colour` with a value of ``0xc27c0e``.""" return cls(0xc27c0e) @classmethod def orange(cls): """A factory method that returns a :class:`Colour` with a value of ``0xe67e22``.""" return cls(0xe67e22) @classmethod def dark_orange(cls): """A factory method that returns a :class:`Colour` with a value of ``0xa84300``.""" return cls(0xa84300) @classmethod def red(cls): """A factory method that returns a :class:`Colour` with a value of ``0xe74c3c``.""" return cls(0xe74c3c) @classmethod def dark_red(cls): """A factory method that returns a :class:`Colour` with a value of ``0x992d22``.""" return cls(0x992d22) @classmethod def lighter_grey(cls): """A factory method that returns a :class:`Colour` with a value of ``0x95a5a6``.""" return cls(0x95a5a6) @classmethod def dark_grey(cls): """A factory method that returns a :class:`Colour` with a value of ``0x607d8b``.""" return cls(0x607d8b) @classmethod def light_grey(cls): """A factory method that returns a :class:`Colour` with a value of ``0x979c9f``.""" return cls(0x979c9f) @classmethod def darker_grey(cls): """A factory method that returns a :class:`Colour` with a value of ``0x546e7a``.""" return cls(0x546e7a) Color = Colour
enigmampc/catalyst
catalyst/finance/performance/position.py
Python
apache-2.0
7,850
0.000127
# # Copyright 2016 Quantopian, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """ Position Tracking ================= +-----------------+----------------------------------------------------+ | key | value | +=================+====================================================+ | asset | the asset held in this position | +-----------------+----------------------------------------------------+ | amount | whole number of shares in the position | +-----------------+----------------------------------------------------+ | last_sale_price | price at last sale of the asset on the exchange | +-----------------+----------------------------------------------------+ | cost_basis | the volume weighted average price paid per share | +-----------------+----------------------------------------------------+ """ from __future__ import division from math import copysign from collections import OrderedDict import numpy as np import logbook from catalyst.assets import Future, Asset from catalyst.utils.input_validation import expect_types from catalyst.constants import LOG_LEVEL log = logbook.Logger('Performance', level=LOG_LEVEL) class Position(object): @expect_types(asset=Asset) def __init__(self, asset, amount=0, cost_basis=0.0, last_sale_price=0.0, last_sale_date=None): self.asset = asset self.amount = amount self.cost_basis = cost_basis # per share self.last_sale_price = last_sale_price self.last_sale_date = last_sale_date def earn_dividend(self, dividend): """ Register the number of shares we held at this dividend's ex date so that we can pay out the correct amount on the dividend's pay date. """ return { 'amount': self.amount * dividend.amount } def earn_stock_dividend(self, stock_dividend): """ Register the number of shares we held at this dividend's ex date so that we can pay out the correct amount on the dividend's pay date. """ return { 'payment_asset': stock_dividend.payment_asset, 'share_co
unt': np.floor( self.amount * float(stock_dividend.ratio) ) } @expect_types(asset=Asset) def handle_split(self, asset, ratio): """ Update the position by
the split ratio, and return the resulting fractional share that will be converted into cash. Returns the unused cash. """ if self.asset != asset: raise Exception("updating split with the wrong asset!") # adjust the # of shares by the ratio # (if we had 100 shares, and the ratio is 3, # we now have 33 shares) # (old_share_count / ratio = new_share_count) # (old_price * ratio = new_price) # e.g., 33.333 raw_share_count = self.amount / float(ratio) # e.g., 33 full_share_count = np.floor(raw_share_count) # e.g., 0.333 fractional_share_count = raw_share_count - full_share_count # adjust the cost basis to the nearest cent, e.g., 60.0 new_cost_basis = round(self.cost_basis * ratio, 2) self.cost_basis = new_cost_basis self.amount = full_share_count return_cash = round(float(fractional_share_count * new_cost_basis), 2) log.info("after split: " + str(self)) log.info("returning cash: " + str(return_cash)) # return the leftover cash, which will be converted into cash # (rounded to the nearest cent) return return_cash def update(self, txn): if self.asset != txn.asset: raise Exception('updating position with txn for a ' 'different asset') total_shares = self.amount + txn.amount if total_shares == 0: self.cost_basis = 0.0 else: prev_direction = copysign(1, self.amount) txn_direction = copysign(1, txn.amount) if prev_direction != txn_direction: # we're covering a short or closing a position if abs(txn.amount) > abs(self.amount): # we've closed the position and gone short # or covered the short position and gone long self.cost_basis = txn.price else: prev_cost = self.cost_basis * self.amount txn_cost = txn.amount * txn.price total_cost = prev_cost + txn_cost self.cost_basis = total_cost / total_shares # Update the last sale price if txn is # best data we have so far if self.last_sale_date is None or txn.dt > self.last_sale_date: self.last_sale_price = txn.price self.last_sale_date = txn.dt # on live mode, if the fee currency exists, reduce the commission # from the position if necessary. # Notice! the fee_currency is compared to the base_currency- once it # is allowed to have more than one quote currency, the comparison is # needed to be changed if txn.commission is not None and \ txn.fee_currency == self.asset.base_currency: total_shares -= txn.commission self.amount = total_shares @expect_types(asset=Asset) def adjust_commission_cost_basis(self, asset, cost): """ A note about cost-basis in catalyst: all positions are considered to share a cost basis, even if they were executed in different transactions with different commission costs, different prices, etc. Due to limitations about how catalyst handles positions, catalyst will currently spread an externally-delivered commission charge across all shares in a position. """ if asset != self.asset: raise Exception('Updating a commission for a different asset?') if cost == 0.0: return # If we no longer hold this position, there is no cost basis to # adjust. if self.amount == 0: return prev_cost = self.cost_basis * self.amount if isinstance(asset, Future): cost_to_use = cost / asset.multiplier else: cost_to_use = cost new_cost = prev_cost + cost_to_use self.cost_basis = new_cost / self.amount def __repr__(self): template = "asset: {asset}, amount: {amount}, cost_basis: {cost_basis}, \ last_sale_price: {last_sale_price}" return template.format( asset=self.asset, amount=self.amount, cost_basis=self.cost_basis, last_sale_price=self.last_sale_price ) def to_dict(self): """ Creates a dictionary representing the state of this position. Returns a dict object of the form: """ return { 'sid': self.asset, 'amount': self.amount, 'cost_basis': self.cost_basis, 'last_sale_price': self.last_sale_price } class positiondict(OrderedDict): def __missing__(self, key): return None
dalimatt/Instastalk
dependencies/workflow/background.py
Python
mit
7,361
0.001359
#!/usr/bin/env python # encoding: utf-8 # # Copyright © 2014 [email protected] # # MIT Licence. See http://opensource.org/licenses/MIT # # Created on 2014-04-06 # """ Run background tasks """ from __future__ import print_function, unicode_literals import sys import os import subprocess import pickle from workflow import Workflow __all__ = ['is_running', 'run_in_background'] _wf = None def wf(): global _wf if _wf is None: _wf = Workflow() return _wf def _arg_cache(name): """Return path to pickle cache file for arguments :param name: name of task :type name: ``unicode`` :returns: Path to cache file :rtype: ``unicode`` filepath """ return wf().cachefile('{0}.argcache'.format(name)) def _pid_file(name): """Return path to PID file for ``name`` :param name: name of task :type name: ``unicode`` :returns: Path to PID file for task :rtype: ``unicode`` filepath """ return wf().cachefile('{0}.pid'.format(name)) def _process_exists(pid): """Check if a process with PID ``pid`` exists :param pid: PID to check :type pid: ``int`` :returns: ``True`` if process exists, else ``False`` :rtype: ``Boolean`` """ try: os.kill(pid, 0) except OSError: # not running return False return True def is_running(name): """ Test whether task is running under ``name`` :param name: name of task :type name: ``unicode`` :returns: ``True`` if task with name ``name`` is running, else ``False`` :rtype: ``Boolean`` """ pidfile = _pid_file(name) if not os.path.exists(pidfile): return False with open(pidfile, 'rb') as file_obj: pid = int(file_obj.read().strip()) if _process_exists(pid): return True elif os.path.exists(pidfile): os.unlink(pidfile) return False def _background(stdin='/dev/null', stdout='/dev/null', stderr='/dev/null'): # pragma: no cover """Fork the current process into a background daemon. :param stdin: where to read input :type stdin: filepath :param stdout: where to write stdout output :type stdout: filepath :param stderr: where to write stderr output :type stderr: filepath """ # Do first fork. try: pid = os.fork() if pid > 0: sys.exit(0) # Exit first parent. except OSError as e: wf().logger.critical("fork #1 failed: ({0:d}) {1}".format( e.errno, e.strerror)) sys.exit(1) # Decouple from parent environment. os.chdir(wf().workflowdir) os.umask(0) os.setsid() # Do second fork. try: pid = os.fork() if pid > 0: sys.exit(0) # Exit second parent. except OSError as e: wf().logger.critical("fork #2 failed: ({0:d}) {1}".format( e.errno, e.strerror)) sys.exit(1) # Now I am a daemon! # Redirect standard file descriptors. si = file(stdin, 'r', 0) so = file(stdout, 'a+', 0) se = file(stderr, 'a+', 0) if hasattr(sys.stdin, 'fileno'): os.dup2(si.fileno(), sys.stdin.fileno()) if hasattr(sys.stdout, 'fileno'): os.dup2(so.fileno(), sys.stdout.fileno()) if hasattr(sys.stderr, 'fileno'): os.dup2(se.fileno(), sys.stderr.fileno()) def run_in_background(name, args, timeout=None, **kwargs): """Pickle arguments to cache file, then call this script again via :func:`subprocess.call`. :param name: name of task :type name: ``unicode`` :param args: arguments passed as first argument to :func:`subprocess.call` :param \**kwargs: keyword arguments to :func:`subprocess.call` :returns: exit code of sub-process :rtype: ``int`` When you call this function, it caches its arguments and then calls ``background.py`` in a subprocess. The Python subprocess will load the cached arguments, fork into the background, and then run the command you specified. This function will return as soon as the ``background.py`` subprocess has forked, returning the exit code of *that* process (i.e. not of the command you're trying to run). If that process fails, an error will be written to the log file. If a process is already running under the same name, this function will retu
rn immediately and will not run the specified command. """ if is_running(name): wf().logger.info('Task `{0}` is already running'.format(name)) ret
urn argcache = _arg_cache(name) # Cache arguments with open(argcache, 'wb') as file_obj: pickle.dump({'args': args, 'kwargs': kwargs}, file_obj) wf().logger.debug('Command arguments cached to `{0}`'.format(argcache)) # Call this script cmd = ['/usr/bin/python', __file__, name, str(timeout)] wf().logger.debug('Calling {0!r} ...'.format(cmd)) retcode = subprocess.call(cmd) if retcode: # pragma: no cover wf().logger.error('Failed to call task in background') else: wf().logger.debug('Executing task `{0}` in background...'.format(name)) return retcode def main(wf): # pragma: no cover """ Load cached arguments, fork into background, then call :meth:`subprocess.call` with cached arguments """ name = wf.args[0] timeout_str = wf.args[1] argcache = _arg_cache(name) if not os.path.exists(argcache): wf.logger.critical('No arg cache found : {0!r}'.format(argcache)) return 1 # Load cached arguments with open(argcache, 'rb') as file_obj: data = pickle.load(file_obj) # Cached arguments args = data['args'] kwargs = data['kwargs'] # Delete argument cache file os.unlink(argcache) pidfile = _pid_file(name) # Fork to background _background() # Write PID to file with open(pidfile, 'wb') as file_obj: file_obj.write('{0}'.format(os.getpid())) # Run the command try: wf.logger.debug('Task `{0}` running'.format(name)) wf.logger.debug('cmd : {0!r}'.format(args)) # wf.logger.debug('About to create sub process') process = subprocess.Popen(args, **kwargs) retcode = process.returncode # wf.logger.debug('Created process: pid:{0}'.format(process.pid)) # Write PID to file with open(pidfile, 'wb') as file_obj: file_obj.write('{0}'.format(process.pid)) # Create watchdog process if there is a timeout if timeout_str != 'None': watchdog = wf.workflowfile('watchdog.py') cmd = ['/usr/bin/python', watchdog, str(process.pid), timeout_str] wf.logger.debug('cmd : {0!r}'.format(cmd)) retcode2 = subprocess.call(cmd) if retcode2: wf.logger.error('Command failed with [{0}] : {1!r}'.format( retcode2, cmd)) if retcode: wf.logger.error('Command failed with [{0}] : {1!r}'.format( retcode, args)) finally: # if os.path.exists(pidfile): # os.unlink(pidfile) wf.logger.debug('Task `{0}` finished'.format(name)) if __name__ == '__main__': # pragma: no cover wf().run(main)
tinkerinestudio/Tinkerine-Suite
TinkerineSuite/python/Lib/power/__init__.py
Python
agpl-3.0
1,441
0.002776
# coding=utf-8 """ Provides crossplatform checking of current power source, battery warning level and battery time remaining estimate. Allows you to add observer for power notifications if platform supports it. Usage: from power import PowerManagement, PowerManagementObserver # Automatically imports platform-specific implementation class Observer(PowerManagementObserver): def on_power_sources_change(self, power_management): print "Power sources did change." def on_time_remaining_change(self, power_management): print "Time remaining did change." # class Observer(object): # ... # PowerManagementObserver.register(Observer) """ __author__ = '[email protected]' __version__ = '1.2' from sys import platform from power.common import * try: if platform.startswith('darwin'): from power.darwin import PowerManagement elif platform.startswith('win32'): from power.win32 import PowerManagement elif platform.startswith('linux'): from power.linux import PowerManagement else: raise RuntimeError("{platform} is not supported.".format(platform=platform)) except RuntimeError as e: import warnings warnings.warn("Unable to load PowerManagement for {platform}. No-op PowerManagement class is used: {error}".format(
error=str(e), platform=platform)) from power.common import PowerManagemen
tNoop as PowerManagement
nirvaris/nirvaris-dictionary
dictionary/migrations/0012_auto_20160521_1234.py
Python
mit
887
0.002255
# -*- coding: utf-8 -*- # Generated by Django 1.9 on 2016-
05-21 12:34 from __future__ import unicode_literals import dictionary.models from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('dictionary'
, '0011_auto_20160503_1535'), ] operations = [ migrations.RenameField( model_name='picture', old_name='image', new_name='full', ), migrations.AddField( model_name='picture', name='small', field=models.ImageField(max_length=1024, null=True, upload_to=dictionary.models.user_directory_path), ), migrations.AddField( model_name='picture', name='tinny', field=models.ImageField(max_length=1024, null=True, upload_to=dictionary.models.user_directory_path), ), ]
savi-dev/horizon
horizon/views/auth_forms.py
Python
apache-2.0
8,511
0.000587
# vim: tabstop=4 shiftwidth=4 softtabstop=4 # Copyright 2012 United States Government as represented by the # Administrator of the National Aeronautics and Space Administration. # All Rights Reserved. # # Copyright 2012 Nebula, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. """ Forms used for Horizon's auth mechanisms. """ import logging from django import shortcuts from django.conf import settings from django.contrib.auth import REDIRECT_FIELD_NAME from django.utils.translation import ugettext as _ from django.views.decorators.debug import sensitive_variables from keystoneclient import exceptions as keystone_exceptions from horizon import api from horizon import base from horizon import exceptions from horizon import forms from horizon import users LOG = logging.getLogger(__name__) def _set_session_data(request, token): request.session['serviceCatalog'] = token.serviceCatalog request.session['tenant'] = token.tenant['name'] request.session['tenant_id'] = token.tenant['id'] request.session['token'] = token.id request.session['user_name'] = token.user['name'] request.session['user_id'] = token.user['id'] request.session['roles'] = token.user['roles'] class Login(forms.SelfHandlingForm): """ Form used for logging in a user. Handles authentication with Keystone, choosing a tenant, and fetching a scoped token token for that tenant. Redirects to the URL returned by :meth:`horizon.get_user_home` if successful. Subclass of :class:`~horizon.forms.SelfHandlingForm`. """ region = forms.ChoiceField(label=_("Region"), required=False) username = forms.CharField(label=_("User Name")) password = forms.CharField(label=_("Password"), widget=forms.PasswordInput(render_value=False)) def __init__(self, *args, **kwargs): super(Login, self).__init__(*args, **kwargs) # FIXME(gabriel): When we switch to region-only settings, we can # remove this default region business. default_region = (settings.OPENSTACK_KEYSTONE_URL, "Default Region") regions = getattr(settings, 'AVAILABLE_REGIONS', [default_region]) self.fields['region'].choices = regions if len(regions) == 1: self.fields['region'].initial = default_region[0] self.fields['region'].widget = forms.widgets.HiddenInput() @sensitive_variables("data") def handle(self, request, data): """ Process the user's login via Keystone. Note: We don't use the messages framework here (including messages created by ``exceptions.handle`` beause they will not be displayed on the login page (intentionally). Instead we add all error messages to the form's ``non_field_errors``, causing them to appear as errors on the form itself. """ if 'user_name' in request.session: if request.session['user_name'] != data['username']: # To avoid reusing another user's sessi
on, create a # new,
empty session if the existing session # corresponds to a different authenticated user. request.session.flush() # Always cycle the session key when viewing the login form to # prevent session fixation request.session.cycle_key() # For now we'll allow fallback to OPENSTACK_KEYSTONE_URL if the # form post doesn't include a region. endpoint = data.get('region', None) or settings.OPENSTACK_KEYSTONE_URL if endpoint != request.session.get('region_endpoint', None): region_name = dict(self.fields['region'].choices)[endpoint] request.session['region_endpoint'] = endpoint request.session['region_name'] = region_name request.user.service_catalog = None redirect_to = request.REQUEST.get(REDIRECT_FIELD_NAME, "") if data.get('tenant', None): try: token = api.token_create(request, data.get('tenant'), data['username'], data['password']) tenants = api.tenant_list_for_token(request, token.id) except: msg = _('Unable to authenticate for that project.') exceptions.handle(request, ignore=True) return self.api_error(msg) _set_session_data(request, token) user = users.get_user_from_request(request) redirect = redirect_to or base.Horizon.get_user_home(user) return shortcuts.redirect(redirect) elif data.get('username', None): try: unscoped_token = api.token_create(request, '', data['username'], data['password']) except keystone_exceptions.Unauthorized: msg = _('Invalid user name or password.') exceptions.handle(request, ignore=True) return self.api_error(msg) except: # If we get here we don't want to show a stack trace to the # user. However, if we fail here, there may be bad session # data that's been cached already. request.user_logout() msg = _("An error occurred authenticating. " "Please try again later.") exceptions.handle(request, ignore=True) return self.api_error(msg) # Unscoped token request.session['unscoped_token'] = unscoped_token.id request.user.username = data['username'] # Get the tenant list, and log in using first tenant # FIXME (anthony): add tenant chooser here? try: tenants = api.tenant_list_for_token(request, unscoped_token.id) except: exceptions.handle(request, ignore=True) tenants = [] # Abort if there are no valid tenants for this user if not tenants: msg = _('You are not authorized for any projects.') return self.api_error(msg) # Create a token. # NOTE(gabriel): Keystone can return tenants that you're # authorized to administer but not to log into as a user, so in # the case of an Unauthorized error we should iterate through # the tenants until one succeeds or we've failed them all. while tenants: tenant = tenants.pop() try: token = api.token_create_scoped(request, tenant.id, unscoped_token.id) break except: # This will continue for recognized Unauthorized # exceptions from keystoneclient. exceptions.handle(request, ignore=True) token = None if token is None: msg = _("You are not authorized for any available projects.") return self.api_error(msg) _set_session_data(request, token) user = users.get_user_from_request(request) redirect = redirect_to or base.Horizon.get_user_home(user) return shortcuts.redirect(redirect) class LoginWithTenant(Login): """ Exactly like :class:`.Login` but includes
maxive/erp
addons/lunch/models/lunch.py
Python
agpl-3.0
14,593
0.003358
# -*- coding: utf-8 -*- # Part of Odoo. See LICENSE file for full copyright and licensing details. from collections import OrderedDict import json import datetime from odoo import api, fields, models, _ from odoo.exceptions import AccessError, ValidationError from odoo.addons import decimal_precision as dp class LunchOrder(models.Model): """ A lunch order contains one or more lunch order line(s). It is associated to a user for a given date. When creating a lunch order, applicable lunch alerts are displayed. """ _name = 'lunch.order' _description = 'Lunch Order' _order = 'date desc' def _default_previous_order_ids(self): prev_order = self.env['lunch.order.line'].search([('user_id', '=', self.env.uid), ('product_id.active', '!=', False)], limit=20, order='id desc') # If we return return prev_order.ids, we will have duplicates (identical orders). # Therefore, this following part removes duplicates based on product_id and note. return list({ (order.product_id, order.note): order.id for order in prev_order }.values()) user_id = fields.Many2one('res.users', 'User', readonly=True, states={'new': [('readonly', False)]}, default=lambda self: self.env.uid) date = fields.Date('Date', required=True, readonly=True, states={'new': [('readonly', False)]}, default=fields.Date.context_today) order_line_ids = fields.One2many('lunch.order.line', 'order_id', 'Products', readonly=True, copy=True, states={'new': [('readonly', False)], False: [('readonly', False)]}) total = fields.Float(compute='_compute_total', string="Total", store=True) state = fields.Selection([('new', 'New'), ('confirmed', 'Received'), ('cancelled', 'Cancelled')], 'Status', readonly=True, index=True, copy=False, compute='_compute_order_state', store=True) alerts = fields.Text(compute='_compute_alerts_get', string="Alerts") company_id = fields.Many2one('res.company', related='user_id.company_id', store=True) currency_id = fields.Many2one('res.currency', related='company_id.currency_id', readonly=True, store=True) cash_move_balance = fields.Monetary(compute='_compute_cash_move_balance', multi='cash_move_balance') balance_visible = fields.Boolean(compute='_compute_cash_move_balance', multi='cash_move_balance') previous_order_ids = fields.Many2many('lunch.order.line', compute='_compute_previous_order') previous_order_widget = fields.Text(compute='_compute_previous_order') @api.one @api.depends('order_line_ids') def _compute_total(self): """ get and sum the order lines' price """ self.total = sum( orderline.price for orderline in self.order_line_ids) @api.multi def name_get(self): return [(order.id, '%s %s' % (_('Lunch Order'), '#%d' % order.id)) for order in self] @api.depends('state') def _compute_alerts_get(self): """ get the alerts to display on the order form """ alert_msg = [alert.message for alert in self.env['lunch.alert'].search([]) if alert.display] if self.state == 'new': self.alerts = alert_msg and '\n'.join(alert_msg) or False @api.multi @api.depends('user_id', 'state') def _compute_previous_order(self): self.ensure_one() self.previous_order_widget = json.dumps(False) prev_order = self.env['lunch.order.line'].search([('user_id', '=', self.env.uid), ('product_id.active', '!=', False)], limit=20, order='date desc, id desc') # If we use prev_order.ids, we will have duplicates (identical orders). # Therefore, this following part removes duplicates based on product_id and note. self.previous_order_ids = list({ (order.product_id, order.note): order.id for order in prev_order }.values()) if self.previous_order_ids: lunch_data = {} for line in self.previous_order_ids: lunch_data[line.id] = { 'line_id': line.id, 'product_id': line.product_id.id, 'product_name': line.product_id.name, 'supplier': line.supplier.name, 'note': line.note, 'price': line.price, 'date': line.date,
'currency_id': line.currency_id.id, }
# sort the old lunch orders by (date, id) lunch_data = OrderedDict(sorted(lunch_data.items(), key=lambda t: (t[1]['date'], t[0]), reverse=True)) self.previous_order_widget = json.dumps(lunch_data) @api.one @api.depends('user_id') def _compute_cash_move_balance(self): domain = [('user_id', '=', self.user_id.id)] lunch_cash = self.env['lunch.cashmove'].read_group(domain, ['amount', 'user_id'], ['user_id']) if len(lunch_cash): self.cash_move_balance = lunch_cash[0]['amount'] self.balance_visible = (self.user_id == self.env.user) or self.user_has_groups('lunch.group_lunch_manager') @api.one @api.constrains('date') def _check_date(self): """ Prevents the user to create an order in the past """ date_order = datetime.datetime.strptime(self.date, '%Y-%m-%d') date_today = datetime.datetime.strptime(fields.Date.context_today(self), '%Y-%m-%d') if (date_order < date_today): raise ValidationError(_('The date of your order is in the past.')) @api.one @api.depends('order_line_ids.state') def _compute_order_state(self): """ Update the state of lunch.order based on its orderlines. Here is the logic: - if at least one order line is cancelled, the order is set as cancelled - if no line is cancelled but at least one line is not confirmed, the order is set as new - if all lines are confirmed, the order is set as confirmed """ if not self.order_line_ids: self.state = 'new' else: isConfirmed = True for orderline in self.order_line_ids: if orderline.state == 'cancelled': self.state = 'cancelled' return elif orderline.state == 'confirmed': continue else: isConfirmed = False if isConfirmed: self.state = 'confirmed' else: self.state = 'new' return class LunchOrderLine(models.Model): _name = 'lunch.order.line' _description = 'lunch order line' _order = 'date desc, id desc' name = fields.Char(related='product_id.name', string="Product Name", readonly=True) order_id = fields.Many2one('lunch.order', 'Order', ondelete='cascade', required=True) product_id = fields.Many2one('lunch.product', 'Product', required=True) category_id = fields.Many2one('lunch.product.category', string='Product Category', related='product_id.category_id', readonly=True, store=True) date = fields.Date(string='Date', related='order_id.date', readonly=True, store=True) supplier = fields.Many2one('res.partner', string='Vendor', related='product_id.supplier', readonly=True, store=True) user_id = fields.Many2one('res.users', string='User', related='order_id.user_id', readonly=True, store=True) note = fields.Text('Note') price = fields.Float(related='product_id.price', readonly=True, store=True, digits=dp.get_precision('Account')) state = fields.Selection([('new', 'New'), ('confirmed', 'Received'), ('ordered', 'Ord
abelectronicsuk/ABElectronics_Python_Libraries
IOPi/tests/get_bus_pullups.py
Python
gpl-2.0
1,397
0
#!/usr/bin/env python """ ================================================ ABElectronics IO Pi Tests | test get_bus_pullups function Requires python smbus to be installed For Python 2 install with: sudo apt-get install python-smbus For Python 3 install with: sudo apt-get install python3-smbus run with: python3 get_bus_pullups.py ================================================ This test validates the get_bus_pullups function in the IOPi class. === Expected Result ============================ > Console Output: Test Passed """ from __future__ import absolute_import, division, print_function, \ unicode_literals try: import sys sys.path.append("..") from IOPi import IOPi except ImportError: raise ImportError("Failed to import IOPi library") def main(): """ Main program function """ passed = True iopi = IOPi(0x20, False) # new iopi object without initialisation for a in range(1, 65536): iopi.set_bus_pullups(a) x = iopi.get_bus_pullups()
