repo_name
stringlengths
5
100
path
stringlengths
4
231
language
stringclasses
1 value
license
stringclasses
15 values
size
int64
6
947k
score
float64
0
0.34
prefix
stringlengths
0
8.16k
middle
stringlengths
3
512
suffix
stringlengths
0
8.17k
codemeow5/vehiclenet-python
web.py
Python
gpl-2.0
2,732
0.027086
#!/usr/bin/python import sys, os import tornado.ioloop import tornado.web import logging import logging.handlers import re from urllib import unquote import config from vehiclenet import * reload(sys) sys.setdefaultencoding('utf8') def deamon(chdir = False): try: if os.fork() > 0: os._exit(0) except OSError, e: print 'fork #1 failed: %d (%s)' % (e.errno, e.strerror) os._exit(1) def init(): WeatherHandler.cache() class DefaultHandler(tornado.web.RequestHandler): def get(self): self.write('VehicleNet Say Hello!') class LogHandler(tornado.web.RequestHandler): def get(self): log_filename = 'logs/logging' if not os.path.exists(log_filename): self.write('The log file is empty.') return log_file = None log_file_lines = None try: log_file = open(log_filename, 'r') if log_file is None: raise Exception('log_file is None') log_file_lines = log_file.readlines() if log_file_lines is None: raise Exception('log_file_lines is None') except Exception, e: logger = logging.getLogger('web') logger.error('Failed to read the log file (logs/logging), error: %s' % e) finally: if log_file is not None: log_file.close() if log_file_lines is None: self.write('Failed to read the log file.') line_limit = 500 for _ in log_file_lines[::-1]: line_limit -= 1 if line_limit > 0: self.write(unquote(_) + '<BR/>') settings = { "static_path": os.path.join(os.path.dirname(__file__), "static"), } routes = [ (r"/", DefaultHandler), (r"/carlink/weather/findWeather.htm", WeatherHandler), (r"/carlink/music/findMusic.htm", MusicSearchHandler)
, (r"/carlink//music/findMusic.htm", MusicSearchHandler), (r"/carlink/music/findMusicTop.htm", MusicTopHandler), (r"/ca
rlink/music/findMusicLrc.htm", LrcSearchHandler), (r"/carlink/news/findNews.htm", NewsHandler), ] if config.Mode == 'DEBUG': routes.append((r"/log", LogHandler)) application = tornado.web.Application(routes, **settings) if __name__ == "__main__": if '-d' in sys.argv: deamon() logdir = 'logs' if not os.path.exists(logdir): os.makedirs(logdir) fmt = '%(asctime)s - %(filename)s:%(lineno)s - %(name)s - %(message)s' formatter = logging.Formatter(fmt) handler = logging.handlers.TimedRotatingFileHandler( '%s/logging' % logdir, 'M', 20, 360) handler.suffix = '%Y%m%d%H%M%S.log' handler.extMatch = re.compile(r'^\d{4}\d{2}\d{2}\d{2}\d{2}\d{2}') handler.setFormatter(formatter) logger = logging.getLogger('web') logger.addHandler(handler) if config.Mode == 'DEBUG': logger.setLevel(logging.DEBUG) else: logger.setLevel(logging.ERROR) init() application.listen(80) print 'Server is running, listening on port 80....' tornado.ioloop.IOLoop.instance().start()
yanjinbin/learnPython
chapter_7/chapter7.py
Python
gpl-3.0
3,243
0.000699
"""映射 集合 ... 高级数据结构类型""" from string import Template val_dict = {1: 'a', 2: 'b', 3: 'c'} print(val_dict) print(val_dict.keys()) print(val_dict.items()) print(val_dict.values()) factory_dict = dict((['x', 1], ['y', 2])) print(factory_dict) ddcit = {}.fromkeys(('x', 'y', 'z'), -24) ddcit.update(val_dict) # 新值覆盖旧值 print(ddcit) print(ddcit.get("m", "no such key ")) print(ddcit.setdefault('x', "new value ")) print(type(ddcit.keys())) for key in ddcit.keys(): s = Template("key is ${key} and value is ${value}") # 不加 key 和 value 就出错了 为什么 print(s.substitute(key=key, value=ddcit[key])) # has_key 方法取消了 参见 Python3 文档 https://docs.python.org/3.1/whatsnew/3.0.html#builtins var_tuple = (1, 'acs') var_list = [1, 2, 3] strange_dict = {var_tuple: 11, 1: 'abcd'} # 键成员关系操作 print(1 in strange_dict) # strange_dict = {var_tuple: 11, 1: 'abcd', var_list: 'acv'} # 语法上没错误,但是 会包 unhashable type: 'list' 错误 所有基于 dict 的操作都会报错误 # 因为 check key 是否 hashable 的合法性 print(strange_dict[var_tuple]) # print(strange_dict[var_list]) # strange_dict.pop(var_list) strange_dict.pop(var_tuple) strange_dict.clear() del strange_dict val_dict1 = {1: 'a', '2': "v"} val_dict2 = {1: 'v'} # print(val_dict > val_dict2) Python3 不再支持了 print(dict([['x', 1], ['z', 2]])) # fixed zip(函数) map(lambda 表达式 等价于 zip print(type(hash((1, 2, 3)))) print(hash((1, 2, 'a'))) # print(hash(([1, 23, 34], 'a'))) # 集合保证元素不重复 ,真正意义上的数学集合(元素不重复) # 而不是编程意义上的集合 print("------set-----") var_set = set('aasn223wuerhe') print(type(var_
set)) print(var_set) print("frozensetr ") var_frozen_set = frozenset('aaddk2u9m3pq40aiwoe27na') print(var_frozen_set) print('a' in var_set) print('2' in var_frozen_set) # True 数字被当做字符处理 print(2 in var_frozen_set) # False # 可变集合 的 CRUD var_set.update("anddipwq") print(var_set) var_se
t.discard("n") print(var_set) var_set.remove("a") print(var_set) var_set.pop() print(var_set) var_set.clear() print(var_set) var_set.add("$") print(var_set) var_set1 = set('rtyufghvb') print(var_set1) var_set2 = set('qwertyuiop') print(var_set2) var_set3 = set('qwertyuiop') print(var_set3) var_set4 = var_set1 print(var_set4) var_set5 = set('qwert') print(var_set5) # 数学意义上的集合操作 print(var_set1 == var_set2) print(var_set1 != var_set2) print(var_set5 < var_set3) print(var_set5.issubset(var_set3)) print(var_set1 <= var_set4) print(var_set1.issuperset(var_set4)) print(var_set1 ^ var_set2) # A B 公共集合的剩余部分 A△B print(var_set1.symmetric_difference(var_set2)) print(var_set1.union(var_set5)) print(var_set1 | var_set5) print(var_set5 & var_set3) print(var_set5.intersection(var_set3)) print(var_set3 - var_set5) print(var_set3.difference(var_set5)) # 混合集合类型操作 根据左边操作数 确定集合是不是可变 immutable_set = frozenset("ansaskwke") mutable_set = set("24m9sjwe") immutable_set_1 = immutable_set | mutable_set print(type(immutable_set_1)) # print(1 | 2) python3 居然支持了 我擦啊
welch/seasonal
tests/adjust_seasons_test.py
Python
mit
1,815
0.007163
# test seasonal.adjust_seasons() options handling # # adjust_seasons() handles a variety of optional arguments. # verify that adjust_trend() correctly calledfor different option combinations. # # No noise in this test set. # from __future__ import division import numpy as np from seasonal import fit_trend, adjust_seasons # pylint:disable=import-error from seasonal.sequences import sine # pylint:disable=import-error PERIOD = 25 CYCLES = 4 AMP = 1.0 TREND = AMP / PERIOD LEVEL = 1000.0 SEASONS = sine(AMP, PERIOD, 1) DATA = LEVEL + np.arange(PERIOD * CYCLES) * TREND + np.tile(SEASONS, CYCLES) ZEROS = np.zeros(PERIOD * CYCLES) def iszero(a): return np.all(np.isclose(a, ZEROS)) def isseasons(a): return np.all(np.isclose(a, SEASONS)) def test_auto(): adjusted = adjust_seasons(DATA) assert adjusted.std() < DATA.std() def test_trend_line(): adjusted = adjust_seaso
ns(DATA, trend="line") assert adjusted.std() < DATA.std() def test_explicit_trend(): trend = fit_trend(DATA, kind="line") adjusted = adjust_seasons(DATA, trend=trend) assert adjusted.std() < DATA.std() def test_trend_period(): adjusted = adjust_seasons(DATA, trend="line", period=PERIOD) assert adjusted.std() < DATA.std() def