if x != a: passed = False break iopi.set_bus_pullups(a) x = iopi.get_bus_pullups()
if x != a: passed = False break if passed is False: print("Test Failed") else: print("Test Passed") if __name__ == "__main__": main()
quattor/aquilon
lib/aquilon/worker/commands/show_realm_all.py
Python
apache-2.0
1,108
0
# -*- cpy-indent-level: 4; indent-tabs-mode: nil -*- # ex: set expandtab softtabstop=4 shiftwidth=4: # # Copyright (C) 2012,2014,2016 C
ontributor # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS
IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Contains the logic for `aq show realm --all`.""" from aquilon.aqdb.model import Realm from aquilon.worker.broker import BrokerCommand from aquilon.worker.formats.list import StringAttributeList class CommandShowRealmAll(BrokerCommand): required_parameters = [] def render(self, session, **_): q = session.query(Realm).order_by(Realm.name) return StringAttributeList(q.all(), "name")
edx-solutions/edx-platform
lms/djangoapps/courseware/tests/test_lti_integration.py
Python
agpl-3.0
9,264
0.002807
"""LTI integration tests""" import json from collections import OrderedDict import mock import oauthlib import six from django.conf import settings from django.urls import reverse from six import text_type from lms.djangoapps.courseware.tests.helpers import BaseTestXmodule from lms.djangoapps.courseware.views.views import get_course_lti_endpoints from openedx.core.lib.url_utils import quote_slashes from xmodule.modulestore.tests.django_utils import SharedModuleStoreTestCase from xmodule.modulestore.tests.factories import CourseFactory, ItemFactory from xmodule.x_module import STUDENT_VIEW class TestLTI(BaseTestXmodule): """ Integration test for lti xmodule. It checks overall code, by assuring that context that goes to template is correct. As part of that, checks oauth signature generation by mocking signing function of `oauthlib` library. """ CATEGORY = "lti" def setUp(self): """ Mock oauth1 signing of requests library for testing. """ super(TestLTI, self).setUp() mocked_nonce = u'135685044251684026041377608307' mocked_timestamp = u'1234567890' mocked_signature_after_sign = u'my_signature%3D' mocked_decoded_signature = u'my_signature=' # Note: this course_id is actually a course_key context_id = text_type(self.item_descriptor.course_id) user_id = text_type(self.item_descriptor.xmodule_runtime.anonymous_student_id) hostname = self.item_descriptor.xmodule_runtime.hostname resource_link_id = text_type(six.moves.urllib.parse.quote('{}-{}'.format(hostname, self.item_descriptor.location.html_id() ))) sourcedId = "{context}:{resource_link}:{user_id}".format( context=six.moves.urllib.parse.quote(context_id), resource_link=resource_link_id, user_id=user_id ) self.correct_headers = { u'user_id': user_id, u'oauth_callback': u'about:blank', u'launch_presentation_return_url': '', u'lti_message_type': u'basic-lti-launch-request', u'lti_version': 'LTI-1p0', u'roles': u'Student', u'context_id': context_id, u'resource_link_id': resource_link_id, u'lis_result_sourcedid': sourcedId, u'oauth_nonce': mocked_nonce, u'oauth_timestamp': mocked_timestamp, u'oauth_consumer_key': u'', u'oauth_signature_method': u'HMAC-SHA1', u'oauth_version': u'1.0', u'oauth_signature': mocked_decoded_signature } saved_sign = oauthlib.oauth1.Client.sign self.expected_context = { 'display_name': self.item_descriptor.display_name, 'input_fields': self.correct_headers, 'element_class': self.item_descriptor.category,
'element_id': self.item_descriptor.location.html_id(), 'launch_url': u'http://www.example.com', # default value 'open_in_a_new_page': Tr
ue, 'form_url': self.item_descriptor.xmodule_runtime.handler_url(self.item_descriptor, 'preview_handler').rstrip('/?'), 'hide_launch': False, 'has_score': False, 'module_score': None, 'comment': u'', 'weight': 1.0, 'ask_to_send_username': self.item_descriptor.ask_to_send_username, 'ask_to_send_email': self.item_descriptor.ask_to_send_email, 'description': self.item_descriptor.description, 'button_text': self.item_descriptor.button_text, 'accept_grades_past_due': self.item_descriptor.accept_grades_past_due, } def mocked_sign(self, *args, **kwargs): """ Mocked oauth1 sign function. """ # self is <oauthlib.oauth1.rfc5849.Client object> here: __, headers, __ = saved_sign(self, *args, **kwargs) # we should replace nonce, timestamp and signed_signature in headers: old = headers[u'Authorization'] old_parsed = OrderedDict([param.strip().replace('"', '').split('=') for param in old.split(',')]) old_parsed[u'OAuth oauth_nonce'] = mocked_nonce old_parsed[u'oauth_timestamp'] = mocked_timestamp old_parsed[u'oauth_signature'] = mocked_signature_after_sign headers[u'Authorization'] = ', '.join([k + '="' + v + '"' for k, v in old_parsed.items()]) return None, headers, None patcher = mock.patch.object(oauthlib.oauth1.Client, "sign", mocked_sign) patcher.start() self.addCleanup(patcher.stop) def test_lti_constructor(self): generated_content = self.item_descriptor.render(STUDENT_VIEW).content expected_content = self.runtime.render_template('lti.html', self.expected_context) self.assertEqual(generated_content, expected_content) def test_lti_preview_handler(self): generated_content = self.item_descriptor.preview_handler(None, None).body expected_content = self.runtime.render_template('lti_form.html', self.expected_context) self.assertEqual(generated_content.decode('utf-8'), expected_content) class TestLTIModuleListing(SharedModuleStoreTestCase): """ a test for the rest endpoint that lists LTI modules in a course """ # arbitrary constant COURSE_SLUG = "100" COURSE_NAME = "test_course" @classmethod def setUpClass(cls): super(TestLTIModuleListing, cls).setUpClass() cls.course = CourseFactory.create(display_name=cls.COURSE_NAME, number=cls.COURSE_SLUG) cls.chapter1 = ItemFactory.create( parent_location=cls.course.location, display_name="chapter1", category='chapter') cls.section1 = ItemFactory.create( parent_location=cls.chapter1.location, display_name="section1", category='sequential') cls.chapter2 = ItemFactory.create( parent_location=cls.course.location, display_name="chapter2", category='chapter') cls.section2 = ItemFactory.create( parent_location=cls.chapter2.location, display_name="section2", category='sequential') # creates one draft and one published lti module, in different sections cls.lti_published = ItemFactory.create( parent_location=cls.section1.location, display_name="lti published", category="lti", location=cls.course.id.make_usage_key('lti', 'lti_published'), ) cls.lti_draft = ItemFactory.create( parent_location=cls.section2.location, display_name="lti draft", category="lti", location=cls.course.id.make_usage_key('lti', 'lti_draft'), publish_item=False, ) def expected_handler_url(self, handler): """convenience method to get the reversed handler urls""" return "https://{}{}".format(settings.SITE_NAME, reverse( 'xblock_handler_noauth', args=[ text_type(self.course.id), quote_slashes(text_type(self.lti_published.scope_ids.usage_id)), handler ] )) def test_lti_rest_bad_course(self): """Tests what happens when the lti listing rest endpoint gets a bad course_id""" bad_ids = [u"sf", u"dne/dne/dne", u"fo/ey/\\u5305"] for bad_course_id in bad_ids: lti_rest_endpoints_url = 'courses/{}/lti_rest_endpoints/'.format(bad_course_id) response = self.client.get(lti_rest_endpoints_url) self.assertEqual(404, response.status_code) def test_lti_rest_listing(self): """tests that the draft lti module is part of the endpoint response""" request = mock.Mock() request.method = 'GET' response
narrowmark/engelbart
note_entry.py
Python
mit
4,157
0.006495
import time import wx import xapian from threading import Thread from stop_words import stop_words class NoteEntryFrame(wx.Frame): def __init__(self, parent): wx.Frame.__init__(self, None, title="Note Entry", size=(300, 300)) self.db_path = "db" self.InitUI() def InitUI(self): panel = wx.Panel(self) # General GUI layout hbox =
wx.BoxSizer(wx.HORIZONTAL) sizer = wx.FlexGridSizer(3, 2, 9, 25) subject = wx.StaticText(panel, label='Subject') note = wx.StaticText(panel, label='Note') self.subject_text = wx.TextCtrl(panel) self.note_text = wx.TextCtrl(panel, style=wx.TE_MULTILINE) sizer.AddMany([(subject), (self.subject_text, 1, wx.EXPAND), (note), (se
lf.note_text, 1, wx.EXPAND)]) sizer.AddGrowableRow(1, 1) sizer.AddGrowableCol(1, 1) hbox.Add(sizer, proportion=1, flag=wx.ALL|wx.EXPAND, border=15) panel.SetSizer(hbox) # Accelerator features save = wx.NewId() open = wx.NewId() self.Bind(wx.EVT_MENU, self.onCtrlS, id=save) self.Bind(wx.EVT_MENU, self.onCtrlO, id=open) self.accel = wx.AcceleratorTable( [(wx.ACCEL_CTRL, ord('S'), save), (wx.ACCEL_CTRL, ord('O'), open)]) self.SetAcceleratorTable(self.accel) self.Show() self.ueg() def onCtrlS(self, e): self.index(self.db_path) def onCtrlO(self, e): pass def index(self, db_path="db"): subject = self.subject_text.GetValue() note = self.note_text.GetValue() now = time.ctime() db = xapian.WritableDatabase(db_path, xapian.DB_CREATE_OR_OPEN) indexer = xapian.TermGenerator() stemmer = xapian.Stem("english") indexer.set_stemmer(stemmer) doc = xapian.Document() doc.set_data(note) indexer.set_document(doc) indexer.index_text(subject) indexer.index_text(note) indexer.index_text(now) db.add_document(doc) self.note_text.Clear() def ueg(self): p_search = PassiveSearchThread(self) class PassiveSearchFrame(wx.Frame): def __init__(self, parent): wx.Frame.__init__(self, parent, title="Passive Search", size=(300,300)) self.parent = parent self.InitUI() self.timer = wx.Timer(self) self.Bind(wx.EVT_TIMER, self.compare, self.timer) self.timer.Start(1500) def InitUI(self): panel = wx.Panel(self) # General GUI layout hbox = wx.BoxSizer(wx.HORIZONTAL) sizer = wx.FlexGridSizer(2, 3, 9, 25) result = wx.StaticText(panel, label='Result') self.result_text = wx.TextCtrl(panel, style=wx.TE_MULTILINE) sizer.Add(result, 1, wx.EXPAND) sizer.Add(self.result_text, 1, wx.EXPAND) sizer.AddGrowableRow(0, 2) sizer.AddGrowableCol(1, 2) hbox.Add(sizer, proportion=1, flag=wx.ALL|wx.EXPAND, border=10) panel.SetSizer(hbox) self.init_string = '' self.Show() def pre_process(self, query_string): processed = '' query_string = query_string.split(' ') for word in query_string: if word not in stop_words: processed += word + ' ' return processed def compare(self, e): query_string = self.parent.note_text.GetValue() if self.init_string != query_string: self.search(e) self.init_string = query_string def search(self, e): database = xapian.Database(self.parent.db_path) enquire = xapian.Enquire(database) query_string = self.parent.note_text.GetValue() query_string = self.pre_process(query_string) qp = xapian.QueryParser() stemmer = xapian.Stem("english") qp.set_stemmer(stemmer) qp.set_database(database) qp.set_stemming_strategy(xapian.QueryParser.STEM_SOME) query = qp.parse_query(query_string) enquire.set_query(query) matches = enquire.get_mset(0, 10) final = '' for m in matches: final = final + m.document.get_data() + "\n" self.result_text.SetValue(final) class PassiveSearchThread(wx.Frame, Thread): def __init__(self, parent): Thread.__init__(self) self.parent = parent self.run() def run(self): p_search = PassiveSearchFrame(self.parent) if __name__ == '__main__': app = wx.App() NoteEntryFrame(None) app.MainLoop()
rew4332/tensorflow
tensorflow/contrib/slim/python/slim/evaluation.py
Python
apache-2.0
12,824
0.002963
# Copyright 2016 Google Inc. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Contains functions for evaluation and summarization of metrics. The evaluation.py module contains helper functions for evaluating TensorFlow modules using a variety of metrics and summarizing the results. ********************** * Evaluating Metrics * ********************** In the simplest use case, we use a model to create the predictions, then specify the metrics and finally call the `evaluation` method: # Create model and obtain the predictions: images, labels = LoadData(...) predictions = MyModel(images) # Choose the metrics to compute: names_to_values, names_to_updates = slim.metrics.aggregate_metric_map({ "accuracy": slim.metrics.accuracy(predictions, labels), "mse": slim.metrics.mean_squared_error(predictions, labels), }) init_op = tf.group( tf.initialize_all_variables(), tf.initialize_local_variables()) with tf.Session() as sess: metric_values = slim.evaluation( sess, num_evals=1, init_op=init_op, eval_op=names_to_updates.values(), final_op=name_to_values.values()) for metric, value in zip(names_to_values.keys(), metric_values): logging.info('Metric %s has value: %f', metric, value) ************************************************ * Evaluating a Checkpointed Model with Metrics * ************************************************ Often, one wants to evaluate a model checkpoint saved on disk. This can be performed once or repeatedly on a set schedule. To evaluate a particular model, users define zero or more metrics and zero or more summaries and call the evaluation_l
oop method: # Create model and obtain the predictions: images, labels = LoadData(...) predictions = MyModel(images)
# Choose the metrics to compute: names_to_values, names_to_updates = slim.metrics.aggregate_metric_map({ "accuracy": slim.metrics.accuracy(predictions, labels), "mse": slim.metrics.mean_squared_error(predictions, labels), }) # Define the summaries to write: for metric_name, metric_value in metrics_to_values.iteritems(): tf.scalar_summary(metric_name, metric_value) checkpoint_dir = '/tmp/my_model_dir/' log_dir = '/tmp/my_model_eval/' # We'll evaluate 1000 batches: num_evals = 1000 # Evaluate every 10 minutes: slim.evaluation_loop( master='', checkpoint_dir, logdir, num_evals=num_evals, eval_op=names_to_updates.values(), summary_op=tf.merge_summary(summary_ops), eval_interval_secs=600) ************************************************** * Evaluating a Checkpointed Model with Summaries * ************************************************** At times, an evaluation can be performed without metrics at all but rather with only summaries. The user need only leave out the 'eval_op' argument: # Create model and obtain the predictions: images, labels = LoadData(...) predictions = MyModel(images) # Define the summaries to write: tf.scalar_summary(...) tf.histogram_summary(...) checkpoint_dir = '/tmp/my_model_dir/' log_dir = '/tmp/my_model_eval/' # Evaluate once every 10 minutes. slim.evaluation_loop( master='', checkpoint_dir, logdir, num_evals=1, summary_op=tf.merge_summary(summary_ops), eval_interval_secs=600) """ from __future__ import absolute_import from __future__ import division from __future__ import print_function import time from tensorflow.contrib.framework.python.ops import variables from tensorflow.python.framework import ops from tensorflow.python.ops import control_flow_ops from tensorflow.python.ops import data_flow_ops from tensorflow.python.ops import logging_ops from tensorflow.python.ops import variables as tf_variables from tensorflow.python.platform import tf_logging as logging from tensorflow.python.training import saver as tf_saver from tensorflow.python.training import summary_io from tensorflow.python.training import supervisor from tensorflow.python.training import training_util __all__ = ['evaluation', 'evaluation_loop', 'wait_for_new_checkpoint'] def wait_for_new_checkpoint(checkpoint_dir, last_checkpoint, seconds_to_sleep=1, timeout=None): """Waits until a new checkpoint file is found. Args: checkpoint_dir: The directory in which checkpoints are saved. last_checkpoint: The last checkpoint path used. seconds_to_sleep: The number of seconds to sleep for before looking for a new checkpoint. timeout: The maximum amount of time to wait. If left as `None`, then the process will wait indefinitely. Returns: a new checkpoint path, or None if the timeout was reached. """ stop_time = time.time() + timeout if timeout is not None else None while True: checkpoint_path = tf_saver.latest_checkpoint(checkpoint_dir) if checkpoint_path is None or checkpoint_path == last_checkpoint: if stop_time is not None and time.time() + seconds_to_sleep > stop_time: return None time.sleep(seconds_to_sleep) else: return checkpoint_path def evaluation(sess, num_evals=1, init_op=None, init_op_feed_dict=None, eval_op=None, eval_op_feed_dict=None, final_op=None, final_op_feed_dict=None, summary_op=None, summary_op_feed_dict=None, summary_writer=None, global_step=None): """Performs a single evaluation run. A single evaluation consists of several steps run in the following order: (1) an initialization op, (2) an evaluation op which is executed `num_evals` times (3) a finalization op and (4) the execution of a summary op which is written out using a summary writer. Args: sess: The current TensorFlow `Session`. num_evals: The number of times to execute `eval_op`. init_op: An operation run at the beginning of evaluation. init_op_feed_dict: A feed dictionary to use when executing `init_op`. eval_op: A operation run `num_evals` times. eval_op_feed_dict: The feed dictionary to use when executing the `eval_op`. final_op: An operation to execute after all of the `eval_op` executions. The value of `final_op` is returned. final_op_feed_dict: A feed dictionary to use when executing `final_op`. summary_op: A summary op executed after `eval_op` and `finalize_op`. summary_op_feed_dict: An optional feed dictionary to use when executing the `summary_op`. summary_writer: The summery writer used if `summary_op` is provided. global_step: the global step variable. If left as `None`, then slim.variables.global_step() is used. Returns: The value of `final_op` or `None` if `final_op` is `None`. Raises: ValueError: if `summary_op` is provided but `global_step` is `None`. """ if init_op is not None: logging.info('Executing init op') sess.run(init_op, init_op_feed_dict) if eval_op is not None: logging.info('Executing eval ops') for i in range(int(num_evals)): logging.info('Executing eval_op %d/%d', i + 1, num_evals) sess.run(eval_op, eval_op_feed_dict) if final_op is not None: logging.info('Executing final op') final_op_value = sess.run(final_op, final_op_feed_dict) else: final_op_value = None if summary_op is not None: logging.info('Executing summary op') if global_step is None: gl
cjaymes/pyscap
src/scap/model/oval_5/defs/linux/SystemDUnitDependencyStateElement.py
Python
gpl-3.0
1,172
0.00256
# Copyright 2016 Casey Jaymes # This file is part of PySCAP. # # PySCAP is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # PySCAP is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR P
URPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with PySCAP. If not, see <http://www.gnu.org/licenses/>. import logging from scap.model.oval_5.defs.linux.StateType import StateType logger = logging.getLogger(__name__) class SystemDUnitDependencyStateElement(StateType): MODEL_MAP = { 'tag_name': 'systemdunitdependency_state',
'elements': [ {'tag_name': 'unit', 'class': 'scap.model.oval_5.defs.EntityStateType', 'min': 0, 'max': 1}, {'tag_name': 'dependency', 'class': 'scap.model.oval_5.defs.EntityStateType', 'min': 0, 'max': 1}, ], }
OxPython/Python_float_round
src/digit_precision_float.py
Python
epl-1.0
432
0.006977
#!/usr/bin/env
python # -*- coding: utf-8 -*- ''' Created on Jul 16, 2014 @author: anroco How to define the number of decimal digits of a float in Python? ¿Cómo definir la cantidad de digitos decimales de
un float en Python? ''' #crate a float number f = 13.9497389867 print(f) #this method rounded to the number of digits defined after the decimal point. print(round(f, 2)) #define 4 digits of precision print(round(f, 4))
IllinoisRoboticsInSpace/Arduino_Control
RemoteControl/Move.py
Python
mit
675
0.056296
from ArduinoSerial import sendData, beginTransmission import serial import time import atexit ser = serial.Serial("/dev/ttyACM0",115200) ser.flushInput() #The next five lines allow the motors to stop once the ctrl+c command is given to abort the program. def exit_handler(): sendData(ser,1,0) sendData(ser,2,0) atexit.regis
ter(exit_handler) if ser.is_open: beginTransmission(ser) else: print("Serial Closed") square = [(100,100),(100,-100),(100,100),(100,-100),(100,100),(100,-100),(100,100),(100,-100),(0,0)] #This should create a square for cmd in squ
are: sendData(ser, 1, cmd[0]) #This sends the commands to arduino, for each motor sendData(ser, 2, cmd[1])
zouzhberk/ambaridemo
demo-server/src/main/resources/stacks/HDP/2.1.GlusterFS/services/YARN/package/scripts/application_timeline_server.py
Python
apache-2.0
1,573
0.006357
""" Licensed to the Apache Software Foundation (ASF) under one or more contributor license agreements. See the NOTICE file distributed with this work for additional information regarding copyright ownership. The ASF licenses this file to you under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. Ambari Agent """ import sys from resource_management import * from yarn import yarn from service import service class ApplicationTimelineServer(Script): def install(self, env): self.install_packages(env) #self.configure(env) def configure(s
elf, env): import params env.set_params(params) yarn() def start(self, env): import params env.set_params(params) self.configure(env) # FOR SECURITY service('historyserver', action='start') def stop(self, env): import params env.set_params(params) service('historyserver', action='stop') def status(self, env): import status_params env.set_params(status_params) check_process_status(status_params.yarn
_historyserver_pid_file) if __name__ == "__main__": ApplicationTimelineServer().execute()
yourlabs/django-cities-light
src/cities_light/tests/test_update.py
Python
mit
5,691
0
"""Tests for update records.""" import unittest from dbdiff.fixture import Fixture from .base import TestImportBase, FixtureDir class TestUpdate(TestImportBase): """Tests update procedure.""" def test_update_fields(self): """Test all fields are updated.""" fixture_dir = FixtureDir('update') self.import_data( fixture_dir, 'initial_country', 'initial_region', 'initial_subregion', 'initial_city', 'initial_translations' ) self.import_data( fixture_dir, 'update_country', 'update_region', 'update_subregion', 'update_city', 'update_translations', ) Fixture( fixture_dir.get_file_path('update_fields.json') ).assertNoDiff() def test_update_fields_wrong_timezone(self): """Test all fields are updated, but timezone field is wrong.""" fixture_dir = FixtureDir('update') self.import_data( fixture_dir, 'initial_country', 'initial_region', 'initial_subregion', 'initial_city', 'initial_translations' ) self.import_data( fixture_dir, 'update_country', 'update_region', 'update_subregion', 'update_city_wtz', 'update_translations', ) Fixture( fixture_dir.get_file_path('update_fields_wtz.json') ).assertNoDiff() def test_change_country(self): """Test change country for region/city.""" fixture_dir = FixtureDir('update') self.import_data( fixture_dir, 'initial_country', 'initial_region', 'initial_subregion', 'initial_city', 'initial_translations' ) self.import_data( fixture_dir, 'change_country', 'update_region', 'update_subregion', 'update_city', 'update_translations', ) Fixture( fixture_dir.get_file_path('change_country.json') ).assertNoDiff() def test_change_region_and_country(self): """Test change region and country.""" fixture_dir = FixtureDir('update') self.import_data( fixture_dir, 'initial_country', 'initial_region', 'initial_subregion', 'initial_city', 'initial_translations' ) self.import_data( fixture_dir, 'change_country', 'change_region', 'update_subregion', 'update_city', 'update_translations', ) Fixture( fixture_dir.get_file_path('change_region_and_country.json') ).assertNoDiff() def test_keep_slugs(self): """Test --keep-slugs option.""" fixture_dir = FixtureDir('update') self.import_data( fixture_dir, 'initial_country', 'initial_region', 'initial_subregion', 'initial_city', 'initial_translations' ) self.import_data( fixture_dir, 'update_country', 'update_region', 'update_subregion', 'update_city', 'update_translations', keep_slugs=True ) Fixture( fixture_dir.get_file_path('keep_slugs.json'), ).assertNoDiff() def test_add_records(self): """Test that new records are added.""" fixture_dir = FixtureDir('update')
self.import_data( fixture_dir, 'initial_country', 'initial_region', 'initial_subregion', 'initial_city', 'initial_translations' ) self.import_data( fixture_dir, 'add_country', 'add_region', 'add_subregion', 'add_city', 'add_translations' )
Fixture( fixture_dir.get_file_path('add_records.json') ).assertNoDiff() def test_noinsert(self): """Test --noinsert option.""" fixture_dir = FixtureDir('update') self.import_data( fixture_dir, 'initial_country', 'initial_region', 'initial_subregion', 'initial_city', 'initial_translations' ) self.import_data( fixture_dir, 'add_country', 'add_region', 'add_subregion', 'add_city', 'add_translations', noinsert=True ) Fixture( fixture_dir.get_file_path('noinsert.json'), ).assertNoDiff() # TODO: make the test pass @unittest.skip("Obsolete records are not removed yet.") def test_remove_records(self): """Test that obsolete records are removed.""" fixture_dir = FixtureDir('update') self.import_data( fixture_dir, 'remove_initial_country', 'remove_initial_region', 'remove_initial_subregion', 'remove_initial_city', 'remove_initial_translations' ) self.import_data( fixture_dir, 'remove_country', 'remove_region', 'remove_subregion', 'remove_city', 'remove_translations' ) Fixture( fixture_dir.get_file_path('remove_records.json') ).assertNoDiff()
brain461/ar_too
ar_too/__init__.py
Python
apache-2.0
197
0.005076
# -*- coding: utf-8 -*- from .api import get_artifactory_config_from_url
, update_ldapSettings_from_
dict, update_artifactory_config, cr_repository, update_password, get_repo_configs, get_repo_list
kevin-coder/tensorflow-fork
tensorflow/python/compiler/tensorrt/test/batch_matmul_test.py
Python
apache-2.0
3,185
0.002826
# Copyright 2018 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Model script to test TF-TensorRT integration.""" from __future__ import abso
lute_import from __future__ import division from __future__ import print_function import numpy as np from tensorflow.python.compiler.tensorrt.test import tf_trt_integration_test_base as trt_test from tensorflow.python.framework import constant_op from tensorflow.python.framework import dtypes from tensorflow.python.framework import ops from tensorfl
ow.python.ops import array_ops from tensorflow.python.ops import gen_array_ops from tensorflow.python.ops import math_ops from tensorflow.python.platform import test class BatchMatMulTest(trt_test.TfTrtIntegrationTestBase): def GetParams(self): """Testing conversion of BatchMatMul in TF-TRT conversion.""" dtype = dtypes.float32 input_name = "input" input_dims = [12, 5, 8, 12] output_name = "output" w1_name = "matmul_w1" w1_dims = [12, 5, 12, 7] w2_name = "matmul_w2" w2_dims = [12, 12, 7] g = ops.Graph() with g.as_default(): inp = array_ops.placeholder( dtype=dtype, shape=[None] + input_dims[1:], name=input_name) w1 = array_ops.placeholder(dtype=dtype, shape=w1_dims, name=w1_name) w2 = array_ops.placeholder(dtype=dtype, shape=w2_dims, name=w2_name) with g.device("/GPU:0"): b = constant_op.constant(np.random.randn(12, 5, 12, 7), dtype=dtype) x1 = math_ops.matmul(inp, b) c = constant_op.constant(np.random.randn(5, 1, 1), dtype=dtype) x1 = x1 + c x2 = math_ops.matmul(inp, w1) d = constant_op.constant(np.random.randn(5, 1, 1), dtype=dtype) x2 = x2 * d e = self.trt_incompatible_op(inp) e = gen_array_ops.reshape(e, [12, 40, 12]) x3 = math_ops.matmul(e, w2) f = constant_op.constant(np.random.randn(40, 1), dtype=dtype) x3 = x3 + f x3 = gen_array_ops.reshape(x3, [12, 5, 8, 7]) x3 = self.trt_incompatible_op(x3) out = x1 + x2 + x3 array_ops.squeeze(out, name=output_name) return trt_test.TfTrtIntegrationTestParams( gdef=g.as_graph_def(add_shapes=True), input_names=[input_name, w1_name, w2_name], input_dims=[[input_dims, w1_dims, w2_dims]], output_names=[output_name], expected_output_dims=[[[12, 5, 8, 7]]]) def ExpectedEnginesToBuild(self, run_params): """Return the expected engines to build.""" return ["TRTEngineOp_0", "TRTEngineOp_1"] if __name__ == "__main__": test.main()
pr2git/e2openplugin-OpenWebif
plugin/__init__.py
Python
gpl-3.0
509
0.011788
# -*- c
oding: utf-8 -*- from Components.Language import language from Tools.Directories import resolveFilename, SCOPE_PLUGINS import gettext PluginLanguageDomain = "OpenWebif" PluginLanguagePath = "Extensions/OpenWebif/locale" def localeInit(): gettext.bindtextdomain(PluginLanguageDomain, resolveFilename(SCOPE_PLUGINS, PluginLanguagePath)) def _(txt): t = gettext.dgettext(PluginLanguageDomain, txt) if t == txt: t = gettext.gettext(txt) return t localeInit() language.