test_trend_seasons(): adjusted = adjust_seasons(DATA, trend="line", seasons=SEASONS) assert adjusted.std() < DATA.std() def test_trend_spline(): adjusted = adjust_seasons(DATA, trend="spline") assert adjusted.std() < DATA.std() def test_period(): adjusted = adjust_seasons(DATA, period=PERIOD) assert adjusted.std() < DATA.std() adjusted = adjust_seasons(DATA, period=PERIOD // 2) # no seasonality assert adjusted is None def test_seasons(): adjusted = adjust_seasons(DATA, seasons=SEASONS) assert adjusted.std() < DATA.std()
foobarbazblarg/stayclean
stayclean-2020-july/serve-challenge-with-flask.py
Python
mit
12,690
0.003546
#!/usr/bin/env python import subprocess import praw import datetime import pyperclip from hashlib import sha1 from flask import Flask from flask import Response from flask import request from cStringIO import StringIO from base64 import b64encode from base64 import b64decode from ConfigParser import ConfigParser import OAuth2Util import os import markdown import bleach # encoding=utf8 import sys from participantCollection import ParticipantCollection reload(sys) sys.setdefaultencoding('utf8') # Edit Me! challengePageSubmissionId = 'hjbcvx' flaskport = 8936 thisMonthName = "July" nextMonthName = "August" readAllCommentsWhichCanBeSlower = False sorryTooLateToSignUpReplyText = "Sorry, but the late signup grace period for " + thisMonthName + " is over, so you can't officially join this challenge. But feel free to follow along anyway, and comment all you want. And be sure to join us for the " + nextMonthName + " challenge. Signup posts for " + nextMonthName + " will begin during the last week of " + thisMonthName + "." reinstatedReplyText = "OK, I've reinstated you. You should start showing up on the list again starting tomorrow." app = Flask(__name__) app.debug = True commentHashesAndComments = {} submission = None def loginAndReturnRedditSession(): config = ConfigParser() config.read("../reddit-password-credentials.cfg") user = config.get("Reddit", "user") password = config.get("Reddit", "password") # TODO: password auth is going away, and we will soon need to do oauth. redditSession = praw.Reddit(user_agent='Test Script by /u/foobarbazblarg') redditSession.login(user, password, disable_warning=True) # submissions = redditSession.get_subredd
it('pornfree').get_hot(limit=5) # print [str(x) for x in submissions] return redditSession def loginOAuthAndReturnRedditSession(): redditSession = praw.Reddit(user_agent='Test Script by /u/foobarbazblarg') # New version of praw does not require explicit use of the OAuth2Util object. Presumably because reddit now REQUIRES oauth. # o = OAuth2Util.OAuth2Util(redditSession, print_log=True
, configfile="../reddit-oauth-credentials.cfg") # TODO: Testing comment of refresh. We authenticate fresh every time, so presumably no need to do o.refresh(). # o.refresh(force=True) return redditSession def getSubmissionForRedditSession(redditSession): # submission = redditSession.get_submission(submission_id=challengePageSubmissionId) submission = redditSession.submission(id=challengePageSubmissionId) if readAllCommentsWhichCanBeSlower: submission.comments.replace_more(limit=None) # submission.replace_more_comments(limit=None, threshold=0) return submission def getCommentsForSubmission(submission): # return [comment for comment in praw.helpers.flatten_tree(submission.comments) if comment.__class__ == praw.models.Comment] commentForest = submission.comments # commentForest.replace_more(limit=None, threshold=0) return [comment for comment in commentForest.list() if comment.__class__ == praw.models.Comment] def retireCommentHash(commentHash): with open("retiredcommenthashes.txt", "a") as commentHashFile: commentHashFile.write(commentHash + '\n') def retiredCommentHashes(): with open("retiredcommenthashes.txt", "r") as commentHashFile: # return commentHashFile.readlines() return commentHashFile.read().splitlines() @app.route('/moderatechallenge.html') def moderatechallenge(): currentDayOfMonthIndex = datetime.date.today().day lateCheckinGracePeriodIsInEffect = currentDayOfMonthIndex <= 3 global commentHashesAndComments global submission commentHashesAndComments = {} stringio = StringIO() stringio.write('<html>\n<head>\n</head>\n\n') # redditSession = loginAndReturnRedditSession() redditSession = loginOAuthAndReturnRedditSession() submission = getSubmissionForRedditSession(redditSession) flat_comments = getCommentsForSubmission(submission) retiredHashes = retiredCommentHashes() i = 1 stringio.write('<iframe name="invisibleiframe" style="display:none;"></iframe>\n') stringio.write("<h3>") stringio.write(os.getcwd()) stringio.write("<br>\n") stringio.write(submission.title) stringio.write("</h3>\n\n") stringio.write('<form action="copydisplaytoclipboard.html" method="post" target="invisibleiframe">') stringio.write('<input type="submit" name="actiontotake" value="Copy display.py stdout to clipboard">') stringio.write('<input type="submit" name="actiontotake" value="Automatically post display.py stdout">') stringio.write('</form>') stringio.write('<form action="updategooglechart.html" method="post" target="invisibleiframe">') stringio.write('<input type="submit" value="update-google-chart.py">') stringio.write('</form>') for comment in flat_comments: # print comment.is_root # print comment.score i += 1 commentHash = sha1() commentHash.update(comment.fullname) commentHash.update(comment.body.encode('utf-8')) commentHash = commentHash.hexdigest() if commentHash not in retiredHashes: commentHashesAndComments[commentHash] = comment authorName = str(comment.author) # can be None if author was deleted. So check for that and skip if it's None. participant = ParticipantCollection().participantNamed(authorName) stringio.write("<hr>\n") stringio.write('<font color="blue"><b>') stringio.write(authorName) stringio.write('</b></font><br>') if ParticipantCollection().hasParticipantNamed(authorName): stringio.write(' <small><font color="green">(member)</font></small>') if participant.isStillIn: stringio.write(' <small><font color="green">(still in)</font></small>') else: stringio.write(' <small><font color="red">(out)</font></small>') if participant.hasCheckedIn: stringio.write(' <small><font color="green">(checked in)</font></small>') else: stringio.write(' <small><font color="orange">(not checked in)</font></small>') if participant.hasRelapsed: stringio.write(' <small><font color="red">(relapsed)</font></small>') else: stringio.write(' <small><font color="green">(not relapsed)</font></small>') else: stringio.write(' <small><font color="red">(not a member)</font></small>') stringio.write('<form action="takeaction.html" method="post" target="invisibleiframe">') if lateCheckinGracePeriodIsInEffect: stringio.write('<input type="submit" name="actiontotake" value="Checkin">') stringio.write('<input type="submit" name="actiontotake" value="Signup and checkin" style="color:white;background-color:green">') else: stringio.write('<input type="submit" name="actiontotake" value="Checkin" style="color:white;background-color:green">') stringio.write('<input type="submit" name="actiontotake" value="Signup and checkin">') stringio.write('<input type="submit" name="actiontotake" value="Relapse" style="color:white;background-color:red">') stringio.write('<input type="submit" name="actiontotake" value="Reinstate with automatic comment">') stringio.write('<input type="submit" name="actiontotake" value="Reply with sorry-too-late comment">') stringio.write('<input type="submit" name="actiontotake" value="Skip comment">') stringio.write('<input type="submit" name="actiontotake" value="Skip comment and don\'t upvote">') stringio.write('<input type="hidden" name="username" value="' + b64encode(authorName) + '">') stringio.write('<input type="hidden" name="bodyencodedformlcorpus" value="' + b64encode(comment.body.encode('utf-8')) + '">') stringio.write('<input type="hidden" n