addCallback(localeInit)
rapirent/toc_project
kuoteng_bot/kuoteng_bot/urls.py
Python
mit
972
0.002058
"""kuoteng_bot URL Configuration The `urlpatterns` list routes URLs to views. For more information please see: https://docs.djangoproject.com/en/1.11/topics/http/urls/ Examples: Function views 1. Add an import: from my_app import views
2. Add a URL to urlpatterns: url(r'^$', views.home, name='home') Class-based views 1. Add an import: from other_app.views import Home 2. Add a URL to urlpatterns: url(r'^$', Home.as_view(), name='home') Including another URLconf 1. Import the include() function: from django.conf.urls import url, include 2. Add a URL to urlpatterns: url(r'^blog/', include('blog.urls')) """ from django.conf.urls import url, include from django.contrib import a
dmin from django.conf import settings #from telegram_bot.views import _set_webhook urlpatterns = [ url(r'^admin/', admin.site.urls), url(r'^bot/', include('telegram_bot.urls')), url(r'^', include('django_telegrambot.urls')), ] #_set_webhook()
Peter-Collins/NormalForm
src/py/CoordinateChange.py
Python
gpl-2.0
3,820
0.003141
""" AUTHOR: Dr. Andrew David Burbanks, 2005 This software is Copyright (C) 2004-2008 Bristol University and is released under the GNU General Public License version 2. MODULE: CoordinateChange PURPOSE: Compute the coo
rdinate changes relating complex diagonal to complex nor
mal form coordinates. NOTES: For parallel computation, one can specify for which variable index we want to compute the coordinate change. """ # parallel; we specify the index that we wish to compute. from Polynomial import Polynomial from IsogradeInnerTaylorCoeffs import IsogradeInnerTaylorCoeffs from Utility import binomial, factorial from LieTriangle import _make_db_key class CoordinateChange: """ This class is responsible for taking scalar functions written in one set of variables (either the diagonal complex or normal form complex) and expressing them in terms of the other set of variables, making use of the generating function that was computed during the normalization procedure. In particular, it can be used to express the coordinates themselves (via the scalar function projecting onto each coordinate value) in the other coordinate system, thereby computing the coordinate-change maps as vectors of polynomials. """ def __init__(self, lie_alg, w_i_list): self._alg = lie_alg self._w_i = w_i_list self._iso = IsogradeInnerTaylorCoeffs(self._alg, offset=1) #1 def get_isograde_list_handler(self): return self._iso def triangle_diag_in_norm(self, i, j): """ Express scalar function of diagonal coordinates in terms of normal form coordinates. """ db_key = _make_db_key(i, j) bracket = self._alg.bracket if self._x_ij.has_key(db_key): pass else: if (j == 0): self._x_ij[db_key] = self._iso.poly_to_inner_taylor(self._f, i) else: temp = self.triangle_diag_in_norm(i+1, j-1).copy() for k in xrange(0, i+1): if (i+1-k) >= len(self._w_i): assert 0, 'out of range, (k+1)=%d'%(k+1) else: w_term = self._w_i[i+1-k] temp += binomial(i, k) * bracket(self.triangle_diag_in_norm(k, j-1), w_term) self._x_ij[db_key] = temp return self._x_ij[db_key] def express_diag_in_norm(self, f, x_i_list, x_ij_dict, n): self._f = f self._x_i = x_i_list self._x_ij = x_ij_dict for i in xrange(0, n + 1): self._x_i.append(self.triangle_diag_in_norm(0, i)) def triangle_norm_in_diag(self, i, j): """ Express normal form coordinate expression in terms of diagonal coordinates. """ db_key = _make_db_key(i, j) bracket = self._alg.bracket if self._x_ij.has_key(db_key): pass else: if (i == 0): self._x_ij[db_key] = self._iso.poly_to_inner_taylor(self._f, j) else: temp = self.triangle_norm_in_diag(i-1, j+1).copy() for k in xrange(0, i): if (k+1) >= len(self._w_i): assert 0, 'out of range, (k+1)=%d'%(k+1) else: w_term = self._w_i[k+1] temp -= binomial(i-1, k) * bracket(self.triangle_norm_in_diag(i-k-1, j), w_term) #NOTE: MUST BE MINUS!!! self._x_ij[db_key] = temp return self._x_ij[db_key] def express_norm_in_diag(self, f, x_i_list, x_ij_dict, n): self._f = f self._x_i = x_i_list self._x_ij = x_ij_dict for i in xrange(0, n + 1): self._x_i.append(self.triangle_norm_in_diag(i, 0))
google-research/episodic-curiosity
third_party/gym/ant_wrapper_test.py
Python
apache-2.0
2,294
0.001308
# coding=utf-8 # The MIT License # # Copyright (c) 2016 OpenAI (https://openai.com) # Copyright (c) 2018 The TF-Agents Authors. # Copyright (c) 2018 Google LLC (http://google.com) # # Permission is hereby granted, free of charge, to any person obtaining a copy # of this software and associated documentation files (the "Software"), to deal # in the Software without restriction, including without limitation the rights # to use, copy, modify, merge, publish, distribute, sublicense, and/or sell # copies of the Software, and to permit persons to whom the Software is # furnishe
d to do so, subject to the following conditions: # # The above copyright notice and this permission notice shall be included in # all copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLI
ED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE # AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWIS, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN # THE SOFTWARE. """Tests for google3.third_party.py.third_party.gym.ant_wrapper.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function import os from third_party.gym import ant_wrapper from google3.pyglib import resources from google3.testing.pybase import googletest ASSETS_DIR = 'google3/third_party/py/third_party.gym/assets' def get_resource(filename): return resources.GetResourceFilenameInDirectoryTree( os.path.join(ASSETS_DIR, filename)) class AntWrapperTest(googletest.TestCase): def test_ant_wrapper(self): env = ant_wrapper.AntWrapper( get_resource('mujoco_ant_custom_texture_camerav2.xml'), texture_mode='fixed', texture_file_pattern=get_resource('texture.png')) env.reset() obs, unused_reward, unused_done, info = env.step(env.action_space.sample()) self.assertEqual(obs.shape, (27,)) self.assertIn('frame', info) self.assertEqual(info['frame'].shape, (120, 160, 3)) if __name__ == '__main__': googletest.main()
ActivisionGameScience/assertpy
tests/test_same_as.py
Python
bsd-3-clause
2,899
0.008624
# Copyright (c) 2015-2019, Activision Publishing, Inc. # All rights reserved. # # Redistribution and use in source and binary forms, with or without modification, # are permitted provided that the following conditions are met: # # 1. Redistributions of source code must retain the above copyright notice, this # list of conditions and the following disclaimer. # # 2. Redistributions in binary form must reproduce the above copyright notice, # this list of conditions and the following disclaimer in the documentation # and/or other materials provided with the distribution. # # 3. Neither the name of the copyright holder nor the names of its contributors # may be used to endorse or prom
ote products derived from this software without # specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND # ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMIT
ED TO, THE IMPLIED # WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE # DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE FOR # ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES # (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; # LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON # ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT # (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS # SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. import sys from assertpy import assert_that, fail def test_is_same_as(): for obj in [object(), 1, 'foo', True, None, 123.456]: assert_that(obj).is_same_as(obj) def test_is_same_as_failure(): try: obj = object() other = object() assert_that(obj).is_same_as(other) fail('should have raised error') except AssertionError as ex: assert_that(str(ex)).matches('Expected <.+> to be identical to <.+>, but was not.') def test_is_not_same_as(): obj = object() other = object() assert_that(obj).is_not_same_as(other) assert_that(obj).is_not_same_as(1) assert_that(obj).is_not_same_as(True) assert_that(1).is_not_same_as(2) assert_that({'a':1}).is_not_same_as({'a':1}) assert_that([1,2,3]).is_not_same_as([1,2,3]) if sys.version_info[0] == 3 and sys.version_info[1] >= 7: assert_that((1,2,3)).is_same_as((1,2,3)) # tuples are identical in py 3.7 else: assert_that((1,2,3)).is_not_same_as((1,2,3)) def test_is_not_same_as_failure(): for obj in [object(), 1, 'foo', True, None, 123.456]: try: assert_that(obj).is_not_same_as(obj) fail('should have raised error') except AssertionError as ex: assert_that(str(ex)).matches('Expected <.+> to be not identical to <.+>, but was.')
sebrandon1/neutron
neutron/extensions/providernet.py
Python
apache-2.0
3,608
0
# Copyright (c) 2012 OpenStack Foundation. # All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. from neutron_lib.api import converters from neutron_lib.api import validators from neutron_lib import constants from neutron_lib import exceptions as n_exc from neutron._i18n import _ from neutron.api import extensions NETWORK_TYPE = 'provider:network_type' PHYSICAL_NETWORK = 'provider:physical_network' SEGMENTATION_ID = 'provider:segmentation_id' ATTRIBUTES = (NETWORK_TYPE, PHYSICAL_NETWORK, SEGMENTATION_ID) # Common definitions for maximum string field length NETWORK_TYPE_MAX_LEN = 32 PHYSICAL_NETWORK_MAX_LEN = 64 EXTENDED_ATTRIBUTES_2_0 = { 'networks': { NETWORK_TYPE: {'allow_post': True, 'allow_put': True, 'validate': {'type:string': NETWORK_TYPE_MAX_LEN}, 'default': constants.ATTR_NOT_SPECIFIED, 'enforce_policy': True, 'is_visible': True}, PHYSICAL_NETWORK: {'allow_post': True, 'allow_put': True, 'validate': {'type:string': PHYSICAL_NETWORK_MAX_LEN}, 'default': constants.ATTR_NOT_SPECIFIED, 'enforce_policy': True, 'is_visible': True}, SEGMENTATION_ID: {'allow_post': True, 'allow_put': True, 'convert_to': converters.convert_to_int, 'enforce_policy': True, 'default': constants.ATTR_NOT_SPECIFIED, 'is_visible': True}, } } def _raise_if_updates_provider_attributes(attrs): """Raise exception if provider attributes are present. This method is used for plugins that do not support updating provider networks. """ if any(validators.is_attr_set(attrs.get(a)) for a in ATTRIBUTES): msg = _("Plugin does not support updating provider attributes") raise n_exc.InvalidInput(error_message=msg) class Provi
dernet(extensions.ExtensionDescriptor): """Extension class supporting provider networks. This class is used by neutron's extension framework to make metadata about the provider network extension available to clients. No new resources are defined by this extension. Instead, the existing network resource's request and response messages are extended with attributes in the provider namespace. With admin rights, network dictionaries returned will al
so include provider attributes. """ @classmethod def get_name(cls): return "Provider Network" @classmethod def get_alias(cls): return "provider" @classmethod def get_description(cls): return "Expose mapping of virtual networks to physical networks" @classmethod def get_updated(cls): return "2012-09-07T10:00:00-00:00" def get_extended_resources(self, version): if version == "2.0": return EXTENDED_ATTRIBUTES_2_0 else: return {}
thdb-theo/Zombie-Survival
src/pickup.py
Python
mit
3,543
0.001411
from functools import partial from random import random, randint, choice import pygame import init as _ from baseclass import BaseClass from options import Options try: from cython_ import collide except ImportError: from python_ import collide from miscellaneous import further_than, scale from tile import Tile class PickUp(BaseClass): """Creates a PickUp Params: x: x coordinate of the PickUp y: y coordinate of the PickUp spawn_tile: The index of the tile on which the PickUp is type_: A float between 0 and 1. If it is over 2/3 the PickUp is ammo else health Example: >>> tile = Tile.instances[PickUp.spawn_tiles[0]] >>> a = PickUp(*tile.pos, PickUp.spawn_tiles[0], type_=0.9) >>> a.type "health" TODO: Add more pick ups""" with open(Options.mappath) as file: spawn_tiles = [ i for i, x in enumerate(file.read().replace("\n", "")) if x == "P" ] init_round, left_round = 4, 4 zombie_init_round = None images = {"ammo": scale(pygame.image.load("assets/Images/PickUps/ammo.png")), "health": scale(pygame.image.load("assets/Images/PickUps/health.png"))} sounds = {"ammo": pygame.mixer.Sound("assets/Audio/PickUp/ammo_short.ogg"), "health": pygame.mixer.Sound("assets/Audio/PickUp/health.ogg")} sounds["ammo"].set_volume(Options.volume) sounds["health"].set_volume(Options.volume) instances = set() def __init__(self, x, y, spawn_tile, type_): super().__init__(x, y) PickUp.instances.add(self) self.incr = randint(20, 35) self.spawn_tile = spawn_tile self.type = "ammo" if type_ < 2 / 3 else "health" PickUp.spawn_tiles.remove(spawn
_tile) @classmethod def spawn(cls, survivor): _further_than = partial(further_than, survivor=survivor, min_dist=150) pos_spawn_tiles = list(filter(_further_than, cls.spawn_tiles)) if not pos_spa
wn_tiles: # If no pick-up spawn is far enough away if not cls.spawn_tiles: # If all pick-up spawns are occupied, don"t spawn return pos_spawn_tiles.extend(cls.spawn_tiles) cls.left_round -= 1 type_ = random() spawn_tile = choice(pos_spawn_tiles) spawn_node = Tile.instances[spawn_tile] cls(*spawn_node.pos, spawn_tile, type_) @classmethod def update(cls, screen, survivor, total_frames): if cls.left_round: try: if total_frames % ((Options.fps * cls.zombie_init_round * 2) // cls.init_round) == 0: cls.spawn(survivor) except ZeroDivisionError: if total_frames % Options.fps * 10 == 0: cls.spawn(survivor) del_pick_up = set() for pick_up in cls.instances: screen.blit(cls.images[pick_up.type], pick_up.pos.as_ints()) if collide(*pick_up.pos, *pick_up._size, *survivor.pos, *survivor._size): setattr(survivor, pick_up.type, getattr(survivor, pick_up.type) + pick_up.incr) cls.sounds[pick_up.type].play() cls.spawn_tiles.append(pick_up.spawn_tile) del_pick_up.add(pick_up) del pick_up cls.instances -= del_pick_up if __name__ == "__main__": Tile.create() import doctest doctest.testmod()
alexwlchan/python-taskpaper
test/test_item.py
Python
mit
3,541
0
# -*- encoding: utf-8 -*- from hypothesis import given from hypothesis.strategies import integers, lists import pytest from taskpaper import TaskPaperItem, TaskPaperError from utils import taskpaper_item_strategy @given(integers()) def test_setting_tab_size(tab_size): """We can set the tab size on TaskPaperItem.""" item = TaskPaperItem('hello world', tab_size=tab_size) assert item.tab_size == tab_size class TestParentChildRelationship(object): """ Tests of the parent-child relationship between items. """ def test_default_parent_is_none(self): """By default, a task does not have a parent.""" item = TaskPaperItem('hello world') assert item.parent is None def test_default_task_has_no_children(self): """By default, a task has no children.""" item = TaskPaperItem('hello world') assert item.children == [] def test_setting_a_parent(self): """Test we can initialize an item with a parent.""" item_p = TaskPaperItem('parent') item_c = TaskPaperItem('child', parent=item_p) assert item_c.parent == item_p assert item_p.children == [item_c] def test_updating_a_parent(self): """Test we can create an item with a parent, then change the parent.""" item_p1 = TaskPaperItem('parent1') item_p2 = TaskPaperItem('parent2') item_c = TaskPaperItem('child', parent=item_p1) item_c.parent = item_p2 assert item_c.parent == item_p2 assert item_p2.children == [item_c] assert item_p1.children == [] def test_updating_to_same_parent(self): """ Create an item with a parent, change the parent to existing parent, check nothing happens. """ item_p = TaskPaperItem('parent') item_c = TaskPaperItem('child', parent=item_p) item_c.parent == item_p assert item_c.parent == item_p assert item_p.children == [item_c] def test_removing_a_parent(self): """
Create an item with a parent, then set the parent to None. Check the child is removed from the list of its previous parents' children. """ item_p = TaskPaperItem('parent') item_c = TaskPaperItem('child', parent=
item_p) item_c.parent = None assert item_c.parent is None assert item_p.children == [] def test_detect_item_cannot_be_its_parents_parent(self): """ An item cannot be the parent of its own parent. """ item_p = TaskPaperItem('parent') item_c = TaskPaperItem('child', parent=item_p) with pytest.raises(TaskPaperError): item_p.parent = item_c @given(lists(taskpaper_item_strategy(), min_size=2)) def test_detecting_circular_chain(self, items): """ We detect an arbitrarily long circular parent chain. """ # Create a chain of parent-child relationships # items[0] -> items[1] -> ... -> items[n] for idx, alt_item in enumerate(items[1:], start=1): items[idx-1].parent = alt_item # Now make the first item the parent of the last, and check we # get an exception. with pytest.raises(TaskPaperError): items[-1].parent = items[0] def test_an_item_cannot_be_its_own_parent(self): """ An item cannot be its own parent. """ item = TaskPaperItem('hello world') with pytest.raises(TaskPaperError): item.parent = item
mkmeral/TevitolApplication
application/backend/application/views.py
Python
gpl-3.0
2,676
0.00299
from rest_framework.decorators import api_view from rest_framework.response import Response from django.contrib.auth.models import User from application.serializers import UserSerializer, ApplicationSerializer, ApplicationListSerializer from rest_framework import viewsets, status from application.models import Application, validate_tc from django.core.exceptions import ValidationError from django.contrib.auth.models import User from django.http import Http404 from rest_framework import permissions from rest_framework import generics from rest_framework.views import APIView from rest_framework.parsers import FileUploadParser class ApplicationList(APIView): def get(self, request, format=None): applications = Application.objects.all() serializer = ApplicationListSerializer(applications, many=True) return Response(serializer.data) class ApplicationDetail(APIView): def get_object(self, pk): try: return Application.objects.get(pk=pk)
except Application.DoesNotExist: raise Http404 def get(self, request, pk, form
at=None): applications = self.get_object(pk) serializer = ApplicationSerializer(applications) return Response(serializer.data) def put(self, request, pk, format=None): application = self.get_object(pk) serializer = ApplicationSerializer(application, data=request.data) if serializer.is_valid(): serializer.save() return Response(serializer.data) return Response(serializer.errors, status=status.HTTP_400_BAD_REQUEST) def delete(self, request, pk, format=None): application = self.get_object(pk) application.delete() return Response(status=status.HTTP_204_NO_CONTENT) class ApplicationCreate(APIView): def post(self, request): serializer = UserSerializer(data=request.data) if serializer.is_valid(): serializer.save() Application.objects.create(user=User.objects.get(pk=serializer.data['id'])) return Response(serializer.data) class FileUpload(APIView): parser_classes = (FileUploadParser,) def post(self, request, format=None): file_obj = request.FILES['file'] # do some stuff with uploaded file return Response(status=204) @api_view(['GET']) def tc_validator(request, tc): if len(User.objects.filter(username=tc)) != 0: return Response({'tc': tc}, status=status.HTTP_302_FOUND) try: validate_tc(tc) return Response({'tc': tc}, status=status.HTTP_200_OK) except: return Response({'tc': tc}, status=status.HTTP_400_BAD_REQUEST)
Xinglab/rmats2sashimiplot
src/MISO/misopy/test_miso.py
Python
gpl-2.0
7,024
0.002847
#!/usr/bin/env python import os import sys import unittest import pysam import sam_utils class TestMISO(unittest.TestCase): """ Test MISO functionality. """ def setUp(self): # Find out the current directory self.miso_path = \ os.path.dirname(os.path.abspath(os.path.expanduser(__file__))) self.tests_data_dir = \ os.path.join(self.miso_path, "test-data") self.events_analysis_cmd = "miso" self.tests_output_dir = \ os.path.join(self.miso_path, "test-output") self.test_sam_filename = \ os.path.join(self.tests_data_dir, "sam-data", "c2c12.Atp2b1.sam") self.gff_events_dir = \ os.path.join(self.miso_path, "gff-events") self.sam_to_bam_script = "sam_to_bam" self.index_gff_script = "index_gff" def test_a_sam_to_bam(self): """ Test conversion of SAM to BAM. The 'a' ensures this runs first. """ print "Testing conversion of SAM to BAM..." output_dir = \ os.path.join(self.tests_output_dir, "sam-output") sam_to_bam_cmd = \ "%s --convert %s %s" %(self.sam_to_bam_script, self.test_sam_filename, output_dir) print "Executing: %s" %(sam_to_bam_cmd) os.system(sam_to_bam_cmd) # Make sure conversion worked; sorted, indexed BAM file is outputted assert(os.path.exists(os.path.join(output_dir, "c2c12.Atp2b1.sorted.bam"))) def test_a2_strandedness(self): """ Test that strandedness is read correctly. """ # Read 1 is forward, on plus strand # Has flag 129, i.e. '0b10000001' f_read = pysam.AlignedRead() f_read.qname = "f_read" f_read.flag = 129 f_read.rname = 9 f_read.pos = 4991443 # Read 2 is reverse, on minus strand # Has flag 81, i.e. '0b1010001' r_read = pysam.AlignedRead() r_read.qname = "r_read" r_read.flag = 81 r_read.rname = 9 r_read.pos = 4991578 # Test that we can read the BAM strand flag correctly assert(sam_utils.flag_to_strand(f_read.flag) == "+"), \ "Error in determining plus strand of read." assert(sam_utils.flag_to_strand(r_read.flag) == "-"), \ "Error in determining minus strand of read." ## ## Test stranded-ness rules ## # fr-unstranded, # fr-firststrand, plus_target_strand = "+" minus_target_strand = "-" # fr-unstranded: both strand reads should match # either target strand print "Testing fr-unstranded..." for curr_read in [f_read, r_read]: for target in [plus_target_strand, minus_target_strand]: print "Checking read ", curr_read.qname, " against ", target assert(sam_utils.read_matches_strand(curr_read, target, "fr-unstranded") == True), \ "Error checking strand of fr-unstranded." # fr-firststrand: forward read must match target strand, # i.e. +read matches +target, and -read matches -target # test +read print "Testing fr-firststrand..." assert(sam_utils.read_matches_strand(f_read, plus_target_strand, "fr-firststrand") == True), \
"+read must match +target under fr-firstrand