lutianming/leetcode
reverse_bits.py
Python
mit
321
0.003115
class Solution: # @param n,
an integer # @return an integer def reverseBits(self, n): reverse = 0 r = n for i in range(32): bit = r % 2 reverse += bit << (32-i-1) r = r / 2 return reverse s = So
lution() r = s.reverseBits(43261596) print(r)
shearern/rsync-usb
src/rsync_usb_tests/ChunkLocationTests.py
Python
gpl-2.0
4,596
0.001958
import unittest from rsync_usb.ChunkLocation import ChunkLocation class ChunkLocationTests(unittest.TestCase): '''Test TargetHashesWriter and TargetHashesReader''' def testProperties(self): pos = ChunkLocation('dummy', 100, 10) self.assertEqual(pos.path, 'dummy') self.assertEqual(pos.start_pos, 100) self.assertEqual(pos.data_len, 10) def testEndPos(self): pos = ChunkLocation('dummy', 100, 10) self.assertEqual(pos.start_pos + pos.data_len - 1, pos.end_pos) self.assertEqual(pos.end_pos, 109) def testEqual(self): pos_a = ChunkLocation('dummy', 100, 10) pos_b = ChunkLocation('dummy', 100, 10) self.assertEqual(pos_a, pos_b) # -- Overlaping chunk tests ----------------------------------------------- def assertOverlaping(self, pos_a, pos_b): msg = "%s should overlap %s but did not" self.assertTrue(pos_a.overlaps(pos_b), msg % (str(pos_a), str(pos_b))) self.assertTrue(pos_b.overlaps(pos_a), msg % (str(pos_b), str(pos_a))) def assertNotOverlaping(self, pos_a, pos_b): msg = "%s should not overlap %s but does" self.assertFalse(pos_a.overlaps(pos_b), msg % (str(pos_a), str(pos_b))) self.assertFalse(pos_b.overlaps(pos_a), msg % (str(pos_b), str(pos_a))) def testNoOverlapBefore(self): pos_a = ChunkLocation('dummy', 10, 10) pos_b = ChunkLocation('dummy', 100, 10) self.assertNotOverlaping(pos_a, pos_b) def testNoOverlapAfter(self): pos_a = ChunkLocation('dummy', 1000, 10) pos_b = ChunkLocation('dummy', 100, 10) self.assertNotOverlaping(pos_a, pos_b) def testNoOverlapDifferentPaths(self): pos_a = ChunkLocation('dummy_a', 100, 10) pos_b = ChunkLocation('dummy_b', 100, 10) self.assertNotOverlaping(pos_a, pos_b) def testOverlapEqual(self): # 0000000000111111111112 # 0123456789001234567890 # A: ------|=======|------- # B: ------|=======|------- pos_a = ChunkLocation('dummy', 6, 9) pos_b = ChunkLocation('dummy', 6, 9) self.assertOverlaping(pos_a, pos_b) def testOverlapStartsBefore(self): # 0000000000111111111112 # 0123456789001234567890 # A: ----|=======|--------- # B: ------|=======|------- pos_a = ChunkLocation('dummy', 4, 9) pos_b = ChunkLocation('dummy', 6, 9) self.assertOverlaping(pos_a, pos_b) def testOverlapStartsBeforeAndEqual(self): # 0000000000111111111112 # 0123456789001234567890 # A: ----|=========|------- # B: ------|=======|------- pos_a = ChunkLocation('dummy', 4, 11) pos_b = ChunkLocation('dummy', 6, 9) self.assertOverlaping(pos_a, pos_b) def testOverlapInside(self): # 0000000000111111111112 # 0123456789001234567890 # A: ------|=======|------- # B: -----|=========|------ pos_a = ChunkLocation('dummy', 6, 9) pos_b = ChunkLocation('dummy', 5, 11) self.assertOverlaping(pos_a, pos_b) def testOverlapInsideSameStart(self): # 0000000000111111111112 # 0123456789001234567890 # A: ------|=======|------- # B: ------|========|------ pos_a = ChunkLocation('dummy', 6, 9) pos_b = ChunkL
ocation('dummy', 6, 10) self.assertOverlaping(pos_a, pos_b) def testOverlapInsideSameEnd(self): # 0000000000111111111112 # 012345
6789001234567890 # A: ------|=======|------- # B: -----|========|------- pos_a = ChunkLocation('dummy', 6, 9) pos_b = ChunkLocation('dummy', 5, 10) self.assertOverlaping(pos_a, pos_b) def testOverlapEndsAfter(self): # 0000000000111111111112 # 0123456789001234567890 # A: -------|=======|------ # B: ------|=======|------- pos_a = ChunkLocation('dummy', 7, 9) pos_b = ChunkLocation('dummy', 6, 9) self.assertOverlaping(pos_a, pos_b) def testOverlapEndsAfterAndEqual(self): # 0000000000111111111112 # 0123456789001234567890 # A: ------|=========|----- # B: ------|=======|------- pos_a = ChunkLocation('dummy', 6, 11) pos_b = ChunkLocation('dummy', 6, 9) self.assertOverlaping(pos_a, pos_b)
wenottingham/ansible
lib/ansible/plugins/lookup/subelements.py
Python
gpl-3.0
4,311
0.002784
# (c) 2013, Serge van Ginderachter <[email protected]> # # This file is part of Ansible # # Ansible is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Ansible is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Ansible. If not, see <http://www.gnu.org/licenses/>. from __future__ import (absolute_import, division, print_function) __metaclass__ = type from ansible.compat.six import string_types from ansible.errors import AnsibleError from ansible.plugins.lookup import LookupBase from ansible.utils.listify import listify_lookup_plugin_terms from ansible.utils.boolean import boolean FLAGS = ('skip_missing',) class LookupModule(LookupBase): def run(self, terms, variables, **kwargs): def _raise_terms_error(msg=""): raise AnsibleError( "subelements lookup expects a list of two or three items, " + msg) terms[0] = listify_lookup_plugin_terms(terms[0], templar=self._templar, loader=self._loader) # check lookup terms - ch
eck number of terms if not isinstance(terms, list) or not 2 <= len(terms) <= 3: _raise_terms_error()
# first term should be a list (or dict), second a string holding the subkey if not isinstance(terms[0], (list, dict)) or not isinstance(terms[1], string_types): _raise_terms_error("first a dict or a list, second a string pointing to the subkey") subelements = terms[1].split(".") if isinstance(terms[0], dict): # convert to list: if terms[0].get('skipped', False) is not False: # the registered result was completely skipped return [] elementlist = [] for key in terms[0].iterkeys(): elementlist.append(terms[0][key]) else: elementlist = terms[0] # check for optional flags in third term flags = {} if len(terms) == 3: flags = terms[2] if not isinstance(flags, dict) and not all([isinstance(key, string_types) and key in FLAGS for key in flags]): _raise_terms_error("the optional third item must be a dict with flags %s" % FLAGS) # build_items ret = [] for item0 in elementlist: if not isinstance(item0, dict): raise AnsibleError("subelements lookup expects a dictionary, got '%s'" % item0) if item0.get('skipped', False) is not False: # this particular item is to be skipped continue skip_missing = boolean(flags.get('skip_missing', False)) subvalue = item0 lastsubkey = False sublist = [] for subkey in subelements: if subkey == subelements[-1]: lastsubkey = True if not subkey in subvalue: if skip_missing: continue else: raise AnsibleError("could not find '%s' key in iterated item '%s'" % (subkey, subvalue)) if not lastsubkey: if not isinstance(subvalue[subkey], dict): if skip_missing: continue else: raise AnsibleError("the key %s should point to a dictionary, got '%s'" % (subkey, subvalue[subkey])) else: subvalue = subvalue[subkey] else: # lastsubkey if not isinstance(subvalue[subkey], list): raise AnsibleError("the key %s should point to a list, got '%s'" % (subkey, subvalue[subkey])) else: sublist = subvalue.pop(subkey, []) for item1 in sublist: ret.append((item0, item1)) return ret
ntt-pf-lab/backup_keystone