." assert(sam_utils.read_matches_strand(f_read, minus_target_strand, "fr-firststrand") == False), \ "+read must match +target under fr-firststrand." # test -read assert(sam_utils.read_matches_strand(r_read, plus_target_strand, "fr-firststrand") == False), \ "-read must match -target under fr-firststrand." assert(sam_utils.read_matches_strand(r_read, minus_target_strand, "fr-firststrand") == True), \ "-read must match -target under fr-firststrand." # Test fr-firststrand read pair pe = (300, 10) assert(sam_utils.read_matches_strand((f_read, r_read), plus_target_strand, "fr-firststrand", paired_end=pe) == True), \ "(+, -) must match +target under fr-firststrand." # If target strand is -, second read must match minus strand assert(sam_utils.read_matches_strand((f_read, r_read), minus_target_strand, "fr-firststrand", paired_end=pe) == True), \ "(+, -) must match -target under fr-firststrand." def test_z_gene_psi(self): """ Test gene-level Psi inferences using SAM/BAM reads. The 'z' ensures this runs last. """ print "Testing gene-level Psi..." sam_dir = os.path.join(self.tests_output_dir, "sam-output") bam_filename = os.path.join(sam_dir, "c2c12.Atp2b1.sorted.bam") read_len = 36 insert_mean = 250 insert_sd = 30 # First index the GFF of interest gff_filename = os.path.join(self.gff_events_dir, "mm9", "genes", "Atp2b1.mm9.gff") gff_index_dir = os.path.join(self.gff_events_dir, "mm9", "genes", "Atp2b1", "indexed") print "Testing GFF indexing of: %s" %(gff_filename) index_cmd = "%s --index %s %s" %(self.index_gff_script, gff_filename, gff_index_dir) print "Executing: %s" %(index_cmd) os.system(index_cmd) output_dir = os.path.join(self.tests_output_dir, "gene-psi-output") miso_cmd = "%s --run %s %s --output-dir %s --read-len %d " \ %(self.events_analysis_cmd, gff_index_dir, bam_filename, output_dir, read_len) print "Executing: %s" %(miso_cmd) os.system(miso_cmd) def main(): unittest.main() if __name__ == '__main__': main()
vamst/COSMOS2
cosmos/web/admin.py
Python
gpl-3.0
358
0.002793
# from .. import Workflow, Stage, Tas
k, TaskFile # # from flask.ext import admin # from flask.ext.admin.contrib import sqla # # # def add_cosmos_admin(flask_app, session): # adm = admin.Admin(flask_app, 'Flask Admin', base_template="admin_layout.html") # f
or m in [Workflow, Stage, Task, TaskFile]: # adm.add_view(sqla.ModelView(m, session))
jamiefolsom/edx-platform
lms/djangoapps/instructor_task/tests/test_tasks_helper.py
Python
agpl-3.0
61,734
0.003193
# -*- coding: utf-8 -*- """ Unit tests for LMS instructor-initiated background tasks helper functions. Tests that CSV grade report generation works with unicode emails. """ import ddt from mock import Mock, patch import tempfile from openedx.core.djangoapps.course_groups import cohorts import unicodecsv from django.core.urlresolvers import reverse from django.test.uti
ls import override_settings from capa.tests.response_xml_factory import MultipleChoiceResponseXMLFactory from certificates.models import CertificateStatuses from certificates.tests.factories import GeneratedCertificateFactory, CertificateWhitelistFactory from course_modes.models import CourseMode from courseware.tests.factories import InstructorFactory from instructor_task.tests.test_base import InstructorTaskCourseT
estCase, TestReportMixin, InstructorTaskModuleTestCase from openedx.core.djangoapps.course_groups.models import CourseUserGroupPartitionGroup from openedx.core.djangoapps.course_groups.tests.helpers import CohortFactory import openedx.core.djangoapps.user_api.course_tag.api as course_tag_api from openedx.core.djangoapps.user_api.partition_schemes import RandomUserPartitionScheme from shoppingcart.models import Order, PaidCourseRegistration, CourseRegistrationCode, Invoice, \ CourseRegistrationCodeInvoiceItem, InvoiceTransaction, Coupon from student.tests.factories import UserFactory, CourseModeFactory from student.models import CourseEnrollment, CourseEnrollmentAllowed, ManualEnrollmentAudit, ALLOWEDTOENROLL_TO_ENROLLED from verify_student.tests.factories import SoftwareSecurePhotoVerificationFactory from xmodule.modulestore.tests.factories import CourseFactory, ItemFactory from xmodule.partitions.partitions import Group, UserPartition from instructor_task.models import ReportStore from instructor_task.tasks_helper import ( cohort_students_and_upload, upload_problem_responses_csv, upload_grades_csv, upload_problem_grade_report, upload_students_csv, upload_may_enroll_csv, upload_enrollment_report, upload_exec_summary_report, generate_students_certificates, ) from openedx.core.djangoapps.util.testing import ContentGroupTestCase, TestConditionalContent @ddt.ddt class TestInstructorGradeReport(TestReportMixin, InstructorTaskCourseTestCase): """ Tests that CSV grade report generation works. """ def setUp(self): super(TestInstructorGradeReport, self).setUp() self.course = CourseFactory.create() @ddt.data([u'[email protected]', u'ni\[email protected]']) def test_unicode_emails(self, emails): """ Test that students with unicode characters in emails is handled. """ for i, email in enumerate(emails): self.create_student('student{0}'.format(i), email) self.current_task = Mock() self.current_task.update_state = Mock() with patch('instructor_task.tasks_helper._get_current_task') as mock_current_task: mock_current_task.return_value = self.current_task result = upload_grades_csv(None, None, self.course.id, None, 'graded') num_students = len(emails) self.assertDictContainsSubset({'attempted': num_students, 'succeeded': num_students, 'failed': 0}, result) @patch('instructor_task.tasks_helper._get_current_task') @patch('instructor_task.tasks_helper.iterate_grades_for') def test_grading_failure(self, mock_iterate_grades_for, _mock_current_task): """ Test that any grading errors are properly reported in the progress dict and uploaded to the report store. """ # mock an error response from `iterate_grades_for` mock_iterate_grades_for.return_value = [ (self.create_student('username', '[email protected]'), {}, 'Cannot grade student') ] result = upload_grades_csv(None, None, self.course.id, None, 'graded') self.assertDictContainsSubset({'attempted': 1, 'succeeded': 0, 'failed': 1}, result) report_store = ReportStore.from_config(config_name='GRADES_DOWNLOAD') self.assertTrue(any('grade_report_err' in item[0] for item in report_store.links_for(self.course.id))) def _verify_cell_data_for_user(self, username, course_id, column_header, expected_cell_content): """ Verify cell data in the grades CSV for a particular user. """ with patch('instructor_task.tasks_helper._get_current_task'): result = upload_grades_csv(None, None, course_id, None, 'graded') self.assertDictContainsSubset({'attempted': 2, 'succeeded': 2, 'failed': 0}, result) report_store = ReportStore.from_config(config_name='GRADES_DOWNLOAD') report_csv_filename = report_store.links_for(course_id)[0][0] with open(report_store.path_to(course_id, report_csv_filename)) as csv_file: for row in unicodecsv.DictReader(csv_file): if row.get('username') == username: self.assertEqual(row[column_header], expected_cell_content) def test_cohort_data_in_grading(self): """ Test that cohort data is included in grades csv if cohort configuration is enabled for course. """ cohort_groups = ['cohort 1', 'cohort 2'] course = CourseFactory.create(cohort_config={'cohorted': True, 'auto_cohort': True, 'auto_cohort_groups': cohort_groups}) user_1 = 'user_1' user_2 = 'user_2' CourseEnrollment.enroll(UserFactory.create(username=user_1), course.id) CourseEnrollment.enroll(UserFactory.create(username=user_2), course.id) # In auto cohorting a group will be assigned to a user only when user visits a problem # In grading calculation we only add a group in csv if group is already assigned to # user rather than creating a group automatically at runtime self._verify_cell_data_for_user(user_1, course.id, 'Cohort Name', '') self._verify_cell_data_for_user(user_2, course.id, 'Cohort Name', '') def test_unicode_cohort_data_in_grading(self): """ Test that cohorts can contain unicode characters. """ course = CourseFactory.create(cohort_config={'cohorted': True}) # Create users and manually assign cohorts user1 = UserFactory.create(username='user1') user2 = UserFactory.create(username='user2') CourseEnrollment.enroll(user1, course.id) CourseEnrollment.enroll(user2, course.id) professor_x = u'ÞrÖfessÖr X' magneto = u'MàgnëtÖ' cohort1 = CohortFactory(course_id=course.id, name=professor_x) cohort2 = CohortFactory(course_id=course.id, name=magneto) cohort1.users.add(user1) cohort2.users.add(user2) self._verify_cell_data_for_user(user1.username, course.id, 'Cohort Name', professor_x) self._verify_cell_data_for_user(user2.username, course.id, 'Cohort Name', magneto) def test_unicode_user_partitions(self): """ Test that user partition groups can contain unicode characters. """ user_groups = [u'ÞrÖfessÖr X', u'MàgnëtÖ'] user_partition = UserPartition( 0, 'x_man', 'X Man', [ Group(0, user_groups[0]), Group(1, user_groups[1]) ] ) # Create course with group configurations self.initialize_course( course_factory_kwargs={ 'user_partitions': [user_partition] } ) _groups = [group.name for group in self.course.user_partitions[0].groups] self.assertEqual(_groups, user_groups) def test_cohort_scheme_partition(self): """ Test that cohort-schemed user partitions are ignored in the grades export. """ # Set up a course with 'cohort' and 'random' user partitions. cohort_scheme_partition = UserPartition( 0, 'Cohort-schemed Group Configuration', 'Group Configuration based on Cohorts', [Group(0, '
noironetworks/group-based-policy
gbpservice/nfp/common/constants.py
Python
apache-2.0
4,212
0.000237
# Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. FIREWALL = 'firewall' LOADBALANCERV2 = 'loadbalancerv2' VPN = 'vpn' GENERIC_CONFIG = 'generic_config' GBP_MODE = "gbp" NEUTRON_MODE = "neutron" NOVA_MODE = "nova" NEUTRON_PORT = "
neutron_port" GBP_PORT = "gbp_policy_target" NEUTRON_NETWORK = "neutron_network" GBP_NETWORK = "gbp_group" PROVIDER = "provider" CONSUMER = "consumer" STITCHING = "stitching" MANAGEMENT = "management" MONITOR = "monitoring" GATEWAY_TYPE = "gateway" ENDPOINT_TYPE = "endpoint" CREATE = "create" UPDATE = "update" DELETE = "delete" SUCCESS = 'SUCCESS' FOREVER = 'forever' INITIAL = 'initial' ACTIV
E_PORT = "ACTIVE" STANDBY_PORT = "STANDBY" MASTER_PORT = "MASTER" STANDALONE_PORT = "STANDALONE" ACTIVE = "ACTIVE" # REVISIT(ashu) - Merge to have single BUILD state PENDING_CREATE = "PENDING_CREATE" PENDING_UPDATE = "PENDING_UPDATE" PENDING_DELETE = "PENDING_DELETE" ERROR = "ERROR" BUILD = "BUILD" NFP_STATUS = [ACTIVE, PENDING_CREATE, PENDING_UPDATE, PENDING_DELETE, ERROR] DEVICE_ORCHESTRATOR = "device_orch" SERVICE_ORCHESTRATOR = "service_orch" HEAT_CONFIG_TAG = 'heat_config' CONFIG_INIT_TAG = 'config_init' ANSIBLE_TAG = 'ansible' CUSTOM_JSON = 'custom_json' COMPLETED = "COMPLETED" IN_PROGRESS = "IN_PROGRESS" CONFIG_INIT_TAG = "config_init" CONFIG_SCRIPT = 'config_script' CONFIG_TAG_RESOURCE_MAP = { HEAT_CONFIG_TAG: 'heat', CONFIG_INIT_TAG: 'config_init', ANSIBLE_TAG: 'ansible', CUSTOM_JSON: 'custom_json'} MAXIMUM_INTERFACES = 'maximum_interfaces' SUPPORTS_SHARING = 'supports_device_sharing' SUPPORTS_HOTPLUG = 'supports_hotplug' PERIODIC_HM = 'periodic_healthmonitor' DEVICE_TO_BECOME_DOWN = 'DEVICE_TO_BECOME_DOWN' METADATA_SUPPORTED_ATTRIBUTES = [MAXIMUM_INTERFACES, SUPPORTS_SHARING, SUPPORTS_HOTPLUG] LOADBALANCERV2_RPC_API_VERSION = "1.0" HEALTHMONITOR_RESOURCE = 'healthmonitor' INTERFACE_RESOURCE = 'interfaces' ROUTES_RESOURCE = 'routes' MANAGEMENT_INTERFACE_NAME = 'mgmt_interface' VYOS_VENDOR = 'vyos' HAPROXY_LBAASV2 = 'haproxy' NFP_VENDOR = 'nfp' L3_INSERTION_MODE = "l3" request_event = "REQUEST" response_event = "RESPONSE" error_event = "ERROR" # POLLING EVENTS SPACING AND MAXRETRIES DEVICE_SPAWNING_SPACING = 10 DEVICE_SPAWNING_MAXRETRY = 25 DEVICE_BEING_DELETED_SPACING = 5 DEVICE_BEING_DELETED_MAXRETRY = 20 APPLY_USER_CONFIG_IN_PROGRESS_SPACING = 10 APPLY_USER_CONFIG_IN_PROGRESS_MAXRETRY = 20 UPDATE_USER_CONFIG_PREPARING_TO_START_SPACING = 10 UPDATE_USER_CONFIG_PREPARING_TO_START_MAXRETRY = 20 UPDATE_USER_CONFIG_STILL_IN_PROGRESS_MAXRETRY = 300 DELETE_USER_CONFIG_IN_PROGRESS_SPACING = 10 DELETE_USER_CONFIG_IN_PROGRESS_MAXRETRY = 20 CHECK_USER_CONFIG_COMPLETE_SPACING = 10 CHECK_USER_CONFIG_COMPLETE_MAXRETRY = 40 PULL_NOTIFICATIONS_SPACING = 10 # nfp_node_deriver_config # all units in sec. SERVICE_CREATE_TIMEOUT = 1500 SERVICE_DELETE_TIMEOUT = 600 # heat stack creation timeout STACK_ACTION_WAIT_TIME = 300 # default directory for config files CONFIG_DIR = '/etc/nfp/' NFP_STATUS_MAP = { ERROR: {'status': ERROR, 'status_details': 'Node deployment failed'}, ACTIVE: {'status': ACTIVE, 'status_details': 'Node deployment completed'}, BUILD: {'status': BUILD, 'status_details': 'Node deployment is in progress'}, PENDING_CREATE: {'status': BUILD, 'status_details': 'Node deployment is in progress'}, PENDING_UPDATE: {'status': BUILD, 'status_details': 'update of node is in progress'}, PENDING_DELETE: {'status': BUILD, 'status_details': 'delete of node is in progress'} }
nextgenusfs/ufits
amptk/install.py
Python
bsd-2-clause
3,232
0.008045
#!/usr/bin/env python from __future__ import (absolute_import, division, print_function, unicode_literals) import sys import os import argparse import tarfile import gzip import json import requests import shutil from amptk import amptklib try: from urllib.request import urlopen except ImportError: from urllib2 import urlopen class MyFormatter(argparse.ArgumentDefaultsHelpFormatter): def __init__(self,prog): super(MyFormatter,self).__init__(prog,max_help_position=50) def main(args): parser=argparse.ArgumentParser(prog='amptk-install.py', description='''Script to download preformatted databases''', epilog="""Written by Jon Palmer (2019) [email protected]""", formatter_class=MyFormatter) parser.add_argument('-i','--input', nargs='+', required=True, choices=['ITS', '16S', 'LSU', 'COI'], help='Install Databases') parser.add_argument('-f','--force', action='store_true', help='Overwrite existing databases') parser.add_argument('-l','--local', action='store_true', help='Use local downloads.json for links') args=parser.parse_args(args) parentdir = os.path.join(os.path.dirname(amptklib.__file__)) # downd from github to get most recent databases if not args.local: try: print('Retrieving download links from GitHub Repo') URL = json.loads(requests.get("https://raw.githubusercontent.com/nextgenusfs/amptk/master/amptk/downloads.json").text) except: print('Unable to download links from GitHub, using funannotate version specific links') with open(os.path.join(os.path.dirname(__file__), 'downloads.json')) as infile: URL = json.load(infile) else: with open(os.path.join(os.path.dirname(__file__), 'downloads.json')) as infile: URL = json.load(infile) for x in args.input: udbfile = os.path.join(parentdir, 'DB', x+'.udb') if os.path.isfile(udbfile): if not args.force: print("A formated database was found, to overwrite use '--force'. You can add more custom databases by using the `amptk da
tabase` command.") sys.exit(1) #download if not x in URL: if args.force: continue print("%s not valid, choices are ITS, 16S, LSU, COI" % x)
sys.exit(1) print("Downloading %s pre-formatted database" % x) address = URL.get(x) if not os.path.isfile(x+'.amptk.tar.gz'): amptklib.download(address, x+'.amptk.tar.gz') tfile = tarfile.open(x+'.amptk.tar.gz', 'r:gz') tfile.extractall(x) for file in os.listdir(x): shutil.move(os.path.join(x,file), os.path.join(parentdir, 'DB', file)) shutil.rmtree(x) os.remove(x+'.amptk.tar.gz') print('Extracting FASTA files for {:}'.format(x)) extracted = os.path.join(parentdir, 'DB', x+'.extracted.fa') cmd = ['vsearch', '--udb2fasta', udbfile, '--output', extracted] amptklib.runSubprocess5(cmd) print("{:} taxonomy database installed to {:}".format(x, os.path.join(parentdir, 'DB'))) if __name__ == "__main__": main()
resmio/django-sendgrid
sendgrid/tests/test_signals.py
Python
bsd-2-clause
3,625
0
from django.test import TestCase, Client from sendgrid import utils, signals import json class SignalTestCase(TestCase): def setUp(self): self.client = Client() self.email_data = {'subject': 'Test Subject', 'body': 'Hi, I am a test body', 'from_email': '[email protected]', 'to': ('[email protected]', )} def test_received_email(self): """ Test signals triggered by sendgrid callback. """ data = [] def email_event_handler(sender, signal): data.append((sender, signal, )) signals.email_event.connect(email_event_handler) # check if we received signals self.assertEqual(len(data), 0) message = utils.SendgridEmailMessage(**self.email_data) message.send() # check if we received the signal triggered by the email creation self.assertEqual(len(data), 1) response = self.client.post('/sendgrid_callback/', data=json.dumps([{ 'email': '[email protected]', 'uuid': message.uuid, 'event': 'processed', 'timestamp': '123456789', }, ]), content_type='application/json') # verify that we received a signa
l self.assertEqual(len(data), 2) self.assertEqual(data[1][0].ev
ent, 'processed') self.assertEqual(data[1][0].uuid, message.uuid) self.assertEqual(response.status_code, 200) def test_dupe_signals(self): """ Test handling of duplicate signals. """ data = [] def email_event_handler(sender, signal): data.append((sender, signal, )) signals.email_event.connect(email_event_handler) # check if we received signals self.assertEqual(len(data), 0) message = utils.SendgridEmailMessage(**self.email_data) message.send() # check if we received the signal triggered by the email creation self.assertEqual(len(data), 1) response = self.client.post('/sendgrid_callback/', data=json.dumps([{ 'email': '[email protected]', 'uuid': message.uuid, 'event': 'delivered', 'timestamp': '123456789', }, ]), content_type='application/json') # verify that we received a signal self.assertEqual(len(data), 2) self.assertEqual(data[1][0].event, 'delivered') self.assertEqual(data[1][0].uuid, message.uuid) self.assertEqual(response.status_code, 200) response = self.client.post('/sendgrid_callback/', data=json.dumps([{ 'email': '[email protected]', 'uuid': message.uuid, 'event': 'delivered', 'timestamp': '123456790', }, ]), content_type='application/json') # verify that we received a signal self.assertEqual(len(data), 2) self.assertEqual(response.status_code, 200)
gem/oq-engine
openquake/hazardlib/source/non_parametric.py
Python
agpl-3.0
10,119
0
# The Hazard Library # Copyright (C) 2013-2022 GEM Foundation # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as # published by the Free Software Foundation, either version 3 of the # License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. """ Module :mod:`openquake.hazardlib.source.non_parametric` defines :class:`NonParametricSeismicSource` """ import numpy from openquake.baselib.general import block_splitter from openquake.hazardlib.source.base import BaseSeismicSource from openquake.hazardlib.geo.surface.gridded import GriddedSurface from openquake.hazardlib.geo.surface.multi import MultiSurface from openquake.hazardlib.source.rupture import \ NonParametricProbabilisticRupture from openquake.hazardlib.geo.utils import (angular_distance, KM_TO_DEGREES, get_spherical_bounding_box) from openquake.hazardlib.geo.utils import angular_distance, KM_TO_DEGREES from openquake.hazardlib.geo.mesh import Mesh from openquake.hazardlib.geo.point import Point from openquake.hazardlib.pmf import PMF F32 = numpy.float32 U32 = numpy.uint32 class NonParametricSeismicSource(BaseSeismicSource): """ Non Parametric Seismic Source explicitly defines earthquake ruptures in the constructor. That is earthquake ruptures are not generated algorithmically from a set of source parameters. Ruptures' rectonic region types are overwritten by source tectonic region type. :param data: List of tuples. Each tuple must contain two items. The first item must be an instance of :class:`openquake.hazardlib.source.rupture.Rupture`. The second item must be an instance of :class:`openquake.hazardlib.pmf.PMF` describing the probability of the rupture to occur N times (the PMF must be defined from a minimum number of occurrences equal to 0) """ code = b'N' MODIFICATIONS = set() def __init__(self, source_id, name, tectonic_region_type, data, weights=None): super().__init__(source_id, name, tectonic_region_type) self.data = data if weights is n
ot None: assert len(weights) == len(data) for (rup, pmf), weight in zip(data, weights): rup.weight = weight def iter_ruptures(self, **kwargs): """ Get a generator object that yields probabilistic ruptures the source consists of. :returns: Generator of instances of :class:`openquake.ha
zardlib.source. rupture.NonParametricProbabilisticRupture`. """ for rup, pmf in self.data: if rup.mag >= self.min_mag: yield NonParametricProbabilisticRupture( rup.mag, rup.rake, self.tectonic_region_type, rup.hypocenter, rup.surface, pmf, weight=rup.weight) def few_ruptures(self): """ Fast version of iter_ruptures used in estimate_weight """ for i, (rup, pmf) in enumerate(self.data): if i % 50 == 0 and rup.mag >= self.min_mag: yield NonParametricProbabilisticRupture( rup.mag, rup.rake, self.tectonic_region_type, rup.hypocenter, rup.surface, pmf, weight=rup.weight) def __iter__(self): if len(self.data) == 1: # there is nothing to split yield self return for i, block in enumerate(block_splitter(self.data, 100)): source_id = '%s:%d' % (self.source_id, i) src = self.__class__(source_id, self.name, self.tectonic_region_type, block) src.num_ruptures = len(block) src.trt_smr = self.trt_smr yield src def count_ruptures(self): """ See :meth: `openquake.hazardlib.source.base.BaseSeismicSource.count_ruptures`. """ return len(self.data) def get_min_max_mag(self): """ Return the minimum and maximum magnitudes of the ruptures generated by the source """ min_mag = min(rup.mag for rup, pmf in self.data) max_mag = max(rup.mag for rup, pmf in self.data) return min_mag, max_mag def get_bounding_box(self, maxdist): """ Bounding box containing the surfaces, enlarged by the maximum distance """ surfaces = [] for rup, _ in self.data: if isinstance(rup.surface, MultiSurface): surfaces.extend(rup.surface.surfaces) else: surfaces.append(rup.surface) lons = [] lats = [] for surf in surfaces: lo1, lo2, la1, la2 = surf.get_bounding_box() lons.extend([lo1, lo2]) lats.extend([la1, la2]) west, east, north, south = get_spherical_bounding_box(lons, lats) a1 = maxdist * KM_TO_DEGREES a2 = angular_distance(maxdist, north, south) return west - a2, south - a1, east + a2, north + a1 def is_gridded(self): """ :returns: True if containing only GriddedRuptures, False otherwise """ for rup, _ in self.data: if not isinstance(rup.surface, GriddedSurface): return False return True def todict(self): """ Convert a GriddedSource into a dictionary of arrays """ assert self.is_gridded(), '%s is not gridded' % self n = len(self.data) m = sum(len(rup.surface.mesh) for rup, pmf in self.data) p = len(self.data[0][1].data) dic = {'probs_occur': numpy.zeros((n, p)), 'magnitude': numpy.zeros(n), 'rake': numpy.zeros(n), 'hypocenter': numpy.zeros((n, 3), F32), 'mesh3d': numpy.zeros((m, 3), F32), 'slice': numpy.zeros((n, 2), U32)} start = 0 for i, (rup, pmf) in enumerate(self.data): dic['probs_occur'][i] = [prob for (prob, _) in pmf.data] dic['magnitude'][i] = rup.mag dic['rake'][i] = rup.rake dic['hypocenter'][i] = (rup.hypocenter.x, rup.hypocenter.y, rup.hypocenter.z) mesh = rup.surface.mesh.array.T # shape (npoints, 3) dic['mesh3d'][start: start + len(mesh)] = mesh dic['slice'][i] = start, start + len(mesh) start += len(mesh) return dic def fromdict(self, dic, weights=None): """ Populate a GriddedSource with ruptures """ assert not self.data, '%s is not empty' % self i = 0 for mag, rake, hp, probs, (start, stop) in zip( dic['magnitude'], dic['rake'], dic['hypocenter'], dic['probs_occur'], dic['slice']): mesh = Mesh(dic['mesh3d'][start:stop, 0], dic['mesh3d'][start:stop, 1], dic['mesh3d'][start:stop, 2]) surface = GriddedSurface(mesh) pmf = PMF([(prob, i) for i, prob in enumerate(probs)]) hypocenter = Point(hp[0], hp[1], hp[2]) rup = NonParametricProbabilisticRupture( mag, rake, self.tectonic_region_type, hypocenter, surface, pmf, weight=None if weights is None else weights[i]) self.data.append((rup, pmf)) i += 1 def __repr__(self): return '<%s %s gridded=%s>' % ( self.__class__.__name__, self.source_id, self.is_gridded()) @property def mesh_size(self): """ :returns: the number of points in the underlying meshes (reduced) """ n = 0 for rup in self.few_ruptures
radman404/Who-s-attacking-me-now--
wamnclient.py
Python
gpl-2.0
2,126
0.024929
#!/usr/bin/python import pygeoip import json from logsparser.lognormalizer import LogNormalizer as LN import gzip import glob import socket import urllib2 IP = 'IP.Of,Your.Server' normalizer = LN('/usr/local/share/logsparser/normalizers') gi = pygeoip.GeoIP('../GeoLiteCity.dat') def complete(text, state): return (glob.glob(text+'*')+[none])[state] def sshcheck(): attacks = {} users = {} try: import readline, rlcompleter readline.set_completer_delims(' \t\n;') readline.parse_and_bind("tab: complete") readline.set_completer(complete) except ImportError: print 'No Tab Completion' LOGs = raw_input('Enter the path to the log file: ') for LOG in LOGs.split(' '): if LOG.endswith('.gz'): auth_logs = gzip.GzipFile(LOG, 'r') else: auth_logs = open(LOG, 'r') if len(LOGs) is '1': print "Parsing log file" else: print "Parsing log files" for log in auth_logs: l = {"raw": log } normalizer.normalize(l) if l.get('action') == 'fail' and l.get('program') == 'sshd': u = l['user'] p = l['source_ip'] o1, o2, o3, o4 = [int(i) for i in p.split('.')] if o1 == 192 and o2 == 168 or o1 == 172 and o2 in range(16, 32) or o1 == 10: print "Private IP, %s No geolocation data" %str(p) attacks[p] = attacks.get(p, 0) + 1 getip() dojson(attacks, IP) def getip(): global IP if IP is 0: try: i = urllib2.Request("http://icanhazip.com") p = urllib2.urlopen(i) IP = p.read() except: print "can't seem to grab your IP please set IP variable so We can better map attacks" def dojson(attacks, IP): data = {} for i,(a,p) in enumerate(attacks.iteritems()): datalist = [{ 'ip': a, 'attacks': p, 'local_ip': IP }] data[i] = datalist
newd
ata = data newjson = json.dumps(newdata) print json.loads(newjson) send(newjson) def send(data): s = socket.socket(socket.AF_INET, socket.SOCK_STREAM) s.connect(('Ip.Of.Your.Server', 9999)) s.sendall(data) s.close() try: sshcheck() except KeyboardInterrupt: print '\nCtrl+C Exiting...' exit(0)
markroxor/gensim
gensim/corpora/indexedcorpus.py
Python
lgpl-2.1
5,378
0.002789
#!/usr/bin/env python # -*- codi
ng: utf-8 -*- # # Copyright (C) 2010 Radim Rehurek <[email protected]> # Licensed under the GNU LGPL v2.1 - http://www.gnu.org/licenses/lgpl.html """ Indexed corpus is a mechanism for random-accessing corpora. While the standard corpus interface in gensim allows iterating over corpus with `for doc in corpus: pass`, indexed corpus allows accessing the documents with `corpus[docno]` (in O(1) look-up time). This functionality is achieved by storing an extra file (by default named
the same as the corpus file plus '.index' suffix) that stores the byte offset of the beginning of each document. """ import logging import six import numpy from gensim import interfaces, utils logger = logging.getLogger('gensim.corpora.indexedcorpus') class IndexedCorpus(interfaces.CorpusABC): def __init__(self, fname, index_fname=None): """ Initialize this abstract base class, by loading a previously saved index from `index_fname` (or `fname.index` if `index_fname` is not set). This index will allow subclasses to support the `corpus[docno]` syntax (random access to document #`docno` in O(1)). >>> # save corpus in SvmLightCorpus format with an index >>> corpus = [[(1, 0.5)], [(0, 1.0), (1, 2.0)]] >>> gensim.corpora.SvmLightCorpus.serialize('testfile.svmlight', corpus) >>> # load back as a document stream (*not* plain Python list) >>> corpus_with_random_access = gensim.corpora.SvmLightCorpus('tstfile.svmlight') >>> print(corpus_with_random_access[1]) [(0, 1.0), (1, 2.0)] """ try: if index_fname is None: index_fname = utils.smart_extension(fname, '.index') self.index = utils.unpickle(index_fname) # change self.index into a numpy.ndarray to support fancy indexing self.index = numpy.asarray(self.index) logger.info("loaded corpus index from %s", index_fname) except Exception: self.index = None self.length = None @classmethod def serialize(serializer, fname, corpus, id2word=None, index_fname=None, progress_cnt=None, labels=None, metadata=False): """ Iterate through the document stream `corpus`, saving the documents to `fname` and recording byte offset of each document. Save the resulting index structure to file `index_fname` (or `fname`.index is not set). This relies on the underlying corpus class `serializer` providing (in addition to standard iteration): * `save_corpus` method that returns a sequence of byte offsets, one for each saved document, * the `docbyoffset(offset)` method, which returns a document positioned at `offset` bytes within the persistent storage (file). * metadata if set to true will ensure that serialize will write out article titles to a pickle file. Example: >>> MmCorpus.serialize('test.mm', corpus) >>> mm = MmCorpus('test.mm') # `mm` document stream now has random access >>> print(mm[42]) # retrieve document no. 42, etc. """ if getattr(corpus, 'fname', None) == fname: raise ValueError("identical input vs. output corpus filename, refusing to serialize: %s" % fname) if index_fname is None: index_fname = utils.smart_extension(fname, '.index') kwargs = {'metadata': metadata} if progress_cnt is not None: kwargs['progress_cnt'] = progress_cnt if labels is not None: kwargs['labels'] = labels offsets = serializer.save_corpus(fname, corpus, id2word, **kwargs) if offsets is None: raise NotImplementedError( "Called serialize on class %s which doesn't support indexing!" % serializer.__name__ ) # store offsets persistently, using pickle # we shouldn't have to worry about self.index being a numpy.ndarray as the serializer will return # the offsets that are actually stored on disk - we're not storing self.index in any case, the # load just needs to turn whatever is loaded from disk back into a ndarray - this should also ensure # backwards compatibility logger.info("saving %s index to %s", serializer.__name__, index_fname) utils.pickle(offsets, index_fname) def __len__(self): """ Return the index length if the corpus is indexed. Otherwise, make a pass over self to calculate the corpus length and cache this number. """ if self.index is not None: return len(self.index) if self.length is None: logger.info("caching corpus length") self.length = sum(1 for _ in self) return self.length def __getitem__(self, docno): if self.index is None: raise RuntimeError("Cannot call corpus[docid] without an index") if isinstance(docno, (slice, list, numpy.ndarray)): return utils.SlicedCorpus(self, docno) elif isinstance(docno, six.integer_types + (numpy.integer,)): return self.docbyoffset(self.index[docno]) else: raise ValueError('Unrecognised value for docno, use either a single integer, a slice or a numpy.ndarray')
leschzinerlab/ISAC
ISAC.py
Python
mit
8,169
0.045048
#!/usr/bin/env python import optparse from sys import * import os,sys,re from optparse import OptionParser import glob import subprocess from os import system import linecache import time #========================= def setupParserOptions(): parser = optparse.OptionParser() parser.set_usage("%prog -i <stack> --nodes=<nodes> --threads=<threads>") parser.add_option("-i",dest="stack",type="string",metavar="FILE", help="Input stack") #parser.add_option("--apix",dest="apix",type="float", metavar="FLOAT", # help="Pixel size") #parser.add_option("--lp",dest="lp",type="int", metavar="INT",default=15, # help="Low pass filter to use during alignment. (Default=15 A)") #parser.add_option("--hp",dest="hp",type="int", metavar="INT",default=500, # help="High pass filter to use during alignment. (Default=500 A)") parser.add_option("--img_per_grp",dest="img_per_grp",type="int", metavar="INT",default=60, help="Number of images per group. (Default=60)") parser.add_option("--thld_err",dest="thld_err",type="int", metavar="INT",default=60, help="Threshold pixel error when checking stability. (Default=1.75)") parser.add_option("--max_round",dest="maxround",type="int", metavar="INT",default=5, help="Max iterations for alignment. (Default=5)") parser.add_option("--generations",dest="num_gen",type="int", metavar="INT",defa
ult=1, help="Number of generations. (Default=1)") parser.add_option("--queue",dest="queue",type="string", metavar="STRING",default='condo', help="Queue for job submission. (Default=condo)") parser.add_option("--nodes",dest="nodes",type="int", metavar="INT",default=20, help="Number of nodes to distribute job over. (Default=20)") parser.add_option("--threads",dest="threads",type="int", metavar="INT",default=8, help="Number of
threads per node to run. (Default=8)") parser.add_option("--walltime",dest="walltime",type="int", metavar="INT",default=8, help="Walltime for job (estimated run time, in hours). (Default=8)") parser.add_option("-d", action="store_true",dest="debug",default=False, help="debug") options,args = parser.parse_args() if len(args) > 1: parser.error("Unknown commandline options: " +str(args)) if len(sys.argv) < 3: parser.print_help() sys.exit() params={} for i in parser.option_list: if isinstance(i.dest,str): params[i.dest] = getattr(options,i.dest) return params #============================= def checkConflicts(params): if not os.path.exists(params['stack']): print 'Error: stack %s does not exist. Exiting' %(params['stack']) sys.exit() if params['stack'][-4:] != '.img': print 'Error: stack extension %s is not recognized as .img. Exiting' %(params['stack'][4:]) sys.exit() if os.path.exists('dir_%s' %(params['stack'][:-4])): print 'Error: output directory dir_%s already exists. Exiting.' %(params['stack'][:-4]) sys.exit() #========================= def getEMANPath(): emanpath = subprocess.Popen("env | grep EMAN2DIR", shell=True, stdout=subprocess.PIPE).stdout.read().strip() if emanpath: emanpath = emanpath.replace("EMAN2DIR=","") if os.path.exists(emanpath): return emanpath print "EMAN2 was not found, make sure it is in your path" sys.exit() #============================== def convertIMG_to_BDB(params,scaling): print '\n' print 'Converting imagic stack to BDB format: %s.img -----> bdb:%s' %(params['stack'][:-4],params['stack'][:-4]) print '...this can take a while\n' #Remove existing images if they are there if os.path.exists('EMAN2DB/%s.bdb' %(params['stack'][:-4])): os.remove('EMAN2DB/%s.bdb' %(params['stack'][:-4])) os.remove('EMAN2DB/%s_64x64x1' %(params['stack'][:-4])) if os.path.exists('EMAN2DB/%s_ali.bdb' %(params['stack'][:-4])): os.remove('EMAN2DB/%s_ali.bdb' %(params['stack'][:-4])) os.remove('EMAN2DB/%s_ali_64x64x1' %(params['stack'][:-4])) #Convert stack from imagic to bdb format cmd='e2proc2d.py %s.img bdb:%s --scale=%f --clip=64,64' %(params['stack'][:-4],params['stack'][:-4],float(scaling)) if params['debug'] is True: print cmd subprocess.Popen(cmd,shell=True).wait() return 'bdb:%s' %(params['stack'][:-4]) #============================== def getBoxSize(stack): cmd='iminfo %s > tmp2222.txt' %(stack) subprocess.Popen(cmd,shell=True).wait() line=linecache.getline('tmp2222.txt',4) boxsize=int(line.split()[-1].split('x')[0]) os.remove('tmp2222.txt') return boxsize #============================= def submitISAC(bdbstack,queue,nodes,threads,walltime,ngen,maxround,imgpergroup,therr): subscript='isac_%i.submit'%(int(time.time())) o1=open(subscript,'w') cmd='#!/bin/bash\n' cmd+='### Inherit all current environment variables\n' cmd+='#PBS -V\n' cmd+='### Job name\n' cmd+='#PBS -N isac1\n' cmd+='### Keep Output and Error\n' cmd+='#PBS -o isac.o$PBS_JOBID\n' cmd+='#PBS -e isac.e$PBS_JOBID\n' cmd+='### Queue name\n' cmd+='#PBS -q %s\n' %(queue) cmd+='### Specify the number of nodes and thread (ppn) for your job.\n' cmd+='#PBS -l nodes=%i:ppn=%i\n' %(nodes,threads) cmd+='### Tell PBS the anticipated run-time for your job, where walltime=HH:MM:SS\n' cmd+='#PBS -l walltime=%i:00:00\n'%(walltime) cmd+='#################################\n' cmd+='### Switch to the working directory;\n' cmd+='cd $PBS_O_WORKDIR\n' cmd+='### Run:\n' cmd+='mpirun /home/micianfrocco/software/EMAN2-2.12/bin/sxisac.py %s --stab_ali=2 --init_iter=1 --main_iter=1 --match_second=1 --radius=30 --max_round=%i --img_per_grp=%i --thld_err=%f --n_generations=%i\n' %(bdbstack,maxround,imgpergroup,therr,ngen) o1.write(cmd) print '\n...Submission script generated.\n' print '\n Exit interactive node and submit ISAC job using the following command: \n' print '\n qsub %s' %(subscript) #============================== if __name__ == "__main__": params=setupParserOptions() getEMANPath() checkConflicts(params) boxSize=getBoxSize(params['stack']) ScalingFactor=64/float(boxSize) if params['debug'] is True: print 'ScalingFactor=%f' %(ScalingFactor) print 'BoxSize=%f' %(boxSize) #Filter stack if os.path.exists('%s_filt.img' %(params['stack'][:-4])): os.remove('%s_filt.img' %(params['stack'][:-4])) if os.path.exists('%s_filt.hed' %(params['stack'][:-4])): os.remove('%s_filt.hed' %(params['stack'][:-4])) #cmd='proc2d %s %s_filt.img apix=%f hp=%i lp=%i' %(params['stack'],params['stack'][:-4],params['apix'],params['hp'],params['lp']) #if params['debug'] is True: # print cmd #subprocess.Popen(cmd,shell=True).wait() bdbstack=convertIMG_to_BDB(params,ScalingFactor) #prepare stack for isac print '\n ...Initializing stack...\n' cmd='sxheader.py %s --params=active --one' %(bdbstack) if params['debug'] is True: print cmd subprocess.Popen(cmd,shell=True).wait() cmd='sxheader.py %s --params=xform.align2d --zero' %(bdbstack) if params['debug'] is True: print cmd subprocess.Popen(cmd,shell=True).wait() #Centering particles print '\n ...Centering particles...\n' cmd='mpirun -np 1 sxali2d.py %s dir_%s --ou=28 --xr="2 1" --ts="1 0.5" --maxit=33 --dst=90 --MPI' %(bdbstack,params['stack'][:-4]) if params['debug'] is True: print cmd subprocess.Popen(cmd,shell=True).wait() #Rotate particles according to centering print '\n ...Applying alignments from centering to particle stack...\n' cmd='sxtransform2d.py %s %s_ali' %(bdbstack,bdbstack) if params['debug'] is True: print cmd subprocess.Popen(cmd,shell=True).wait() #Create cluster submission script & submit job submitISAC('%s_ali' %(bdbstack),params['queue'],params['nodes'],params['threads'],params['walltime'],params['num_gen'],params['maxround'],params['img_per_grp'],params['thld_err'])
lociii/googleads-python-lib
examples/adspygoogle/dfp/v201306/creative_service/get_creatives_by_statement.py
Python
apache-2.0
2,090
0.002871
#!/usr/bin/python # # Copyright 2013 Google Inc. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """This code example gets all image creatives. The statement retrieves up to the maximum page size limit of 500. To create an image creative, run create_creatives.py.""" __author__ = ('Jeff Sham', 'Vincent Tsao') # Locate the client library. If module was installed via "setup.py" script, then # the following two lines are not needed. import os import sys sys.path.insert(0, os.path.join('..', '..', '..', '..', '..')) # Import appropriate classes from the client library. from adspygoogle import DfpClient # Initialize client object. client = DfpClient(path=os.path.join('..', '..', '..', '..', '..')) # Initialize appropriate service. creative_service = client.GetService('CreativeService', version='v201306') # Create statement object to only select image creatives. values = [{ 'key': 'creativeType', 'value': { 'xsi_type': 'TextValue', 'value': 'ImageCreative' } }] filter_statement
= {'query': 'WHERE creativeType = :creativeType LIMIT 500', 'values': values} # Get creatives by statement. response = creative_service.GetCreativesByStatement(filter_statement)[0] creatives = [] if 'results' in response: creatives = response['results'] # Display results
. for creative in creatives: print ('Creative with id \'%s\', name \'%s\', and type \'%s\' was found.' % (creative['id'], creative['name'], creative['Creative_Type'])) print print 'Number of results found: %s' % len(creatives)
nicholasserra/sentry
src/sentry/api/endpoints/project_details.py
Python
bsd-3-clause
8,377
0.002029
from __future__ import absolute_import import logging from datetime import timedelta from django.utils import timezone from rest_framework import serializers, status from rest_framework.response import Response from sentry.api.base import DocSection from sentry.api.bases.project import ProjectEndpoint from sentry.api.decorators import sudo_required from sentry.api.serializers import serialize from sentry.models import ( AuditLogEntryEvent, Group, GroupStatus, Project, ProjectStatus ) from sentry.plugins import plugins from sentry.tasks.deletion import delete_project from sentry.utils.apidocs import scenario, attach_scenarios @scenario('GetProject') def get_project_scenario(runner): runner.request( method='GET', path='/projects/%s/%s/' % ( runner.org.slug, runner.default_project.slug) ) @scenario('DeleteProject') def delete_project_scenario(runner): with runner.isolated_project('Plain Proxy') as project: runner.request( method='DELETE', path='/projects/%s/%s/' % ( runner.org.slug, project.slug) ) @scenario('UpdateProject') def update_project_scenario(runner): with runner.isolated_project('Plain Proxy') as project: runner.request( method='PUT', path='/projects/%s/%s/' % ( runner.org.slug, project.slug), data={ 'name': 'Plane Proxy', 'slug': 'plane-proxy', 'options': { 'sentry:origins': 'http://example.com\nhttp://example.invalid', } } ) def clean_newline_inputs(value): result = [] for v in value.split('\n'): v = v.lower().strip() if v: result.append(v) return result class ProjectSerializer(serializers.ModelSerializer): class Meta: model = Project fields = ('name', 'slug') class ProjectDetailsEndpoint(ProjectEndpoint): doc_section = DocSection.PROJECTS def _get_unresolved_count(self, project): queryset = Group.objects.filter( status=GroupStatus.UNRESOLVED, project=project, ) resolve_age = project.get_option('sentry:resolve_age', None) if resolve_age: queryset = queryset.filter( last_seen__gte=timezone.now() - timedelta(hours=int(resolve_age)), ) return queryset.count() @attach_scenarios([get_project_scenario]) def get(self, request, project): """ Retrieve a Project `````````````````` Return details on an individual project. :pparam string organization_slug: the slug of the organization the project belongs to. :pparam string project_slug: the slug of the project to delete. :auth: required """ active_plugins = [ { 'name': plugin.get_title(), 'id': plugin.slug, } for plugin in plugins.configurable_for_project(project, version=None) if plugin.is_enabled(project) and plugin.has_project_conf() ] data = serialize(project, request.user) data['options'] = { 'sentry:origins': '\n'.join(project.get_option('sentry:origins', ['*']) or []), 'sentry:resolve_age': int(project.g
et_option('sentry:resolve_age', 0)), 'sentry:scrub_data': bool(project.get_option('sentry:scrub_data', True)), 'sentry:scrub_defaults': bool(project.get_option('sentry:scrub_defaults', True)), 'sentry:sensitive_fields': project.get_option('sentry:sensitive_fields', [
]), } data['activePlugins'] = active_plugins data['team'] = serialize(project.team, request.user) data['organization'] = serialize(project.organization, request.user) include = set(filter(bool, request.GET.get('include', '').split(','))) if 'stats' in include: data['stats'] = { 'unresolved': self._get_unresolved_count(project), } return Response(data) @attach_scenarios([update_project_scenario]) @sudo_required def put(self, request, project): """ Update a Project ```````````````` Update various attributes and configurable settings for the given project. Only supplied values are updated. :pparam string organization_slug: the slug of the organization the project belongs to. :pparam string project_slug: the slug of the project to delete. :param string name: the new name for the project. :param string slug: the new slug for the project. :param object options: optional options to override in the project settings. :auth: required """ serializer = ProjectSerializer(project, data=request.DATA, partial=True) if serializer.is_valid(): project = serializer.save() options = request.DATA.get('options', {}) if 'sentry:origins' in options: project.update_option( 'sentry:origins', clean_newline_inputs(options['sentry:origins']) ) if 'sentry:resolve_age' in options: project.update_option('sentry:resolve_age', int(options['sentry:resolve_age'])) if 'sentry:scrub_data' in options: project.update_option('sentry:scrub_data', bool(options['sentry:scrub_data'])) if 'sentry:scrub_defaults' in options: project.update_option('sentry:scrub_defaults', bool(options['sentry:scrub_defaults'])) if 'sentry:sensitive_fields' in options: project.update_option( 'sentry:sensitive_fields', [s.strip().lower() for s in options['sentry:sensitive_fields']] ) self.create_audit_entry( request=request, organization=project.organization, target_object=project.id, event=AuditLogEntryEvent.PROJECT_EDIT, data=project.get_audit_log_data(), ) data = serialize(project, request.user) data['options'] = { 'sentry:origins': '\n'.join(project.get_option('sentry:origins', '*') or []), 'sentry:resolve_age': int(project.get_option('sentry:resolve_age', 0)), } return Response(data) return Response(serializer.errors, status=status.HTTP_400_BAD_REQUEST) @attach_scenarios([delete_project_scenario]) @sudo_required def delete(self, request, project): """ Delete a Project ```````````````` Schedules a project for deletion. Deletion happens asynchronously and therefor is not immediate. However once deletion has begun the state of a project changes and will be hidden from most public views. :pparam string organization_slug: the slug of the organization the project belongs to. :pparam string project_slug: the slug of the project to delete. :auth: required """ if project.is_internal_project(): return Response('{"error": "Cannot remove projects internally used by Sentry."}', status=status.HTTP_403_FORBIDDEN) logging.getLogger('sentry.deletions').info( 'Project %s/%s (id=%s) removal requested by user (id=%s)', project.organization.slug, project.slug, project.id, request.user.id) updated = Project.objects.filter( id=project.id, status=ProjectStatus.VISIBLE, ).update(status=ProjectStatus.PENDING_DELETION) if updated: delete_project.delay(object_id=project.id, countdown=3600) self.create_audit_entry( request=request, organization=project.organization,