keystone/middleware/remoteauth.py
Python
apache-2.0
4,006
0.00025
#!/usr/bin/env python # vim: tabstop=4 shiftwidth=4 softtabstop=4 # # Copyright (c) 2010 OpenStack, LLC. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agre
ed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or # implied. # See the License for the specific language governing permissions and # limitations under the License. """ Auth Middleware that handles auth for a service This module can be installed as a filter in front of your service to validate that requests are coming from a trusted component that has handled authenticating the call. If a call c
omes from an untrusted source, it will redirect it back to be properly authenticated. This is done by sending our a 305 proxy redirect response with the URL for the auth service. The auth service settings are specified in the INI file (keystone.ini). The ini file is passed in as the WSGI config file when starting the service. For this proof of concept, the ini file is in echo/echo/echo.ini. In the current implementation use a basic auth password to verify that the request is coming from a valid auth component or service Refer to: http://wiki.openstack.org/openstack-authn HEADERS ------- HTTP_ is a standard http header HTTP_X is an extended http header > Coming in from initial call HTTP_X_AUTH_TOKEN : the client token being passed in HTTP_X_STORAGE_TOKEN: the client token being passed in (legacy Rackspace use) to support cloud files > Used for communication between components www-authenticate : only used if this component is being used remotely HTTP_AUTHORIZATION : basic auth password used to validate the connection > What we add to the request for use by the OpenStack service HTTP_X_AUTHORIZATION: the client identity being passed in """ from webob.exc import HTTPUseProxy, HTTPUnauthorized class RemoteAuth(object): # app is the downstream WSGI component, usually the OpenStack service # # if app is not provided, the assumption is this filter is being run # from a separate server. def __init__(self, app, conf): # app is the next app in WSGI chain - eventually the OpenStack service self.app = app self.conf = conf # where to redirect untrusted requests to self.proxy_location = conf.get('proxy_location') # secret that will tell us a request is coming from a trusted auth # component self.remote_auth_pass = conf.get('remote_auth_pass') print 'Starting Remote Auth middleware' def __call__(self, env, start_response): # Validate the request is trusted # Authenticate the Auth component itself. headers = [('www-authenticate', 'Basic realm="API Auth"')] if 'HTTP_AUTHORIZATION' not in env: # Redirect to proxy (auth component) and show that basic auth is # required return HTTPUseProxy(location=self.proxy_location, headers=headers)(env, start_response) else: auth_type, encoded_creds = env['HTTP_AUTHORIZATION'].split(None, 1) if encoded_creds != self.remote_auth_pass: return HTTPUnauthorized(headers=headers)(env, start_response) # Make sure that the user has been authenticated by the Auth Service if 'HTTP_X_AUTHORIZATION' not in env: return HTTPUnauthorized()(env, start_response) return self.app(env, start_response) def filter_factory(global_conf, **local_conf): """Returns a WSGI filter app for use with paste.deploy.""" conf = global_conf.copy() conf.update(local_conf) def auth_filter(app): return RemoteAuth(app, conf) return auth_filter
audantic/smartystreets.py
smartystreets/client.py
Python
bsd-3-clause
6,663
0.002852
#!/usr/bin/env python # -*- coding: utf-8 -*- """ Client module for connecting to and interacting with SmartyStreets API """ import json import numbers import requests from .data import Address, AddressCollection from .exceptions import SmartyStreetsError, ERROR_CODES def validate_args(f): """ Ensures that *args consist of a consistent type :param f: any client method with *args parameter :return: function f """ def wrapper(self, args): arg_types = set([type(arg) for arg in args]) if len(arg_types) > 1: raise TypeError("Mixed input types are not allowed") elif list(arg_types)[0] not in (dict, str): raise TypeError("Only dict and str types accepted") return f(self, args) return wrapper def truncate_args(f): """ Ensures that *args do not exceed a set limit or are truncated to meet that limit :param f: any Client method with *args parameter :return: function f """ def wrapper(self, args): if len(args) > 100: if self.truncate_addresses: args = args[:100] else: raise ValueError("This exceeds 100 address at a time SmartyStreets limit") return f(self, args) return wrapper def stringify(data): """ Ensure all values in the dictionary are strings, except for the value for `candidate` which should just be an integer. :param data: a list of addresses in dictionary format :return: the same list with all values except for `candidate` count as a string """ def serialize(k, v): if k == "candidates": return int(v) if isinstance(v, numbers.Number): if k == "zipcode": # If values are presented as integers then leading digits may be cut off, # and these are significant for the zipcode. Add them back. return str(v).zfill(5) return str(v) return v return [ { k: serialize(k, v) for k, v in json_dict.items() } for json_dict in data ] class Client(object): """ Client class for interacting with the SmartyStreets API """ BASE_URL = "https://api.smartystreets.com/" def __init__(self, auth_id, auth_token, standardize=False, invalid=False, logging=True, accept_keypair=False, truncate_addresses=False, timeout=None): """ Constructs the client :param auth_id: authentication ID from SmartyStreets :param auth_token: authentication token :param standardize: boolean include addresses that match zip+4 in addition to DPV confirmed addresses :param invalid: boolean to include address candidates that may not be deliverable :param logging: boolean to allow SmartyStreets to log requests :param accept_keypair: boolean to toggle default keypair behavior :param truncate_addresses: boolean to silently truncate address lists in excess of the SmartyStreets maximum rather than raise an error. :param timeout: optional timeout value in seconds for requests. :return: the configured client object """ self.auth_id = auth_id self.auth_token = auth_token self.standardize = standardize self.invalid = invalid self.logging = logging self.accept_keypair = accept_keypair self.truncate_addresses = truncate_addresses self.timeout = timeout self.session = requests.Session() self.session.mount(self.BASE_URL, requests.adapters.HTTPAdapter(max_retries=5)) def post(self, endpoint, data): """ Executes the HTTP POST request :param endpoint: string indicating the URL component to call :param data: the data to submit :return: the dumped JSON response content """ headers = { 'Content-Type': 'application/json', 'Accept': 'application/json', 'x-standardize-only': 'true' if self.standardize else 'false', 'x-include-invalid': 'true' if self.invalid else 'false', 'x-accept-keypair': 'true' if self.accept_keypair else 'false', } if not self.logging: headers['x-suppress-logging'] = 'true' params = {'auth-id': self.auth_id, 'auth-token': self.auth_token} url = self.BASE_URL + endpoint response = self.session.post(url, json.dumps(stringify(data)), params=params, headers=headers, timeout=self.timeout) if response.status_code == 200: return response.json() raise ERROR_CODES.get(response.status_code, SmartyStreetsError) @truncate_args @validate_args def street_addresses(self, addresses): """ API method for verifying street address and geolocating Returns an AddressCollection always for consistency. In common usage it'd be simple and sane to return an Address when only one address was searched, however this makes populating search addresses from lists of unknown length problematic. If that list returns only one address now the code has to check the type of return value to ensure that it isn't applying behavior for an expected list type rather than a single dictionary. >>> client.street_addresses(["100 Main St, Anywhere, USA"], ["6 S Blvd, Richmond, VA"]) >>> client.street_addresses([{"street": "100 Main St, anywhere USA"}, ... ]) :param addresses: 1 or more addresses in string or dict format :return: an AddressCollection """ # While it's okay in theory to accept freeform addresses they do need to be submitted in # a dictionary format. if type(addresses[0]) != dict: addresses = [{'street': arg} for arg in addresses] r
eturn AddressCollection(self.post('street-address', data=addresses)) def street_address(self, address): """ Geocode one and only address, get a single Address object back >>> client.street_address("100 Main St, Anywhere, USA") >>> client.street_address({"street": "100 Main St, anywhere USA"}) :param address: string or dictionary with street addr
ess information :return: an Address object or None for no match """ address = self.street_addresses([address]) if not len(address): return None return Address(address[0]) def zipcode(self, *args): raise NotImplementedError("You cannot lookup zipcodes yet")
m45t3r/i3pystatus
i3pystatus/spotify.py
Python
mit
183
0
from i3pystatus.playerctl import Playerctl class Spotify(Playerctl): """ Get Spotify info using playerct
l. Based
on `Playerctl`_ module. """ player_name = "spotify"
liuqr/edx-xiaodun
cms/djangoapps/models/settings/course_grading.py
Python
agpl-3.0
9,046
0.003869
from datetime import timedelta from contentstore.utils import get_modulestore from xmodule.modulestore.django import loc_mapper from xblock.fields import Scope class CourseGradingModel(object): """ Basical
ly a DAO and Model combo for CRUD operations pertaining to grading policy. """ # Within this class, allow access to protected members of client classes. # This comes up when accessing kvs data and caches during kvs saves and modulestore writes. def __init__(self, course_descriptor): self.graders = [ CourseGradingModel
.jsonize_grader(i, grader) for i, grader in enumerate(course_descriptor.raw_grader) ] # weights transformed to ints [0..100] self.grade_cutoffs = course_descriptor.grade_cutoffs self.grace_period = CourseGradingModel.convert_set_grace_period(course_descriptor) @classmethod def fetch(cls, course_locator): """ Fetch the course grading policy for the given course from persistence and return a CourseGradingModel. """ course_old_location = loc_mapper().translate_locator_to_location(course_locator) descriptor = get_modulestore(course_old_location).get_item(course_old_location) model = cls(descriptor) return model @staticmethod def fetch_grader(course_location, index): """ Fetch the course's nth grader Returns an empty dict if there's no such grader. """ course_old_location = loc_mapper().translate_locator_to_location(course_location) descriptor = get_modulestore(course_old_location).get_item(course_old_location) index = int(index) if len(descriptor.raw_grader) > index: return CourseGradingModel.jsonize_grader(index, descriptor.raw_grader[index]) # return empty model else: return {"id": index, "type": "", "min_count": 0, "drop_count": 0, "short_label": None, "weight": 0 } @staticmethod def update_from_json(course_locator, jsondict, user): """ Decode the json into CourseGradingModel and save any changes. Returns the modified model. Probably not the usual path for updates as it's too coarse grained. """ course_old_location = loc_mapper().translate_locator_to_location(course_locator) descriptor = get_modulestore(course_old_location).get_item(course_old_location) graders_parsed = [CourseGradingModel.parse_grader(jsonele) for jsonele in jsondict['graders']] descriptor.raw_grader = graders_parsed descriptor.grade_cutoffs = jsondict['grade_cutoffs'] get_modulestore(course_old_location).update_item(descriptor, user.id) CourseGradingModel.update_grace_period_from_json(course_locator, jsondict['grace_period'], user) return CourseGradingModel.fetch(course_locator) @staticmethod def update_grader_from_json(course_location, grader, user): """ Create or update the grader of the given type (string key) for the given course. Returns the modified grader which is a full model on the client but not on the server (just a dict) """ course_old_location = loc_mapper().translate_locator_to_location(course_location) descriptor = get_modulestore(course_old_location).get_item(course_old_location) # parse removes the id; so, grab it before parse index = int(grader.get('id', len(descriptor.raw_grader))) grader = CourseGradingModel.parse_grader(grader) if index < len(descriptor.raw_grader): descriptor.raw_grader[index] = grader else: descriptor.raw_grader.append(grader) get_modulestore(course_old_location).update_item(descriptor, user.id) return CourseGradingModel.jsonize_grader(index, descriptor.raw_grader[index]) @staticmethod def update_cutoffs_from_json(course_location, cutoffs, user): """ Create or update the grade cutoffs for the given course. Returns sent in cutoffs (ie., no extra db fetch). """ course_old_location = loc_mapper().translate_locator_to_location(course_location) descriptor = get_modulestore(course_old_location).get_item(course_old_location) descriptor.grade_cutoffs = cutoffs get_modulestore(course_old_location).update_item(descriptor, user.id) return cutoffs @staticmethod def update_grace_period_from_json(course_location, graceperiodjson, user): """ Update the course's default grace period. Incoming dict is {hours: h, minutes: m} possibly as a grace_period entry in an enclosing dict. It is also safe to call this method with a value of None for graceperiodjson. """ course_old_location = loc_mapper().translate_locator_to_location(course_location) descriptor = get_modulestore(course_old_location).get_item(course_old_location) # Before a graceperiod has ever been created, it will be None (once it has been # created, it cannot be set back to None). if graceperiodjson is not None: if 'grace_period' in graceperiodjson: graceperiodjson = graceperiodjson['grace_period'] grace_timedelta = timedelta(**graceperiodjson) descriptor.graceperiod = grace_timedelta get_modulestore(course_old_location).update_item(descriptor, user.id) @staticmethod def delete_grader(course_location, index, user): """ Delete the grader of the given type from the given course. """ course_old_location = loc_mapper().translate_locator_to_location(course_location) descriptor = get_modulestore(course_old_location).get_item(course_old_location) index = int(index) if index < len(descriptor.raw_grader): del descriptor.raw_grader[index] # force propagation to definition descriptor.raw_grader = descriptor.raw_grader get_modulestore(course_old_location).update_item(descriptor, user.id) @staticmethod def delete_grace_period(course_location, user): """ Delete the course's grace period. """ course_old_location = loc_mapper().translate_locator_to_location(course_location) descriptor = get_modulestore(course_old_location).get_item(course_old_location) del descriptor.graceperiod get_modulestore(course_old_location).update_item(descriptor, user.id) @staticmethod def get_section_grader_type(location): old_location = loc_mapper().translate_locator_to_location(location) descriptor = get_modulestore(old_location).get_item(old_location) return { "graderType": descriptor.format if descriptor.format is not None else 'notgraded', "location": unicode(location), } @staticmethod def update_section_grader_type(descriptor, grader_type, user): if grader_type is not None and grader_type != u'notgraded': descriptor.format = grader_type descriptor.graded = True else: del descriptor.format del descriptor.graded get_modulestore(descriptor.location).update_item(descriptor, user.id) return {'graderType': grader_type} @staticmethod def convert_set_grace_period(descriptor): # 5 hours 59 minutes 59 seconds => converted to iso format rawgrace = descriptor.graceperiod if rawgrace: hours_from_days = rawgrace.days * 24 seconds = rawgrace.seconds hours_from_seconds = int(seconds / 3600) hours = hours_from_days + hours_from_seconds seconds -= hours_from_seconds * 3600 minutes = int(seconds / 60) seconds -= minutes * 60 graceperiod = {'hours': 0, 'minutes': 0, 'seconds': 0} if hours > 0: graceperiod['hours'] = hours if minutes > 0: graceperiod['minutes'] =
hehongliang/tensorflow
tensorflow/python/util/tf_export_test.py
Python
apache-2.0
6,573
0.005021
# Copyright 2017 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """tf_export tests.""" # pylint: disable=unused-import from __future__ import absolute_import from __future__ import division from __future__ import print_function import sys from tensorflow.python.platform import test from tensorflow.python.util import tf_decorator from tensorflow.python.util import tf_export def _test_function(unused_arg=0): pass def _test_function2(unused_arg=0): pass class TestClassA(object): pass class TestClassB(TestClassA): pass class ValidateExportTest(test.TestCase): """Tests for tf_export class.""" class MockModule(object): def __init__(self, name): self.__name__ = name def setUp(self): self._modules = [] def tearDown(self): for name in self._modules: del sys.modules[name] self._modules = [] for symbol in [_test_function, _test_function, TestClassA, TestClassB]: if hasattr(symbol, '_tf_api_names'): del symbol._tf_api_names if hasattr(symbol, '_tf_api_names_v1'): del symbol._tf_api_names_v1 def _CreateMockModule(self, name): mock_module = self.MockModule(name) sys.modules[name] = mock_module self._modules.append(name) return mock_module def testExportSingleFunction(self): export_decorator = tf_export.tf_export('nameA', 'nameB') decorated_function = export_decorator(_test_function) self.assertEquals(decorated_function, _test_function) self.assertEquals(('nameA', 'nameB'), decorated_function._tf_api_names) def testExportMultipleFunctions(self): export_decorator1 = tf_export.tf_export('nameA', 'nameB') export_decorator2 = tf_export.tf_export('nameC', 'nameD') decorated_function1 = export_decorator1(_test_function) decorated_function2 = export_decorator2(_test_function2) self.assertEquals(decorated_function1, _test_function) self.assertEquals(decorated_function2, _test_function2) self.assertEquals(('nameA', 'nameB'), decorated_function1._tf_api_names) self.assertEquals(('nameC', 'nameD'), decorated_function2._tf_api_names) def testExportClasses(self): export_decorator_a = tf_export.tf_export('TestClassA1') export_decorator_a(TestClassA) self.assertEquals(('TestClassA1',), TestClassA._tf_api_names) self.assertTrue('_tf_api_names' not in TestClassB.__dict__) export_decorator_b = tf_export.tf_export('TestClassB1') export_decorator_b(TestClassB) self.assertEquals(('TestClassA1',), TestClassA._tf_api_names) self.assertEquals(('TestClassB1',), TestClassB._tf_api_names) def testExportSingleConstant(self): module1 = self._CreateMockModule('module1') export_decorator = tf_export.tf_export('NAME_A', 'NAME_B') export_decorator.export_constant('module1', 'test_constant') self.assertEquals([(('NAME_A', 'NAME_B'), 'test_constant')], module1._tf_api_constants) def testExportMultipleConstants(self): module1 = self._CreateMockModule('module1') module2 = self._CreateMockModule('module2') test_constant1 = 123 test_constant2 = 'abc' test_constant3 = 0.5 export_decorator1 = tf_export.tf_export('NAME_A', 'NAME_B') export_decorator2 = tf_export.tf_export('NAME_C', 'NAME_D') export_decorator3 = tf_export.tf_export('NAME_E', 'NAME_F') export_decorator1.export_constant('module1', test_constant1) export_decorator2.export_constant('module2', test_constant2) export_decorator3.export_constant('module2', test_constant3) self.assertEquals([(('NAME_A', 'NAME_B'), 123)], module1._tf_api_constants) self.assertEquals([(('NAME_C', 'NAME_D'), 'abc'), (('NAME_E', 'NAME_F'), 0.5)], module2._tf_api_constants) def testRaisesExceptionIfAlreadyHasAPINames(self): _test_function._tf_api_names = ['abc'] export_decorator = tf_export.tf_export('nameA', 'nameB') with self.assertRaises(tf_export.SymbolAlreadyExposedError): exp
ort_decorator(_test_function) def testRaisesExceptionIfInvalidSymbolName(self): # TensorFlow code is not allowed to export symbols under package
# tf.estimator with self.assertRaises(tf_export.InvalidSymbolNameError): tf_export.tf_export('estimator.invalid') # All symbols exported by Estimator must be under tf.estimator package. with self.assertRaises(tf_export.InvalidSymbolNameError): tf_export.estimator_export('invalid') with self.assertRaises(tf_export.InvalidSymbolNameError): tf_export.estimator_export('Estimator.invalid') with self.assertRaises(tf_export.InvalidSymbolNameError): tf_export.estimator_export('invalid.estimator') def testRaisesExceptionIfInvalidV1SymbolName(self): with self.assertRaises(tf_export.InvalidSymbolNameError): tf_export.tf_export('valid', v1=['estimator.invalid']) with self.assertRaises(tf_export.InvalidSymbolNameError): tf_export.estimator_export('estimator.valid', v1=['invalid']) def testOverridesFunction(self): _test_function2._tf_api_names = ['abc'] export_decorator = tf_export.tf_export( 'nameA', 'nameB', overrides=[_test_function2]) export_decorator(_test_function) # _test_function overrides _test_function2. So, _tf_api_names # should be removed from _test_function2. self.assertFalse(hasattr(_test_function2, '_tf_api_names')) def testMultipleDecorators(self): def get_wrapper(func): def wrapper(*unused_args, **unused_kwargs): pass return tf_decorator.make_decorator(func, wrapper) decorated_function = get_wrapper(_test_function) export_decorator = tf_export.tf_export('nameA', 'nameB') exported_function = export_decorator(decorated_function) self.assertEquals(decorated_function, exported_function) self.assertEquals(('nameA', 'nameB'), _test_function._tf_api_names) if __name__ == '__main__': test.main()
Joccalor/PFunc