opennode/nodeconductor-assembly-waldur
src/waldur_core/core/tests/test_authentication.py
Python
mit
7,832
0.002937
from django.conf import settings from django.contrib.auth import get_user_model from django.core.cache import cache from django.urls import reverse from django.utils import timezone from freezegun import freeze_time from rest_framework import status, test from rest_framework.authtoken.models import Token from . import helpers class TokenAuthenticationTest(test.APITransactionTestCase): def setUp(self): self.username = 'test' self.password = 'secret' self.auth_url = 'http://testserver' + reverse('auth-password') self.test_url = 'http://testserver/api/' get_user_model().objects.create_user( self.username, '[email protected]', self.password ) def tearDown(self): cache.clear() def test_user_can_authenticate_with_token(self): response = self.client.post( self.auth_url, data={'username': self.username, 'password': self.password} ) self.assertEqual(response.status_code, status.HTTP_200_OK) token = response.data['token'] self.client.credentials(HTTP_AUTHORIZATION='Token ' + token) response = self.client.get(self.test_url) self.assertEqual(response.status_code, status.HTTP_200_OK) def test_token_expires_based_on_user_token_lifetime(self): user = get_user_model().objects.get(username=self.username) configured_token_lifetime = settings.WALDUR_CORE.get( 'TOKEN_LIFETIME', timezone.timedelta(hours=1) ) user_token_lifetime = configured_token_lifetime - timezone.timedelta(seconds=40) user.token_lifetime = user_token_lifetime.seconds user.save() response = self.client.post( self.auth_url, data={'username': self.username, 'password': self.password} ) self.assertEqual(response.status_code, status.HTTP_200_OK) token = response.data['token'] mocked_now = timezone.now() + user_token_lifetime with freeze_time(mocked_now): self.client.credentials(HTTP_AUTHORIZATION='Token ' + token) response = self.client.get(self.test_url) self.assertEqual(response.status_code, status.HTTP_401_UNAUTHORIZED) self.assertEqual(response.data['detail'], 'Token has expired.') def test_token_creation_time_is_updated_on_every_request(self): response = self.client.post( self.auth_url, data={'username': self.username, 'password': self.password} ) self.assertEqual(response.status_code, status.HTTP_200_OK) token = response.data['token'] created1 = Token.objects.values_list('created', flat=True).get(key=token) self.client.credentials(HTTP_AUTHORIZATION='Token ' + token) self.client.get(self.test_url) created2 = Token.objects.values_list('created', flat=True).get(key=token) self.assertTrue(created1 < created2) def test_account_is_blocked_after_five_failed_attempts(self): for _ in range(5): response = self.client.post( self.auth_url, data={'username': self.username, 'password': 'WRONG'} ) self.assertEqual(response.status_code, status.HTTP_401_UNAUTHORIZED) # this one should fail with a different error message self.client.post( self.auth_url, data={'username': self.username, 'password': 'WRONG'} ) self.assertEqual( response.data['detail'], 'Username is locked out. Try in 10 minutes.' ) self.assertEqual(response.status_code, status.HTTP_401_UNAUTHORIZED) def test_expired_token_is_recreated_on_successful_authentication(self): user = get_user_model().objects.get(username=self.username) self.assertIsNotNone(user.token_lifetime) response = self.client.post( self.auth_url, data={'username': self.username, 'password': self.password} ) self.assertEqual(response.status_code, status.HTTP_200_OK) token1 = response.data['token'] mocked_now = timezone.now() + timezone.timedelta(seconds=user.token_lifetime) with freeze_time(mocked_now): response = self.client.post( self.auth_url, data={'username': self.username, 'password': self.password}, ) token2 = response.data['token'] self.assertNotEqual(token1, token2) def test_not_expired_token_creation_time_is_updated_on_authentication(self): response = self.client.post( self.auth_url, data={'username': self.username, 'password': self.password} ) self.assertEqual(response.status_code, status.HTTP_200_OK) token1 = response.data['token'] created1 = Token.objects.values_list('created', flat=True).get(key=token1) response = self.client.post( self.auth_url, data={'username': self.username, 'password': self.password} ) token2 = response.data['token'] created2 = Token.objects.values_list('created', flat=True).get(key=token2) self.assertEqual(token1, token2) self.assertTrue(created1 < created2) def test_token_never_expires_if_token_lifetime_is_none(self): user = get_user_model().objects.get(username=self.username) user.token_lifetime = None user.save() response = self.client.post( self.auth_url, data={'username': self.username, 'password': self.password} ) self.assertEqual(response.status_code, status.HTTP_200_OK) original_token = response.data['token'] year_ahead = timezone.now() + timezone.timedelta(days=365) with freeze_time(year_ahead): response = self.client.post( self.auth_url, data={'username': self.username, 'password': self.password}, )
token_in_a_year = response.data['token']
self.assertEqual(original_token, token_in_a_year) def test_token_created_date_is_refreshed_even_if_token_lifetime_is_none(self): response = self.client.post( self.auth_url, data={'username': self.username, 'password': self.password} ) self.assertEqual(response.status_code, status.HTTP_200_OK) user = get_user_model().objects.get(username=self.username) original_token_lifetime = user.token_lifetime original_created_value = user.auth_token.created user.token_lifetime = None user.save() last_refresh_time = timezone.now() + timezone.timedelta( seconds=original_token_lifetime ) with freeze_time(last_refresh_time): response = self.client.post( self.auth_url, data={'username': self.username, 'password': self.password}, ) self.assertEqual(response.status_code, status.HTTP_200_OK) token = response.data['token'] user.auth_token.refresh_from_db() self.assertTrue(user.auth_token.created > original_created_value) user.token_lifetime = original_token_lifetime user.save() with freeze_time(last_refresh_time): self.client.credentials(HTTP_AUTHORIZATION='Token ' + token) response = self.client.get(self.test_url) self.assertEqual(response.status_code, status.HTTP_200_OK) @helpers.override_waldur_core_settings(AUTHENTICATION_METHODS=[]) def test_authentication_fails_if_local_signin_is_disabled(self): response = self.client.post( self.auth_url, data={'username': self.username, 'password': self.password} ) self.assertEqual(response.status_code, status.HTTP_401_UNAUTHORIZED) self.assertTrue(b'Authentication method is disabled.' in response.content)
ayseyo/oclapi
django-nonrel/ocl/integration_tests/tests/openmrs_mapping_validation.py
Python
mpl-2.0
1,429
0.003499
from django.core.urlresolvers import reverse from mappings.tests import MappingBaseTest from mappings.validation_messages import OPENMRS_SINGLE_MAPPING_BETWEEN_TWO_CONCEPTS from oclapi.models import CUSTOM_VALIDATION_SCHEMA_OPENMRS from test_helper.base import create_user, create_source, create_concept class OpenMRSMappingCreateTest(MappingBaseTest): def test_create_mapping_duplicate_mapping_between_two_concepts(self): source = create_source(self.user1, validation_schema=CUSTOM_VALIDATION_SCHEMA_OPENMRS) (concept1, _) = create_concept(user=self.user1, source=source) (concept2, _) = create_concept(user=self.
user1, source=source) self.client.login(username='user1
', password='user1') kwargs = { 'source': source.mnemonic } mapping1 = { 'from_concept_url': concept1.url, 'to_concept_url': concept2.url, 'map_type': 'Same As' } mapping2 = { 'from_concept_url': concept1.url, 'to_concept_url': concept2.url, 'map_type': 'Narrower Than' } self.client.post(reverse('mapping-list', kwargs=kwargs), mapping1) response = self.client.post(reverse('mapping-list', kwargs=kwargs), mapping2) self.assertEquals(response.status_code, 400) self.assertEquals(response.data, {"errors": OPENMRS_SINGLE_MAPPING_BETWEEN_TWO_CONCEPTS})
Trust-Code/python-cnab
tests/test_registro.py
Python
mit
4,409
0.000454
import unittest from unittest import skip from decimal import Decimal from cnab240 import errors from cnab240.bancos import itau from tests.data import get_itau_data_from_file class TestRegistro(unittest.TestCase): def setUp(self): itau_data = get_itau_data_from_file() self.header_arquivo = itau_data['header_arquivo'] self.seg_p = itau_data['seg_p1'] self.seg_p_str = itau_data['seg_p1_str'] self.seg_q = itau_data['seg_q1'] self.seg_q_str = itau_data['seg_q1_str'] def test_leitura_campo_num_decimal(self): self.assertEqual(self.seg_p.valor_titulo, Decimal('10
0.00')) def test_escrita_campo_num_decimal(self): # aceitar s
omente tipo Decimal with self.assertRaises(errors.TipoError): self.seg_p.valor_titulo = 10.0 with self.assertRaises(errors.TipoError): self.seg_p.valor_titulo = '' # Testa se as casas decimais estao sendo verificadas with self.assertRaises(errors.NumDecimaisError): self.seg_p.valor_titulo = Decimal('100.2') with self.assertRaises(errors.NumDecimaisError): self.seg_p.valor_titulo = Decimal('1001') with self.assertRaises(errors.NumDecimaisError): self.seg_p.valor_titulo = Decimal('1.000') # verifica se o numero de digitos esta sendo verificado with self.assertRaises(errors.NumDigitosExcedidoError): self.seg_p.valor_titulo = Decimal('10000000008100.21') # armazemamento correto de um decimal self.seg_p.valor_titulo = Decimal('2.13') self.assertEqual(self.seg_p.valor_titulo, Decimal('2.13')) def test_leitura_campo_num_int(self): self.assertEqual(self.header_arquivo.controle_banco, 341) def test_escrita_campo_num_int(self): # aceitar somente inteiros (int e long) with self.assertRaises(errors.TipoError): self.header_arquivo.controle_banco = 10.0 with self.assertRaises(errors.TipoError): self.header_arquivo.controle_banco = '' # verifica se o numero de digitos esta sendo verificado with self.assertRaises(errors.NumDigitosExcedidoError): self.header_arquivo.controle_banco = 12345678234567890234567890 with self.assertRaises(errors.NumDigitosExcedidoError): self.header_arquivo.controle_banco = 1234 # verifica valor armazenado self.header_arquivo.controle_banco = 5 self.assertEqual(self.header_arquivo.controle_banco, 5) def test_leitura_campo_alfa(self): self.assertEqual(self.header_arquivo.cedente_nome, 'TRACY TECNOLOGIA LTDA ME') @skip def test_escrita_campo_alfa(self): # Testa que serao aceitos apenas unicode objects with self.assertRaises(errors.TipoError): self.header_arquivo.cedente_nome = 'tracy' # Testa que strings mais longas que obj.digitos nao serao aceitas with self.assertRaises(errors.NumDigitosExcedidoError): self.header_arquivo.cedente_convenio = '123456789012345678901' # Testa que o valor atribuido foi guardado no objeto self.header_arquivo.cedente_nome = 'tracy' self.assertEqual(self.header_arquivo.cedente_nome, 'tracy') def test_fromdict(self): header_dict = self.header_arquivo.todict() header_arquivo = itau.registros.HeaderArquivo(**header_dict) self.assertEqual(header_arquivo.cedente_nome, 'TRACY TECNOLOGIA LTDA ME') self.assertEqual(header_arquivo.nome_do_banco, 'BANCO ITAU SA') def test_necessario(self): self.assertTrue(self.seg_p) seg_p2 = itau.registros.SegmentoP() self.assertFalse(seg_p2.necessario()) seg_p2.controle_banco = 33 self.assertFalse(seg_p2.necessario()) seg_p2.vencimento_titulo = 10102012 self.assertTrue(seg_p2.necessario()) def test_unicode(self): def unicode_test(seg_instance, seg_str): seg_gen_str = str(seg_instance) self.assertEqual(len(seg_gen_str), 240) self.assertEqual(len(seg_str), 240) self.assertEqual(seg_gen_str, seg_str) unicode_test(self.seg_p, self.seg_p_str) unicode_test(self.seg_q, self.seg_q_str) if __name__ == '__main__': unittest.main()
Microvellum/Fluid-Designer
win64-vc/2.78/python/lib/asyncio/selector_events.py
Python
gpl-3.0
39,441
0.000076
"""Event loop using a selector and related classes. A selector is a "notify-when-ready" multiplexer. For a subclass which also includes support for signal handling, see the unix_events sub-module. """ __all__ = ['BaseSelectorEventLoop'] import collections import errno import functools import socket import warnings try: import ssl except ImportError: # pragma: no cover ssl = None from . import base_events from . import compat from . import constants from . import events from . import futures from . import selectors from . import transports from . import sslproto from .coroutines import coroutine from .log import logger def _test_selector_event(selector, fd, event): # Test if the selector is monitoring 'event' events # for the file descriptor 'fd'. try: key = selector.get_key(fd) except KeyError: return False else: return bool(key.events & event) class BaseSelectorEventLoop(base_events.BaseEventLoop): """Selector event loop. See events.EventLoop for API specification. """ def __init__(self, selector=None): super().__init__() if selector is None: selector = selectors.DefaultSelector() logger.debug('Using selector: %s', selector.__class__.__name__) self._selector = selector self._make_self_pipe() def _make_socket_transport(self, sock, protocol, waiter=None, *, extra=None, server=None): return _SelectorSocketTransport(self, sock, protocol, waiter, extra, server) def _make_ssl_transport(self, rawsock, protocol, sslcontext, waiter=None, *, server_side=False, server_hostname=None, extra=None, server=None): if not sslproto._is_sslproto_available(): return self._make_legacy_ssl_transport( rawsock, protocol, sslcontext, waiter, server_side=server_side, server_hostname=server_hostname, extra=extra, server=server) ssl_protocol = sslproto.SSLProtocol(self, protocol, sslcontext, waiter, server_side, server_hostname) _SelectorSocketTransport(self, rawsock, ssl_protocol, extra=extra, server=server) return ssl_protocol._app_transport def _make_legacy_ssl_transport(self, rawsock, protocol, sslcontext, waiter, *, server_side=False, server_hostname=None, extra=None, server=None): # Use the legacy API: SSL_write, SSL_read, etc. The legacy API is used # on Python 3.4 and older, when ssl.MemoryBIO is not available. return _SelectorSslTransport( self, rawsock, protocol, sslcontext, waiter, server_side, server_hostname, extra, server) def _make_datagram_transport(self, sock, protocol, address=None, waiter=None, extra=None): return _SelectorDatagramTransport(self, sock, protocol, address, waiter, extra) def close(self): if self.is_running(): raise RuntimeError("Cannot close a running event loop") if self.is_closed(): return self._close_self_pipe() super().close() if self._selector is not None: self._selector.close() self._selector = None def _socketpair(self): raise NotImplementedError def _close_self_pipe(self): self.remove_reader(self._ssock.fileno()) self._ssock.close() self._ssock = None self._csock.close() self._csock = None self._internal_fds -= 1 def _make_self_pipe(self): # A self-socket, really. :-) self._ssock, self._csock = self._socketpair() self._ssock.setblocking(False) self._csock.setblocking(False) self._internal_fds += 1 self.add_reader(self._ssock.fileno(), self._read_from_self) def _process_self_data(self, data): pass def _read_from_self(self): while True: try: data = self._ssock.recv(4096) if not data: break self._process_self_data(data) except InterruptedError:
continue except BlockingIOError: break def _write_to_self(self): # This may be called from a different thread, possibly after # _close_self_pipe() has been called or even while it is # running. Guard for self._csock being None or closed. When # a socket is closed, send() raises OSError (wi
th errno set to # EBADF, but let's not rely on the exact error code). csock = self._csock if csock is not None: try: csock.send(b'\0') except OSError: if self._debug: logger.debug("Fail to write a null byte into the " "self-pipe socket", exc_info=True) def _start_serving(self, protocol_factory, sock, sslcontext=None, server=None): self.add_reader(sock.fileno(), self._accept_connection, protocol_factory, sock, sslcontext, server) def _accept_connection(self, protocol_factory, sock, sslcontext=None, server=None): try: conn, addr = sock.accept() if self._debug: logger.debug("%r got a new connection from %r: %r", server, addr, conn) conn.setblocking(False) except (BlockingIOError, InterruptedError, ConnectionAbortedError): pass # False alarm. except OSError as exc: # There's nowhere to send the error, so just log it. if exc.errno in (errno.EMFILE, errno.ENFILE, errno.ENOBUFS, errno.ENOMEM): # Some platforms (e.g. Linux keep reporting the FD as # ready, so we remove the read handler temporarily. # We'll try again in a while. self.call_exception_handler({ 'message': 'socket.accept() out of system resource', 'exception': exc, 'socket': sock, }) self.remove_reader(sock.fileno()) self.call_later(constants.ACCEPT_RETRY_DELAY, self._start_serving, protocol_factory, sock, sslcontext, server) else: raise # The event loop will catch, log and ignore it. else: extra = {'peername': addr} accept = self._accept_connection2(protocol_factory, conn, extra, sslcontext, server) self.create_task(accept) @coroutine def _accept_connection2(self, protocol_factory, conn, extra, sslcontext=None, server=None): protocol = None transport = None try: protocol = protocol_factory() waiter = futures.Future(loop=self) if sslcontext: transport = self._make_ssl_transport( conn, protocol, sslcontext, waiter=waiter, server_side=True, extra=extra, server=server) else: transport = self._make_socket_transport( conn, protocol, waiter=waiter, extra=extra, server=server) try: yield from waiter except: transport.close() raise # It's now up to the protocol to handle the connection. except Exception as exc: if self._debug: context = { 'message': ('Error on transport creation ' 'for incoming connect
quartzmo/gcloud-ruby
google-cloud-bigquery-data_transfer/synth.py
Python
apache-2.0
3,453
0.001448
# Copyright 2018 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """This script is used to synthesize generated parts of this library.""" import synthtool as s import synthtool.gcp as gcp import synthtool.languages.ruby as ruby import logging import re logging.basicConfig(level=logging.DEBUG) gapic = gcp.GAPICGenerator() v1_library = gapic.ruby_library( 'bigquery/datatransfer', 'v1', artman_output_name='google-cloud-ruby/google-cloud-bigquer
ydatatransfer', config_path='artman_bigquerydatatransfer.yaml' ) s.copy(v1_library / 'acceptance') s.copy(v1_library / 'lib') s.copy(v1_library / 'test') s.copy(v1_library / 'README.md') s.copy(v1_library / 'LICENSE') s.copy(v1_library / '.gitignore') s.copy(v1_library / '.yardopts') s.copy(v1_library / 'google-cloud-bigquery-data_transfer.gemspec', merge=ruby.merge_ge
mspec) # PERMANENT: Use custom credentials env variable names s.replace( 'lib/google/cloud/bigquery/data_transfer/v1/credentials.rb', 'BIGQUERYDATATRANSFER_KEYFILE', 'DATA_TRANSFER_KEYFILE') s.replace( 'lib/google/cloud/bigquery/data_transfer/v1/credentials.rb', 'BIGQUERYDATATRANSFER_CREDENTIALS', 'DATA_TRANSFER_CREDENTIALS') # https://github.com/googleapis/gapic-generator/issues/2179 # https://github.com/googleapis/gapic-generator/issues/2196 s.replace( [ 'README.md', 'lib/google/cloud/bigquery/data_transfer.rb', 'lib/google/cloud/bigquery/data_transfer/v1.rb' ], '\\[Product Documentation\\]: https://cloud\\.google\\.com/bigquerydatatransfer\n', '[Product Documentation]: https://cloud.google.com/bigquery/transfer/\n') # https://github.com/googleapis/gapic-generator/issues/2242 def escape_braces(match): expr = re.compile('^([^`]*(`[^`]*`[^`]*)*)([^`#\\$\\\\])\\{([\\w,]+)\\}') content = match.group(0) while True: content, count = expr.subn('\\1\\3\\\\\\\\{\\4}', content) if count == 0: return content s.replace( 'lib/google/cloud/**/*.rb', '\n(\\s+)#[^\n]*[^\n#\\$\\\\]\\{[\\w,]+\\}', escape_braces) # https://github.com/googleapis/gapic-generator/issues/2243 s.replace( 'lib/google/cloud/bigquery/data_transfer/*/*_client.rb', '(\n\\s+class \\w+Client\n)(\\s+)(attr_reader :\\w+_stub)', '\\1\\2# @private\n\\2\\3') # https://github.com/googleapis/gapic-generator/issues/2279 s.replace( 'lib/**/*.rb', '\\A(((#[^\n]*)?\n)*# (Copyright \\d+|Generated by the protocol buffer compiler)[^\n]+\n(#[^\n]*\n)*\n)([^\n])', '\\1\n\\6') # https://github.com/googleapis/gapic-generator/issues/2323 s.replace( [ 'lib/**/*.rb', 'README.md' ], 'https://github\\.com/GoogleCloudPlatform/google-cloud-ruby', 'https://github.com/googleapis/google-cloud-ruby' ) s.replace( [ 'lib/**/*.rb', 'README.md' ], 'https://googlecloudplatform\\.github\\.io/google-cloud-ruby', 'https://googleapis.github.io/google-cloud-ruby' )
coxley/trigger
trigger/utils/notifications/events.py
Python
bsd-3-clause
4,682
0.001495