PFunc.py
Python
gpl-3.0
130,625
0.000322
#!/usr/bin/env python3 # sudo apt-get install python3-tk # This file is part of PFunc. PFunc provides a set of simple tools for users # to analyze preference functions and other function-valued traits. # # Copyright 2016-2022 Joseph Kilmer # # PFunc is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # PFunc is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # Import statements from tkinter import * from tkinter import filedialog from tkinter import messagebox import tkinter.font as tkFont from sys import argv from sys import platform from os import getcwd from os import environ from os import listdir from os import path from math import log10 from math import ceil as ceiling import shelve import matplotlib matplotlib.use('TkAgg') import matplotlib.pyplot as plt # must come after matplotlib.use('TkAgg') from matplotlib.backends.backend_tkagg import FigureCanvasTkAgg as FigureCanvas from matplotlib.figure import Figure from datetime import datetime # If using matplotlib 2+, make it look like matplotlib 1.5.x if int(matplotlib.__version__.split('.')[0]) >= 2: matplotlib.style.use('classic') # For opening the PDF help file: if platform == 'win32': from os import startfile else: import subprocess # For finding R on the system: try: import rpy2.robjects as robjects # must come after matplotlib or numpy environ['R_HOME'] except: custom_path = '0' if 'PFuncPath.txt' in listdir(): with open('PFuncPath.txt') as pathfile: lines = pathfile.readlines() for l in lines: if l[0:11] == 'custom_path': custom_path = str(l[12:-1]) break if custom_path == '0': if platform == 'win32' and 'R' in listdir('C:\\Program Files'): r_versions = [] for d in listdir('C:\\Program Files\\R'): if d[0:2] == 'R-': r_versions.append(d) custom_path = 'C:\\Program Files\\R\\' + r_versions[-1] elif platform == 'darwin': custom_path = '/Library/Frameworks/R.framework/Resources' elif platform == 'linux': custom_path = '/usr/bin' environ['R_HOME'] = custom_path environ['R_USER'] = path.dirname(path.realpath(argv[0])) import rpy2.robjects as robjects r = robjects.r class PrefFunc(): '''This is the base-level data structure for the program. Each PrefFunc object corresponds to an individual in the dataset. This is called when opening a new file and when creating group-level splines. As input, it takes a dataframe that originated in R, and the names of a bunch of different variables that act as settings for generating splines. ''' def __init__(self, r_data_frame, id_number, smoothing_value, current_sp, sp_lim, sp_min, sp_max, loc_peak, peak_min, peak_max, tol_type, tol_drop, tol_absolute, tol_mode, tol_floor, strength_mode, spline_type='individual'): self.smoothing_value = smoothing_value self.current_sp = current_sp self.sp_lim = sp_lim self.sp_min = sp_min self.sp_max = sp_max self.loc_peak = loc_peak self.peak_min = peak_min self.peak_max = peak_max self.tol_type = tol_type self.tol_drop = tol_drop self.tol_absolute = tol_absolute self.tol_mode = tol_mode self.tol_floor = tol_floor self.strength_mode = strength_mode self.r_data_frame = r_data_frame self.id_number = id_number self.type = spline_type self.sp_status = 'magenta' # magenta = default, cyan = adjusted self.update() self.name = r('names(%s)[2]' % self.r_data_frame.r_repr())[0] self.data_x = r('curr.func$data.x') self.data_y = r('curr.func$data.y') self.page = ((self.id_number - 1) // 9) + 1 self.slot = ((self.id_number - 1) % 9) + 1 self.background = 'white' if self.type == 'group': self.constituents = r('mydf') self.background = '#ffff99' self.name = r('names(%s)[3]' % self.r_data_frame.r_repr())[0] def update(self): self.generate_spline() self.populate_stats() def generate_spline(self): if self.tol_type.get() == 'relative': instance_drop = self.tol_drop.get() instance_floor = self.tol_floor.get() elif self.tol_type.get() == 'absolute': instance_drop = 1 instance_floor = self.tol_absolute.get() if self.loc_peak.get() == 0: instance_peak = '1' elif self.loc_peak.get() == 1: instance_peak = 'c(%s, %s)' % (self.peak_min.get(), self.peak_max.get()) if self.sp_status == 'magenta': self.reset_sp() if self.type == 'group': r("ind.data <- %s[2:3]" % self.r_data_frame.r_repr()) else: r("ind.data <- %s" % self.r_data_frame.r_repr()) r("""curr.func <- PFunc(ind.data, 2, %s, peak.within = %s, drop = %s, tol.mode = '%s', sp.binding = %d, min.sp = %s, max.sp = %s, graph.se = TRUE, forgui = TRUE, tol.floor = %s )""" % (self.smoothing_value.get(), instance_peak, instance_drop, self.tol_mode.get(), self.sp_lim.get(), self.sp_min.get(), self.sp_max.get(), instance_floor)) r("master.gam.list[[%s]] <- curr.func$gam.object" % self.id_number) def populate_stats(self): self.spline_x = r('curr.func$stimulus') self.spline_y = r('curr.func$response') self.se = r('curr.func$se') self.peak_pref = ('%s' % r('curr.func$peak.preference')).split()[1] self.peak_resp = ('%s' % r('curr.func$peak.response')).split()[1] self.broad_tolerance = ('%s' % r('curr.func$broad.tol')).split()[1] self.strict_tolerance = ('%s' % r('
curr.func$strict.tol')).split()[1] self.broad_tolerance_points = r('curr.func$broad.tol.points') self.strict_tolerance_point
s = r('curr.func$strict.tol.points') self.tolerance_height = ('%s' % r('curr.func$tol.height')).split()[1] self.hd_strength = ('%s' % r('curr.func$hd.strength')).split()[1] self.hi_strength = ('%s' % r('curr.func$hi.strength')).split()[1] self.responsiveness = ('%s' % r('curr.func$responsiveness')).split()[1] self.axes_ranges = r('range.bundle') # min.x, max.x, min.y, max.y self.smoothing_value.set(( '%s' % r('curr.func$smoothing.parameter')).split()[1]) self.is_flat = r('curr.func$is.flat') def stiffen(self): '''Increase the smoothing parameter''' self.smoothing_value.set(self.increment_sp(by=0.1)) self.sp_status = 'cyan' self.update() self.current_sp.set(self.smoothing_value.get()) def loosen(self): '''Decrease the smoothing parameter''' self.smoothing_value.set(self.increment_sp(by=-0.1)) self.sp_status = 'cyan' self.update() self.current_sp.set(self.smoothing_value.get()) def reset_sp(self): '''Reset the smoothing parameter to the default value''' self.smoothing_value.set('-1') self.sp_status = 'none' # Protection against infinite loops in update self.update() self.sp_status = 'magenta' def increment_sp(self, by): '''Adjust the smoothing parameter by one step up or down.