# -*- coding: utf-8 -*- """ Event objects for the notification system. These are intended to be used within event handlers such as `~trigger.utils.notifications.handlers.email_handler()`. If not customized within :setting:`NOTIFICATION_HANDLERS`, the default notification type is an `~trigger.utils.notification.events.EmailEvent` that is handled by `~trigger.utils.notifications.handlers.email_handler`. """ __author__ = 'Jathan McCollum' __maintainer__ = 'Jathan McCollum' __email__ = '[email protected]' __copyright__ = 'Copyright 2012-2012, AOL Inc.' import socket from trigger.conf import settings # Exports __all__ = ('Event', 'Notification', 'EmailEvent') # Classes class Event(object): """ Base class for events. It just populates the attribute dict with all keyword arguments thrown at the constructor. All ``Event`` objects are expected to have a ``.handle()`` method that willl be called by a handler function. Any user-defined event objects must have a working ``.handle()`` method that returns ``True`` upon success or ``None`` upon a failure when handling the event passed to it. If you specify ``required_args``, these must have a value other than ``None`` when passed to the constructor. """ required_args = () def __init__(self, **kwargs): self.__dict__.update(kwargs) # Brute force wins! local_vars = self.__dict__ for var, value in local_vars.iteritems(): if var in self.required_args and value is None: raise SyntaxError('`%s` is a required argument' % var) def __repr__(self): return '<%s>' % self.__class__.__name__ def handle(self): raise NotImplementedError('Define me in your subclass!') class Notification(Event): """ Base class for notification events. The ``title`` and ``message`` arguments are the only two that are required. This is to simplify the interface when sending notifications and will cause notifications to send from the default ``sender to the default ``recipients`` that are specified withing the global settings. If ``sender`` or ``recipients`` are specified, they will override the global defaults. Note that this base class has no ``.handle()`` method defined. :param title: The title/subject of the notification :param message: The message/body of the notification :param sender: A string representing the sender of the notification (such as an email address or a hostname) :param recipients: An iterable containing strings representing the recipients of of the notification (such as a list of emails or hostnames) :param event_status: Whether this event is a `failure` or a `success` """ required_args = ('title', 'message') status_map = { 'success': settings.SUCCESS_RECIPIENTS, 'failure': settings.FAILURE_RECIPIENTS, } default_sender = settings.NOTIFICATION_SENDER def __init__(self, title=None, message=None, sender=None, recipients=None, event_status='failure', **kwargs): self.title = title self.message = message # If the sender isn't specified, use the global sender if sender is None: sender = self.default_sender self.sender = sender # We want to know whether we're sending a failure or success email if event_status not in self.status_map: raise SyntaxError('`event_status` must be in `status_map`') self.event_status = event_status # If recipients aren't specified, use the global success/failure # recipients if recipients is None: recipients = self.status_map.get(self.event_status) self.recipients = recipients super(Notification, self).__init__(**kwargs) self.kwargs = kwargs class EmailEvent(Notification): """ An email notification event. """ default_sender = settings.EMAIL_SENDER status_map = { 'success': settings.SUCCESS_EMAILS, 'failure': settings.FAILURE_EMAILS, } mailhost = 'localhost' def handle(self): from trig
ger.utils.notifications i
mport send_email try: # This should return True upon successfully sending email e = self return send_email(addresses=e.recipients, subject=e.title, body=e.message, sender=e.sender, mailhost=e.mailhost) except Exception as err: print 'Got exception', err return None
allenlavoie/tensorflow
tensorflow/contrib/model_pruning/python/pruning_test.py
Python
apache-2.0
9,014
0.006989
# Copyright 2017 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Tests for the key functions in pruning library.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function import numpy as np from tensorflow.contrib.model_pruning.python import pruning from tensorflow.python.framework import constant_op from tensorflow.python.ops import math_ops from tensorflow.python.ops import partitioned_variables from tensorflow.python.ops import random_ops from tensorflow.python.ops import state_ops from tensorflow.python.ops import variable_scope from tensorflow.python.ops import variables from tensorflow.python.platform import test from tensorflow.python.training import training_util class PruningHParamsTest(test.TestCase): PARAM_LIST = [ "name=test", "threshold_decay=0.9", "pruning_frequency=10", "do_not_prune=[conv1,conv2]", "sparsity_function_end_step=100", "target_sparsity=0.9" ] TEST_HPARAMS = ",".join(PARAM_LIST) def setUp(self): super(PruningHParamsTest, self).setUp() # Add global step variable to the graph self.global_step = training_util.get_or_create_global_step() # Add sparsity self.sparsity = variables.Variable(0.5, name="sparsity") # Parse hparams self.pruning_hparams = pruning.get_pruning_hparams().parse( self.TEST_HPARAMS) def testInit(self): p = pruning.Pruning(self.pruning_hparams) self.assertEqual(p._spec.name, "test") self.assertAlmostEqual(p._spec.threshold_decay, 0.9) self.assertEqual(p._spec.pruning_frequency, 10) self.assertAllEqual(p._spec.do_not_prune, ["conv1", "conv2"]) self.assertEqual(p._spec.sparsity_function_end_step, 100) self.assertAlmostEqual(p._spec.target_sparsity, 0.9) def testInitWithExternalSparsity(self): with self.test_session(): p = pruning.Pruning(spec=self.pruning_hparams, sparsity=self.sparsity) variables.global_variables_initializer().run() sparsity = p._sparsity.eval() self.assertAlmostEqual(sparsity, 0.5) def testInitWithVariableReuse(self): with self.test_session(): p = pruning.Pruning(spec=self.pruning_hparams, sparsity=self.sparsity) p_copy = pruning.Pruning( spec=self.pruning_hparams, sparsity=self.sparsity) variables.global_variables_initializer().run() sparsity = p._sparsity.eval() self.assertAlmostEqual(sparsity, 0.5
) self.assertEqual(p._sparsity.eval(), p_copy._sparsity.eval()) class PruningTest(test.TestCase): def setUp(self): super(PruningTest, self).setUp() self.global_step = training_util.get_or_create_global_step() def testCreateMask2D(self): width = 10 height = 20 with self.test_session(): weig
hts = variables.Variable( random_ops.random_normal([width, height], stddev=1), name="weights") masked_weights = pruning.apply_mask(weights, variable_scope.get_variable_scope()) variables.global_variables_initializer().run() weights_val = weights.eval() masked_weights_val = masked_weights.eval() self.assertAllEqual(weights_val, masked_weights_val) def testUpdateSingleMask(self): with self.test_session() as session: weights = variables.Variable( math_ops.linspace(1.0, 100.0, 100), name="weights") masked_weights = pruning.apply_mask(weights) sparsity = variables.Variable(0.5, name="sparsity") p = pruning.Pruning(sparsity=sparsity) p._spec.threshold_decay = 0.0 mask_update_op = p.mask_update_op() variables.global_variables_initializer().run() masked_weights_val = masked_weights.eval() self.assertAllEqual(np.count_nonzero(masked_weights_val), 100) session.run(mask_update_op) masked_weights_val = masked_weights.eval() self.assertAllEqual(np.count_nonzero(masked_weights_val), 51) def _blockMasking(self, hparams, weights, expected_mask): threshold = variables.Variable(0.0, name="threshold") sparsity = variables.Variable(0.51, name="sparsity") test_spec = ",".join(hparams) pruning_hparams = pruning.get_pruning_hparams().parse(test_spec) # Set up pruning p = pruning.Pruning(pruning_hparams, sparsity=sparsity) with self.test_session(): variables.global_variables_initializer().run() _, new_mask = p._maybe_update_block_mask(weights, threshold) # Check if the mask is the same size as the weights self.assertAllEqual(new_mask.get_shape(), weights.get_shape()) mask_val = new_mask.eval() self.assertAllEqual(mask_val, expected_mask) def testBlockMasking(self): param_list = ["block_height=2", "block_width=2", "threshold_decay=0"] weights_avg = constant_op.constant( [[0.1, 0.1, 0.2, 0.2], [0.1, 0.1, 0.2, 0.2], [0.3, 0.3, 0.4, 0.4], [0.3, 0.3, 0.4, 0.4]]) weights_max = constant_op.constant( [[0.1, 0.0, 0.2, 0.0], [0.0, -0.1, 0.0, -0.2], [0.3, 0.0, 0.4, 0.0], [0.0, -0.3, 0.0, -0.4]]) expected_mask = [[0, 0, 0, 0], [0, 0, 0, 0], [1, 1, 1, 1], [1, 1, 1, 1]] self._blockMasking(param_list + ["block_pooling_function=MAX"], weights_max, expected_mask) self._blockMasking(param_list + ["block_pooling_function=AVG"], weights_avg, expected_mask) def testBlockMaskingWithHigherDimensions(self): param_list = ["block_height=2", "block_width=2", "threshold_decay=0"] # Weights as in testBlockMasking, but with one extra dimension. weights_avg = constant_op.constant( [[[0.1, 0.1, 0.2, 0.2], [0.1, 0.1, 0.2, 0.2], [0.3, 0.3, 0.4, 0.4], [0.3, 0.3, 0.4, 0.4]]]) weights_max = constant_op.constant( [[[0.1, 0.0, 0.2, 0.0], [0.0, -0.1, 0.0, -0.2], [0.3, 0.0, 0.4, 0.0], [0.0, -0.3, 0.0, -0.4]]]) expected_mask = [[[0, 0, 0, 0], [0, 0, 0, 0], [1, 1, 1, 1], [1, 1, 1, 1]]] self._blockMasking(param_list + ["block_pooling_function=MAX"], weights_max, expected_mask) self._blockMasking(param_list + ["block_pooling_function=AVG"], weights_avg, expected_mask) def testPartitionedVariableMasking(self): partitioner = partitioned_variables.variable_axis_size_partitioner(40) with self.test_session() as session: with variable_scope.variable_scope("", partitioner=partitioner): sparsity = variables.Variable(0.5, name="Sparsity") weights = variable_scope.get_variable( "weights", initializer=math_ops.linspace(1.0, 100.0, 100)) masked_weights = pruning.apply_mask( weights, scope=variable_scope.get_variable_scope()) p = pruning.Pruning(sparsity=sparsity) p._spec.threshold_decay = 0.0 mask_update_op = p.mask_update_op() variables.global_variables_initializer().run() masked_weights_val = masked_weights.eval() session.run(mask_update_op) masked_weights_val = masked_weights.eval() self.assertAllEqual(np.count_nonzero(masked_weights_val), 51) def testConditionalMaskUpdate(self): param_list = [ "pruning_frequency=2", "begin_pruning_step=1", "end_pruning_step=6" ] test_spec = ",".join(param_list) pruning_hparams = pruning.get_pruning_hparams().parse(test_spec) weights = variables.Variable( math_ops.linspace(1.0, 100.0, 100), name="weights") masked_weights = pruning.apply_mask(weights) sparsity = variables.Variable(0.00, name="sparsity") # Set up pruning p = pruning
kfcpaladin/sze-the-game
renpy/display/joystick.py
Python
mit
1,793
0.001673
# Copyright 2004-2017 Tom Rothamel <[email protected]> # # Permission is hereby granted, free of charge, to any person # obtaining a copy of this software and associated documentation files # (the "Software"), to deal in the Software without restriction, # including without limitation the rights to use, copy, modify, merge, # publish, distribute, sublicense, and/or sell copies of the Software, # and to permit persons to whom the Software is furnished to do so, # subject to the following conditions: # # The above copyright notice and this permission notice shall be # included in all copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF
ANY KIND, # EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF # MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND # NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE # LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION # OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION # WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. # This file was responsible for joystick support in Ren'Py, which has # been removed, s
ave for a few compatibility functions. import renpy.display import pygame_sdl2 # Do we have a joystick enabled? enabled = False class JoyBehavior(renpy.display.layout.Null): """ This is a behavior intended for joystick calibration. If a joystick event occurs, this returns it as a string. """ pass joysticks = { } def count(): return pygame_sdl2.joystick.get_count() def get(n): if n in joysticks: return joysticks[n] try: joysticks[n] = pygame_sdl2.joystick.Joystick(n) return joysticks[n] except: return None
rdo-management/neutron
neutron/openstack/common/eventlet_backdoor.py
Python
apache-2.0
4,859
0
# Copyright (c) 2012 OpenStack Foundation. # Administrator of the National Aeronautics and Space Administration. # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. from __future__ import print_function import copy import errno import gc import logging import os import pprint import socket import sys import traceback import eventlet.backdoor import greenlet from oslo_config import cfg from neutron.openstack.common._i18n import _LI help_for_backdoor_port = ( "Acceptable values are 0, <port>, and <start>:<end>, where 0 results " "in listening on a random tcp port number; <port> results in listening " "on the specified port number (and not enabling backdoor if that port " "is in use); and <start>:<end> results in listening on the smallest " "unused port number within the specified range of port numbers. The " "chosen port is displayed in the service's log file.") eventlet_backdoor_opts = [ cfg.StrOpt('backdoor_port', help="Enable eventlet backdoor. %s" % help_for_backdoor_port) ] CONF = cfg.CONF CONF.register_opts(eventlet_backdoor_opts) LOG = logging.getLogger(__name__) def list_opts(): """Entry point for oslo-config-generator. """ return [(None, copy.deepcopy(eventlet_backdoor_opts))] class EventletBackdoorConfigValueError(Exception): def __init__(self, port_range, help_msg, ex): msg = ('Invalid backdoor_port configuration %(range)s: %(ex)s. ' '%(help)s' % {'range': port_range, 'ex': ex, 'help': help_msg}) super(EventletBackdoorConfigValueError, self).__init__(msg) self.port_range = port_range def _dont_use_this(): print("Don't use this, just disconnect instead") def _find_objects(t): return [o for o in gc.get_objects() if isinstance(o, t)] def _print_greenthreads(): for i, gt in enumerate(_find_objects(greenlet.greenlet)): print(i, gt) traceback.print_stack(gt.gr_frame) print() def _print_nativethreads(): for threadId, stack in sys._current_frames().items(): print(threadId) traceback.print_stack(stack) print() def _parse_port_range(port_range): if ':' not in port_range: start, end = port_range, port_range else: start, end = port_range.split(':', 1) try: start, end = int(start), int(end) if end < start: raise ValueError return start, end except ValueError as ex: raise EventletBackdoorConfigValueErr
or(port_range, ex, help_for_backdoor_port) def _listen(host, start_port, end_port, listen_fu
nc): try_port = start_port while True: try: return listen_func((host, try_port)) except socket.error as exc: if (exc.errno != errno.EADDRINUSE or try_port >= end_port): raise try_port += 1 def initialize_if_enabled(): backdoor_locals = { 'exit': _dont_use_this, # So we don't exit the entire process 'quit': _dont_use_this, # So we don't exit the entire process 'fo': _find_objects, 'pgt': _print_greenthreads, 'pnt': _print_nativethreads, } if CONF.backdoor_port is None: return None start_port, end_port = _parse_port_range(str(CONF.backdoor_port)) # NOTE(johannes): The standard sys.displayhook will print the value of # the last expression and set it to __builtin__._, which overwrites # the __builtin__._ that gettext sets. Let's switch to using pprint # since it won't interact poorly with gettext, and it's easier to # read the output too. def displayhook(val): if val is not None: pprint.pprint(val) sys.displayhook = displayhook sock = _listen('localhost', start_port, end_port, eventlet.listen) # In the case of backdoor port being zero, a port number is assigned by # listen(). In any case, pull the port number out here. port = sock.getsockname()[1] LOG.info( _LI('Eventlet backdoor listening on %(port)s for process %(pid)d') % {'port': port, 'pid': os.getpid()} ) eventlet.spawn_n(eventlet.backdoor.backdoor_server, sock, locals=backdoor_locals) return port
mindbody/API-Examples
SDKs/Python/test/test_custom_payment_method.py
Python
bsd-2-clause
980
0
# coding: utf-8 """ MINDBODY Public API No description provided (generated by Swagger Codegen https://github.com/swagger-api/swagger-codegen) # noqa: E501 OpenAPI spec version: v6 Generated by: https://github.com/swagger-api/swagger-codegen.git """ from __future__ import absolute_import import un
ittest import swagger_client from swag
ger_client.models.custom_payment_method import CustomPaymentMethod # noqa: E501 from swagger_client.rest import ApiException class TestCustomPaymentMethod(unittest.TestCase): """CustomPaymentMethod unit test stubs""" def setUp(self): pass def tearDown(self): pass def testCustomPaymentMethod(self): """Test CustomPaymentMethod""" # FIXME: construct object with mandatory attributes with example values # model = swagger_client.models.custom_payment_method.CustomPaymentMethod() # noqa: E501 pass if __name__ == '__main__': unittest.main()
SymbiFlow/prjxray
fuzzers/031-cmt-mmcm/generate.py
Python
isc
3,572
0.00056
#!/usr/bin/env python3 # -*- coding: utf-8 -*- # # Copyright (C) 2017-2020 The Project X-Ray Authors. # # Use of this source code is governed by a ISC-style # license that can be found in the LICENSE file or at # https://opensource.org/licenses/ISC # # SPDX-License-Identifier: ISC import json from prjxray.segmaker import Segmaker from prjxray import verilog def bitfilter(frame, word): if frame < 28: return False return True def bus_tags(segmk, ps, all_params, site): segmk.add_site_tag(site, 'IN_USE', ps['active']) if not ps['active']: return params = all_params[site]["params"] #for k in ps: # segmk.add_site_tag(site, 'param_' + k + '_' + str(ps[k]), 1) for reg, invert in [ ('RST', 1), ('PWRDWN', 1), ('CLKINSEL', 0), ('PSEN', 1), ('PSINCDEC', 1), ]: opt = 'IS_{}_INVERTED'.format(reg) if invert: segmk.add_site_tag(site, 'ZINV_' + reg, 1 ^ ps[opt]) else: segmk.add_site_tag(site, 'INV_' + reg, ps[opt]) for opt in ['OPTIMIZED', 'HIGH', 'LOW']: if verilog.unquote(ps['BANDWIDTH']) == opt: segmk.add_site_tag(site, 'BANDWIDTH.' + opt, 1) elif verilog.unquote(ps['BANDWIDTH']) == 'LOW': segmk.add_site_tag(site, 'BANDWIDTH.' + opt, 0) # "INTERNAL" compensation conflicts with the CLKFBOUT2IN->CLKFBIN PIP. # There is no telling which of these two is actually controlled by those # bits. It is better to leave them for the PIP. COMPENSATION_OPTS = ['ZHOLD', 'BUF_IN', 'EXTERNAL'] for opt in COMPENSATION_OPTS: val = params["COMPENSATION"] == opt segmk.add_site_tag(site, "COMP.{}".format(opt), val) segmk.add_site_tag(site, "COMP.Z_{}".format(opt), not val) opt = (verilog.unquote(ps["SS_EN"]) == "TRUE") segmk.add_site_tag(site, "SS_EN", opt) for param in ['CLKFBOUT_MULT_F']: paramadj = int(ps[param]) bitstr = [int(x) for x in "{0:09b}".format(paramadj)[::-1]] for i in range(7): segmk.add_site_tag(site, '%s[%u]' % (param, i), bitstr[i]) for param in ['CLKOUT0_DUTY_CYCLE']: assert ps[param][:2] == '0.', ps[param] assert len(ps[param]) == 5 paramadj = int(ps[param][2:]) bitstr = [int(x) for x in
"{0:011b}"
.format(paramadj)[::-1]] for i in range(10): segmk.add_site_tag(site, '%s[%u]' % (param, i), bitstr[i]) for param, bits in [ ('CLKOUT0_DIVIDE_F', 7), ('CLKOUT1_DIVIDE', 7), ('CLKOUT2_DIVIDE', 7), ('CLKOUT3_DIVIDE', 7), ('CLKOUT4_DIVIDE', 7), ('CLKOUT5_DIVIDE', 7), ('CLKOUT6_DIVIDE', 7), ('DIVCLK_DIVIDE', 6), ]: # 1-128 => 0-127 for actual 7 bit value paramadj = int(ps[param]) if paramadj < 4: continue bitstr = [int(x) for x in "{0:09b}".format(paramadj)[::-1]] for i in range(bits): segmk.add_site_tag(site, '%s[%u]' % (param, i), bitstr[i]) segmk.add_site_tag( site, 'STARTUP_WAIT', verilog.unquote(ps['STARTUP_WAIT']) == 'TRUE') def run(): segmk = Segmaker("design.bits") print("Loading params") f = open("params.json") params = json.load(f) params = {p["site"]: p for p in params} print("Loading tags") f = open('params.jl', 'r') f.readline() for l in f: j = json.loads(l) bus_tags(segmk, j, params, j['site']) segmk.compile(bitfilter=bitfilter) segmk.write() run()
EnTeQuAk/dotfiles
sublime-text-3/Packages/Search in Project/searchengines/grep.py
Python
unlicense
953
0.018888
### Start of fixing import paths import os, sys, inspect # realpath() with make your script run, even if you symlink it :) cmd_folder = os.path.realpath(os.path.abspath(os.path.split(inspect.getfile( inspect.currentframe() ))[0])) if cmd_folder not in sys.path: sys.path.insert(0, cmd_folder) # use this if you want to include modules from a subforder cmd_subfolder = os.path.realpath(os.path.abspath(os.path.join(os.path.split(inspect.getfile( inspect.currentframe() ))[0],"subfolder"))) if cmd_subfolder not in sys.path: sys.path.insert(0, cmd_subfolder) # Info: # cmd_folder = os.path.dirname(os.path.abspath(__file__)) # DO NOT USE __file__ !!! # __file__ fails if script is called i
n different ways on Windows # __file__ fails if someone does os.chdir() before # sys.argv[0] also fails because i
t doesn't not always contains the path ### End of fixing import paths import base class Grep (base.Base): pass engine_class = Grep
yaukwankiu/armor
tests/imageToDataTest4.py
Python
cc0-1.0
5,132
0.01286
# attempting the classify the charts, after armo
r/tests/imageToDataTest3.py # Plan: 1. compute features and store them # 2. classify # 3. display # #sleepTime= 140000 sleepTime =0 import time print time.asctime() print 'sleeping now for ', sleepTime, 'seconds' time.sleep(sleepTime) import os import time import pickle import numpy as np from armor import pattern dbz = pattern.DBZ dp = pattern.dp plt = patte
rn.plt inputFolder = dp.defaultImageDataFolder + 'charts2-allinone-/' imageFolder = dp.root + 'labLogs2/charts2_extracted/' outputFolder = dp.root + 'labLogs2/charts2_features/' try: os.makedirs(outputFolder) except: print outputFolder, 'exists' N = 500 L = os.listdir(inputFolder) L = [v for v in L if v.startswith('2014') or v.startswith('2013')] #L = os.listdir(imageFolder) if 'MOS' in L[0]: L = [l[:4] + l[5:7] + l[8:10] + '.' + l[11:15] for l in L] else: L = [l[:-4] for l in L] L.sort() print len(L) print L[:10] R = np.random.random(N) R = (R*len(L)).astype(int) R = [L[v] for v in R] R[:10] #R = [l[:4] + l[5:7] + l[8:10] + '.' + l[11:15] for l in R] R[:10] R = [dbz(v) for v in R] R[:10] """ ############## # test case a = R[0] print a.dataTime a.loadImage(rawImage=True) a.show() # a.loadImage() a.show() # a1 = a.connectedComponents() a2 = a.above(51).connectedComponents() a1.show(block=True) a2.show(block=True) # get the components M1 = a1.matrix.max() M2 = a2.matrix.max() components1 = [(a1.matrix==v).sum() for v in range(M1+1)] components2 = [(a2.matrix==v).sum() for v in range(M2+1)] #components1 = sorted([(a1.matrix==v).sum() for v in range(M1+1)][1:], reverse=True) #components2 = sorted([(a2.matrix==v).sum() for v in range(M2+1)][1:], reverse=True) #components1 = [v for v in components1 if v>=100] #components2 = [v for v in components2 if v>=10] print sorted(components1, reverse=True)[1:] print sorted(components2, reverse=True)[1:] # get the moments from armor.geometry import moments as mmt HuPowers = np.array([2., 4., 6., 6., 12., 8., 12.]) HuPowers = (HuPowers)**-1 moments1 = np.array([mmt.HuMoments(a1.matrix==v)**HuPowers for v in range(len(components1))]) moments2 = np.array([mmt.HuMoments(a2.matrix==v)**HuPowers for v in range(len(components2))]) print moments1 print moments2 # defining the features numberOfComponents = len([v for v in components1[1:] if v>=100]) # region of at least 100 pixels volume = a1.matrix.sum() + a2.matrix.sum() features = { 'dataTime' : a.dataTime, 'globalFeatures' : a1.globalShapeFeatures(lowerThreshold=1, upperThreshold=51,), 'localFeatures' : [a1.levelSet(v).globalShapeFeatures() for v in range(len(components1))], # this includes the "background" } pickle.dump(features, open('features_' + a.dataTime +'.pydump','w')) # end test case ############################## """ ########### # later # ########### count = 0 for imageName in L: count +=1 dataTime = imageName print dataTime if os.path.exists(outputFolder+'features_' + dataTime +'.pydump'): continue a=dbz(dataTime) a.loadImage() a.show() a1 = a.connectedComponents() a2 = a.above(51).connectedComponents() #if count < 1: # print 'waiting for check' # a1.show(block=True) # print 'waiting for check' # a2.show(block=True) #elif count==3: # print 'it runs from now on, no more a1.show(block=True)' # get the components M1 = a1.matrix.max() M2 = a2.matrix.max() components1 = [(a1.matrix==v).sum() for v in range(M1+1)] components2 = [(a2.matrix==v).sum() for v in range(M2+1)] print sorted(components1, reverse=True)[1:] print sorted(components2, reverse=True)[1:] # defining the features numberOfComponents = len([v for v in components1[1:] if v>=100]) # region of at least 100 pixels volume = a1.matrix.sum() + a2.matrix.sum() synopsis = "volume: " + str(volume) +'\n' synopsis += "major components: " + str(sorted(components1, reverse=True)[1:]) print synopsis features = { 'dataTime' : a.dataTime, 'globalFeatures' : a1.globalShapeFeatures(lowerThreshold=1, upperThreshold=51,), 'localFeatures' : [a1.levelSet(v).globalShapeFeatures() for v in range(len(components1))], 'synopsis' : synopsis , } pickle.dump(features, open(outputFolder+'features_' + a.dataTime +'.pydump','w')) """ for a in R: a.imagePath = outputFolder+a.dataTime+'.png' if os.path.exists(a.imagePath): continue a.loadImage() b = a.copy() b.loadImage(rawImage=True) plt.subplot(121) plt.imshow(b.matrix, origin='lower') plt.subplot(122) plt.imshow(a.matrix, origin='lower') plt.title(a.dataTime) plt.savefig(a.imagePath) plt.show(block=False) print 'sleeping 2 seconds' time.sleep(2) if N>=100: a.matrix=np.array([0]) #free up some memory """
Pulgama/supriya
supriya/nonrealtime/NodeTransition.py
Python
mit
4,163
0.001441
import supriya.commands import supriya.realtime from supriya.system.SupriyaValueObject import SupriyaValueObject class NodeTransition(SupriyaValueObject): """ A non-realtime state transition. """ ### CLASS VARIABLES ### __documentation_section__ = "Session Internals" __slots__ = ("_source", "_target", "_action") ### INITIALIZER ### def __init__(self, source=None, action=None, target=None): if action is not None: action = supriya.AddAction.from_expr(action) assert isinstance(action, supriya.AddAction) assert source is not target if action is None: assert source is not None assert target is None self._action = action self._source = source self._target = target ### PRIVATE METHODS ### def _free_node(self, nodes_to_children, nodes_to_parents): node = self.source for child in nodes_to_children.get(node, ()) or (): self.free_node(child, nodes_to_children, nodes_to_paren
ts) parent = nodes_to_parents.get(node, None) if node in nodes_to_children: del nodes_to_children[node]
if node in nodes_to_parents: del nodes_to_parents[node] if not parent: return children = list(nodes_to_children[parent]) children.remove(node) nodes_to_children[parent] = tuple(children) or None def _move_node(self, nodes_to_children, nodes_to_parents): assert self.target in nodes_to_children if self.source not in nodes_to_children: nodes_to_children[self.source] = None old_parent = nodes_to_parents.get(self.source, None) if old_parent: children = list(nodes_to_children[old_parent]) children.remove(self.source) nodes_to_children[old_parent] = tuple(children) or None if self.action in (supriya.AddAction.ADD_AFTER, supriya.AddAction.ADD_BEFORE): new_parent = nodes_to_parents[self.target] else: new_parent = self.target nodes_to_parents[self.source] = new_parent children = list(nodes_to_children.get(new_parent, None) or ()) if self.action == supriya.AddAction.ADD_TO_HEAD: children.insert(0, self.source) elif self.action == supriya.AddAction.ADD_TO_TAIL: children.append(self.source) elif self.action == supriya.AddAction.ADD_BEFORE: index = children.index(self.target) children.insert(index, self.source) elif self.action == supriya.AddAction.ADD_AFTER: index = children.index(self.target) + 1 children.insert(index, self.source) nodes_to_children[new_parent] = tuple(children) or None def _to_request(self, id_mapping): node_id_pair = (id_mapping[self.source], id_mapping[self.target]) if self.action == supriya.AddAction.ADD_TO_HEAD: request_class = supriya.commands.GroupHeadRequest elif self.action == supriya.AddAction.ADD_TO_TAIL: request_class = supriya.commands.GroupTailRequest elif self.action == supriya.AddAction.ADD_BEFORE: request_class = supriya.commands.NodeBeforeRequest elif self.action == supriya.AddAction.ADD_AFTER: request_class = supriya.commands.NodeAfterRequest request = request_class(node_id_pairs=[node_id_pair]) return request ### PUBLIC METHODS ### def apply_transform(self, nodes_to_children, nodes_to_parents): if self.action is None: self._free_node(nodes_to_children, nodes_to_parents) else: self._move_node(nodes_to_children, nodes_to_parents) @classmethod def free_node(cls, node, nodes_to_children, nodes_to_parents): action = cls(source=node) action.apply_transform(nodes_to_children, nodes_to_parents) ### PUBLIC PROPERTIES ### @property def action(self): return self._action @property def source(self): return self._source @property def target(self): return self._target
siddhantgoel/streaming-form-data
examples/tornado/stream_request_body.py
Python
mit
1,487
0
import os.path import tempfile from time import time from streaming_form_data import StreamingFormDataParser from streaming_form_data.targets import FileTarget, ValueTarget
from tornado.ioloop import IOLoop from tornado.web import Application,
RequestHandler, stream_request_body one_hundred_gb = 100 * 1024 * 1024 * 1024 @stream_request_body class UploadHandler(RequestHandler): def prepare(self): self.request.connection.set_max_body_size(one_hundred_gb) name = 'uploaded-file-tornado-{}.dat'.format(int(time())) self.value = ValueTarget() self.file_ = FileTarget(os.path.join(tempfile.gettempdir(), name)) self._parser = StreamingFormDataParser(headers=self.request.headers) self._parser.register('name', self.value) self._parser.register('file', self.file_) def data_received(self, chunk): self._parser.data_received(chunk) def post(self): self.render( 'upload.html', name=self.value.value, filename=self.file_.filename ) class IndexHandler(RequestHandler): def get(self): self.render('index.html') def main(): handlers = [(r'/', IndexHandler), (r'/upload', UploadHandler)] settings = dict(debug=True, template_path=os.path.dirname(__file__)) app = Application(handlers, **settings) app.listen(9999, address='localhost') IOLoop().current().start() if __name__ == '__main__': print('Listening on localhost:9999') main()
kevgraham7/toolbox
python/samples/git-tools/util/log_setup.py
Python
apache-2.0
1,033
0.001936
import logging class BorgSingleton: _shared_state = {} def __init__(self): self.__dict__ = self._shared_state class LoggerSetup(BorgSingleton): """Logger setup convenience class""" DEFAULT_FORMAT = '%(asctime)s - %(name)s - %(levelname)s - %(message)s' def __init__(self, logger_name, log_level=logging.INFO, log_file=None, log_format=DEFAULT_FORMAT): BorgSingleton.__init__(self) self.__logger_name = logger_name logger = logging.getLogger(self.__logger_name) logger.setLevel(log_level)
if log_file: self.add_log_file(log_file, log_level, log_format) def add_log_file(self, log_file, level=logging.INFO, log_format=DEFAULT_FORMAT): file_handler
= logging.FileHandler(log_file) file_handler.setLevel(level) file_handler.setFormatter(logging.Formatter(log_format)) logging.getLogger(self.__logger_name).addHandler(file_handler) def get_logger(self): return logging.getLogger(self.__logger_name)
nitely/Spirit
spirit/comment/bookmark/urls.py
Python
mit
273
0
# -*- coding: utf-8 -
*- from django.conf.urls import re_path from . import views app_name = 'bookmark' urlpatterns = [ re_path(r'^(?P<topic_id>[0-9]+)/create/$', views.create, name='cre
ate'), re_path(r'^(?P<topic_id>[0-9]+)/find/$', views.find, name='find'), ]
verma-varsha/zulip
zerver/management/commands/enqueue_digest_emails.py
Python
apache-2.0
728
0.002747
from __future__ import absolute_import import datetime from typing import Any, List from django.conf import settings from django.core.management.base import BaseCommand from django.utils.timezone import now as timezone_now fr
om zerver.lib.digest import enqueue_emails, DIGEST_CUTOFF from zerver.lib.logging_util import create_logger ## Logging setup ## logger = create_logger(__name__, settings.DIGEST_LOG_PATH, 'DEBUG') class Command(BaseCommand): help = """Enqueue digest emails for users that haven't checked the app in a while. """ def handle(self, *args, **options): # type: (*Any, **Any) -> None
cutoff = timezone_now() - datetime.timedelta(days=DIGEST_CUTOFF) enqueue_emails(cutoff)
obi-two/Rebelion
data/scripts/templates/object/mobile/shared_space_rebel_tier3_ezkiel.py
Python
mit
452
0.04646
#### NOTICE: THIS FILE IS AUTOGENERATED #### MODIFICATION
S MAY BE LOST IF DONE IMPROPERLY #### PLEASE SEE THE ONLINE DOCUMENTATION FOR EXAMPLES from swgpy.object import * def create(kernel): result = Creature() result.template = "object/mobile/shared_space_rebel_tier3_ezkiel.iff" result.attribute_template_id = 9 result.stfName("npc_name","ishi_tib_base_male") #### BEGI
N MODIFICATIONS #### #### END MODIFICATIONS #### return result
renzon/fatec-script
backend/appengine/pythonicos.py
Python
mit
1,283
0.003118
# -*- coding: utf-8 -*- from __future__ import absolute_import, unicode_literals from random import shuffle class Carta(): def __init__(self, numero, naipe): self.numero = numero self.naipe = naipe def __repr__(self): return '%s de %s' % (self.numero, self.naipe) class Baralho(): def __init__(self): s
elf._cartas = [Carta(numero, naipe) for numero in 'As 1 2 3 4 5 6 7 8 9 10 Q J K'.split() for naipe in 'Ouros Espadas Copas Paus'.split()] def __getitem__(self, index): return self._cartas[index] def __setitem__(self, key, value): self._cartas[key] = value def __len__(self): return len(self._cartas) print Carta('As', 'P
aus') baralho = Baralho() baralho[55] = Carta('As', 'Paus') shuffle(baralho) for carta in baralho: print carta print baralho[0] class Vetor(): def __init__(self, x, y): self.y = y self.x = x def __repr__(self): return '(%s, %s)' % (self.x, self.y) def __add__(self, other): return Vetor(self.x + other.x, self.y + other.y) def __eq__(self, other): return self.x==other.x and self.y==other.y vetor1 = Vetor(1, 1) vetor2 = Vetor(1, 1) print vetor1 + vetor2 print vetor1 == vetor2
tensorflow/federated
tensorflow_federated/python/learning/model.py
Python
apache-2.0
12,401
0.002903
# Copyright 2018, The TensorFlow Federated Authors. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # # pytype: skip-file # This modules disables the Pytype analyzer, see # https://github.com/tensorflow/federated/blob/main/docs/pytype.md for more # information. """Abstractions for models used in federated learning.""" import abc from typing import Any, Callable, OrderedDict, Sequence import attr import tensorflow as tf MODEL_ARG_NAME = 'x' MODEL_LABEL_NAME = 'y' MetricFinalizersType = OrderedDict[str, Callable[[Any], Any]] @attr.s(frozen=True, slots=True, eq=False) class BatchOutput(): """A structure that holds the output of a `tff.learning.Model`. Note: All fields are optional (may be None). Attributes: loss: The scalar mean loss on the examples in the batch. If the model has multiple losses, it is the sum of all the individual losses. predictions: Tensor of predictions on the examples. The first dimension must be the same size (the size of the batch). num_examples: Number of examples seen in the batch. """ loss = attr.ib() predictions = attr.ib() num_examples = attr.ib() class Model(object, metaclass=abc.ABCMeta): """Represents a model for use in TensorFlow Federated. Each `Model` will work on a set of `tf.Variables`, and each method should be a computation that can be implemented as a `tf.function`; this implies the class should essentially be stateless from a Python perspective, as each method will generally only be traced once (per set of arguments) to create the corresponding TensorFlow graph functions. Thus, `Model` instances should behave as expected in both eager and graph (TF 1.0) usage. In general, `tf.Variables` may be either: * Weights, the variables needed to make predictions with the model. * Local variables, e.g. to accumulate aggregated metrics across calls to forward_pass. The weights can be broken down into trainable variables (variables that can and should be trained using gradient-based methods), and non-trainable variables (which could include fixed pre-trained layers, or static model data). These variables are provided via the `trainable_variables`, `non_trainable_variables`, and `local_variables` properties, and must be initialized by the user of the `Model`. In federated learning, model weights will generally be provided by the server, and updates to trainable model variables will be sent back to the server. Local variables are not transmitted, and are instead initialized locally on the device, and then used to produce `aggregated_outputs` which are sent to the server. All `tf.Variables` should be introduced in `__init__`; this could move to a `build` method more inline with Keras (see https://www.tensorflow.org/api_docs/python/tf/keras/layers/Layer) in the future. """ @abc.abstractproperty def trainable_variables(self) -> Sequence[tf.Variable]: """An iterable of `tf.Variable` objects, see class comment for details.""" pass @abc.abstractproperty def non_trainable_variables(self) -> Sequence[tf.Variable]: """An iterable of `tf.Variable` objects, see class comment for details.""" pass @abc.abstractproperty def local_variables(self) -> Sequence[tf.Variable]: """An iterable of `tf.Variable` objects, see class comment for details.""" pass @abc.abstractproperty def input_spec(self): """The type specification of the `batch_input` parameter for `forward_pass`. A nested structure of `tf.TensorSpec` objects, that matches the structure of arguments that will be passed as the `batch_input` argument of `forward_pass`. The tensors must include a batch dimension as the first dimension, but the batch dimension may be undefined. If `input_spec` is an instance of `collections.abc.Mapping`, this mapping must have an `{}` element which corresponds to the input to `predict_on_batch` and a `{}` element containing the batch labels. Otherwise the first positional element of `input_spec` must correspond to the input to `predict_on_batch`, and the second positional element the labels. Similar in spirit to `tf.keras.models.Model.input_spec`. """.format(MODEL_ARG_NAME, MODEL_LABEL_NAME) pass @abc.abstractmethod def forward_pass(self, batch_input, training=True) -> BatchOutput: """Runs the forward pass and returns results. This method must be serializable in a `tff.tf_computation` or other backend decorator. Any pure-Python or unserializable logic will not be runnable in the federated system. This method should not modify any variables that are part of the model parameters, that is, variables that influence the predictions (exceptions being updated, rather than learned, parameters such as BatchNorm means and variances). Rather, this is done by the training loop. However, this method may update aggregated metrics computed across calls to `forward_pass`; the final values of such metrics can be accessed via `aggregated_outputs`. Uses in TFF: * To implement model evaluation. * To implement federated gradient descent and other non-Federated-Averaging algorithms, where we want the model to run the forward pass and update metrics, but there is no optimizer (we might only compute gradients on the returned loss). * To implement Federated Averaging. Args: batch_input: A nested structure that matches the structure of `Model.input_spec` and each tensor in `batch_input` satisfies `tf.TensorSpec.is_compatible_with()` for the corresponding `tf.TensorSpec` in `Model.input_spec`. training: If `True`, run the training forward pass, otherwise, run in evaluation mode. The semantics are generally the same as the `training` argument to `keras.Model.call`; this might e.g. influence how dropout or batch normalization is handled. Returns: A `BatchOutput` object. The object must include the `loss` tensor if the model will be trained via a gradient-based algorithm. """ pass @abc.abstractmethod def predict_on_batch(self, batch_input, training=True): """Performs inference on a batch, produces predictions. Unlike `forward_pass`, this function must _not_ mutate any variables (including metrics) when `training=False`, as it must support conversion to a TFLite flatbuffer for inference. When `training=True` this supports cases such as BatchNorm mean and variance updates or dropout. In many c
ases this method will be called from `forward_pass` to produce the predictions, and `forward_pass` will further compute loss and metrics updates. Note that this im
plies `batch_input` will have a *different* signature for `predict_on_batch` than for `forward_pass`; see the args section of this documentation for a specification of the relationship. Args: batch_input: A nested structure of tensors that holds the prediction inputs for the model. The structure must match the first element of the structure of `Model.input_spec`, or the '{}' key if `Model.input_spec` is a mapping. Each tensor in `x` satisfies `tf.TensorSpec.is_compatible_with()` for the corresponding `tf.TensorSpec` in `Model.input_spec`. training: If `True`, allow updatable variables (e.g. BatchNorm variances and means) to be updated. Otherwise, run in inferece only mode with no variables mutated. The semantics are generally the same as the `training` argument to `keras.Model.`; this might e.g. influenc
utn-frm-si/reservas
app_reservas/urls.py
Python
mit
4,160
0
# coding=utf-8 from djan
go.conf.urls import url from .views import ( AliTemplateView, AliVideoconferenciasDetailView, AreaDetailView, AulaD
etailView, CuerpoDetailView, IndexView, LaboratorioDetailView, LaboratorioInformaticoDetailView, LaboratorioInformaticoListView, NivelDetailView, recurso_eventos_json, RecursoAliDetailView, SolicitudAliReclamosSugerencias, SolicitudAulaView, SolicitudInstalacionSoftwareView, SolicitudLaboratorioInformaticoView, SolicitudMaterialMultimediaView, TipoLaboratorioDetailView, TipoRecursoAliDetailView, TvCuerposListView, TvVisorCuerposDetailView, TvVisorDetailView, ) urlpatterns = [ url( r'^$', IndexView.as_view(), name='index' ), url( r'^cuerpo/(?P<numero>\d+)/$', CuerpoDetailView.as_view(), name='cuerpo_detalle' ), url( r'^cuerpo/(?P<numero_cuerpo>\d+)/nivel/(?P<numero_nivel>-?\d+)/$', NivelDetailView.as_view(), name='nivel_detalle' ), url( r'^aula/(?P<pk>\d+)/$', AulaDetailView.as_view(), name='aula_detalle' ), url( r'^area/(?P<slug>[-\w]+)/$', AreaDetailView.as_view(), name='area_detalle' ), url( r'^recurso/(?P<pk>\d+)/eventos/$', recurso_eventos_json, name='recurso_eventos_json' ), url( r'^ali/$', AliTemplateView.as_view(), name='ali_index' ), url( r'^ali/videoconferencias/$', AliVideoconferenciasDetailView.as_view(), name='ali_videoconferencias_detalle' ), url( r'^laboratorios/informatica/$', LaboratorioInformaticoListView.as_view(), name='laboratorio_informatico_listado' ), url( r'^laboratorio/informatica/(?P<alias>[A-Za-z0-9]+)/$', LaboratorioInformaticoDetailView.as_view(), name='laboratorio_informatico_detalle' ), url( r'^laboratorios/(?P<slug>[-\w]+)/$', TipoLaboratorioDetailView.as_view(), name='tipo_laboratorio_detalle' ), url( r'^laboratorio/(?P<tipo>[A-Za-z0-9]+)/(?P<alias>[A-Za-z0-9]+)/$', LaboratorioDetailView.as_view(), name='laboratorio_detalle' ), url( r'^ali/(?P<slug>[-\w]+)/$', TipoRecursoAliDetailView.as_view(), name='tipo_recurso_ali_detalle' ), url( r'^ali/(?P<tipo>[-\w]+)/(?P<identificador>[A-Za-z0-9_-]+)/$', RecursoAliDetailView.as_view(), name='recurso_ali_detalle' ), url( r'^solicitud/ali/reclamos_sugerencias/$', SolicitudAliReclamosSugerencias.as_view(), name='solicitud_ali_reclamos_sugerencias' ), url( r'^solicitud/aula/$', SolicitudAulaView.as_view(), name='solicitud_aula' ), url( r'^solicitud/instalacion_software/$', SolicitudInstalacionSoftwareView.as_view(), name='solicitud_instalacion_software' ), url( r'^solicitud/laboratorio/informatica/$', SolicitudLaboratorioInformaticoView.as_view(), name='solicitud_laboratorio_informatico' ), url( r'^solicitud/material_multimedia/$', SolicitudMaterialMultimediaView.as_view(), name='solicitud_material_multimedia' ), url( r'^tv/cuerpos/$', TvCuerposListView.as_view(), name='tv_cuerpos' ), url( r'^tv/visor/(?P<slug>[-\w]+)/$', TvVisorDetailView.as_view(), name='tv_visor' ), url( r'^tv/visor/(?P<slug>[-\w]+)/cuerpos/$', TvVisorCuerposDetailView.as_view(), name='tv_visor_cuerpos' ), # TODO: Eliminar. Vistas obsoletas debido a las vistas de VisorTv. Sólo se # mantienen para compatibilidad con los visores que funcionan actualmente. url( r'^tv/bedelia/(?P<slug>[-\w]+)/$', TvVisorDetailView.as_view(), name='tv_bedelia' ), url( r'^tv/bedelia/(?P<slug>[-\w]+)/cuerpos/$', TvVisorCuerposDetailView.as_view(), name='tv_bedelia_cuerpos' ), ]
mitodl/open-discussions
course_catalog/management/commands/print_course_duplicates_yaml.py
Python
bsd-3-clause
397
0
"""Management command for uploading master json data for OCW courses""" from django.core.management import BaseComm
and from course_catalog.etl.deduplication import generate_duplicates_yaml class Command(BaseCommand): """Print course duplicates yaml""" help = "Print course
duplicates yaml" def handle(self, *args, **options): self.stdout.write(generate_duplicates_yaml())