datamade/dedupe
dedupe/labeler.py
Python
mit
15,590
0.000513
import random from abc import ABC, abstractmethod import logging import numpy import rlr from typing import List from typing_extensions import Protocol import dedupe.sampling as sampling import dedupe.core as core import dedupe.training as training import dedupe.datamodel as datamodel from dedupe._typing import TrainingExample logger = logging.getLogger(__name__) class ActiveLearner(ABC): @abstractmethod def transform(self) -> None: pass @abstractmethod def pop(self) -> TrainingExample: pass @abstractmethod def mark(self) -> None: pass @abstractmethod def __len__(self) -> int: pass class HasDataModel(Protocol): data_model: datamodel.DataModel class DedupeSampler(object): def _sample(self: HasDataModel, data, blocked_proportion, sample_size) -> List[TrainingExample]: blocked_sample_size = int(blocked_proportion * sample_size) predicates = list(self.data_model.predicates(index_predicates=False)) data = sampling.randomDeque(data) blocked_sample_keys = sampling.dedupeBlockedSample(blocked_sample_size, predicates,
data) random_sample_size = sample_size - len(blocked_sample_keys) random_sample_keys = set(core.randomPairs(len(data), random_sample_size)) data = dict(data) return [(data[k1], data[k2]) for k1, k2 in blocked_sample_keys | random_sample_keys] class RecordLinkSampler(object): def _sample(self: HasDataModel, data_1, data_2, bl
ocked_proportion, sample_size) -> List[TrainingExample]: offset = len(data_1) blocked_sample_size = int(blocked_proportion * sample_size) predicates = list(self.data_model.predicates(index_predicates=False)) deque_1 = sampling.randomDeque(data_1) deque_2 = sampling.randomDeque(data_2) blocked_sample_keys = sampling.linkBlockedSample(blocked_sample_size, predicates, deque_1, deque_2) random_sample_size = sample_size - len(blocked_sample_keys) random_sample_keys = core.randomPairsMatch(len(deque_1), len(deque_2), random_sample_size) unique_random_sample_keys = {(a, b + offset) for a, b in random_sample_keys} return [(data_1[k1], data_2[k2]) for k1, k2 in blocked_sample_keys | unique_random_sample_keys] class RLRLearner(ActiveLearner, rlr.RegularizedLogisticRegression): def __init__(self, data_model): super().__init__(alpha=1) self.data_model = data_model self._candidates: List[TrainingExample] @property def candidates(self) -> List[TrainingExample]: return self._candidates @candidates.setter def candidates(self, new_candidates): self._candidates = new_candidates self.distances = self.transform(self._candidates) random_pair = random.choice(self._candidates) exact_match = (random_pair[0], random_pair[0]) self.fit_transform([exact_match, random_pair], [1, 0]) def transform(self, pairs): return self.data_model.distances(pairs) def fit(self, X, y): self.y = numpy.array(y) self.X = X super().fit(self.X, self.y, cv=False) def fit_transform(self, pairs, y): self.fit(self.transform(pairs), y) def pop(self) -> TrainingExample: if not len(self.candidates): raise IndexError("No more unlabeled examples to label") target_uncertainty = self._bias() probabilities = self.candidate_scores() distance_to_target = numpy.abs(target_uncertainty - probabilities) uncertain_index = distance_to_target.argmin() self.distances = numpy.delete(self.distances, uncertain_index, axis=0) uncertain_pair = self.candidates.pop(uncertain_index) return uncertain_pair def _remove(self, index): self.distances = numpy.delete(self.distances, index, axis=0) def mark(self, pairs, y): self.y = numpy.concatenate([self.y, y]) self.X = numpy.vstack([self.X, self.transform(pairs)]) self.fit(self.X, self.y) def _bias(self): positive = numpy.sum(self.y == 1) n_examples = len(self.y) bias = 1 - (positive / n_examples if positive else 0) # When we have just a few examples we are okay with getting # examples where the model strongly believes the example is # going to be positive or negative. As we get more examples, # prefer to ask for labels of examples the model is more # uncertain of. uncertainty_weight = min(positive, n_examples - positive) bias_weight = 10 weighted_bias = 0.5 * uncertainty_weight + bias * bias_weight weighted_bias /= uncertainty_weight + bias_weight return weighted_bias def candidate_scores(self): return self.predict_proba(self.distances) def __len__(self): return len(self.candidates) class DedupeRLRLearner(DedupeSampler, RLRLearner): def __init__(self, data_model, data, blocked_proportion, sample_size): super().__init__(data_model) self.candidates = self._sample(data, blocked_proportion, sample_size) class RecordLinkRLRLearner(RecordLinkSampler, RLRLearner): def __init__(self, data_model, data_1, data_2, blocked_proportion, sample_size): super.__init__(data_model) self.candidates = self._sample(data_1, data_2, blocked_proportion, sample_size) class BlockLearner(object): def __init__(self, data_model, candidates, *args): self.data_model = data_model self.candidates = candidates self.current_predicates = () self._cached_labels = None self._old_dupes = [] self.block_learner: training.BlockLearner def fit_transform(self, pairs, y): dupes = [pair for label, pair in zip(y, pairs) if label] new_dupes = [pair for pair in dupes if pair not in self._old_dupes] new_uncovered = (not all(self.predict(new_dupes))) if new_uncovered: self.current_predicates = self.block_learner.learn(dupes, recall=1.0) self._cached_labels = None self._old_dupes = dupes def candidate_scores(self): if self._cached_labels is None: labels = self.predict(self.candidates) self._cached_labels = numpy.array(labels).reshape(-1, 1) return self._cached_labels def predict(self, candidates): labels = [] for record_1, record_2 in candidates: for predicate in self.current_predicates: keys = predicate(record_2, target=True) if keys: if set(predicate(record_1)) & set(keys): labels.append(1) break else: labels.append(0) return labels def _remove(self, index): if self._cached_labels is not None: self._cached_labels = numpy.delete(self._cached_labels, index, axis=0) class DedupeBlockLearner(BlockLearner): def __init__(self, data_model, candidates, data, index_include): super().__init__(data_model, candidates) index_data = Sample(data, 50000) sampled_records = Sample(index_data, 5000) preds = self.data_model.predicates() self.block_learner = training.DedupeBlockLearner(preds,
rbong/gimptools
preview.py
Python
gpl-2.0
2,246
0.01959
#!/usr/bin/env python2 from gimpfu import * import time import re def preview (image, delay, loops, force_delay, ignore_hidden, restore_hide): if not image: raise "No image given." layers = image.layers nlayers = len (layers) visible = [] length = [] i = 0 while i < nlayers: visible += [pdb.gimp_item_get_visible (layers [i])] if visible [i]: pdb.gimp_item_set_visible (layers [i], False) name = pdb.gimp_item_get_name (layers [i]) l = None if not force_delay: l = re.search ("\([0-9]+ms\)", name) if l: l = tuple (map (sum, zip (l.span (), tuple ([+1, -3])))) l = name [slice (*l)] if not l: l = delay length += [float (l) / 1000.0] i += 1 j = 0 while j < loops: while i > 0: i -= 1 if (not ignore_hidden) or visible [i]: pdb.gimp_item_set_visible (layers [i], True) pdb.gimp_displays_flush () time.sleep (length [i]) j += 1 # unhides everything for optimized if j < loops: while i < nlayers: if (not ignore_hidden) or visible [i]: pdb.gimp_item_set_visible (layers [i], False) i += 1 else: i = nlayers i = nlayers if restore_hide: while i > 0: i -= 1 if visible [i]: pdb.gimp_item_set_visible (layers [i], True) register( "preview", "preview", "Preview the animation of a gif", "Roger Bongers", "Roger Bongers", "2016", "Preview...", "*", [ (PF_IMAGE, "image", "The image to modify", None), (PF_INT3
2, "delay", "The default length in ms of each frame", 100), (PF_INT32, "loops", "The number of times to loop the animation", 1), (PF_BOOL, "force-delay", "Force the default length on every frame", 0), (PF_BOOL, "ignore-hidden", "Ignore currently hidden items", 0), (PF_BOOL, "restore-hide", "Restore the hidden status after preview", 0), ], [], preview, menu = "<I
mage>/Filters/Animation") main()
LumPenPacK/NetworkExtractionFromImages
win_build/nefi2_win_amd64_msvc_2015/site-packages/networkx/algorithms/hybrid.py
Python
bsd-2-clause
6,084
0.010355
# coding: utf-8 """ Provides functions for finding and testing for locally `(k, l)`-connected graphs. """ __author__ = """Aric Hagberg ([email protected])\nDan Schult ([email protected])""" # Copyright (C) 2004-2015 by # Aric Hagberg <[email protected]> # Dan Schult <[email protected]> # Pieter Swart <[email protected]> # All rights reserved. # BSD license. _all__ = ['kl_connected_subgraph', 'is_kl_connected'] import copy import networkx as nx def kl_connected_subgraph(G, k, l, low_memory=False, same_as_graph=False): """Returns the maximum locally `(k, l)`-connected subgraph of ``G``. A graph is locally `(k, l)`-connected if for each edge `(u, v)` in the graph there are at least `l` edge-disjoint paths of length at most `k` joining `u` to `v`. Parameters ---------- G : NetworkX graph The graph in which to find a maximum locally `(k, l)`-connected subgraph. k : integer The maximum length of paths to consider. A higher number means a looser connectivity requirement. l : integer The number of edge-disjoint paths. A higher number means a stricter connectivity requirement. low_memory : bool If this is ``True``, this function uses an algorithm that uses slightly more time but less memory. same_as_graph : bool If this is ``True`` then return a tuple of the form ``(H, is_same)``, where ``H`` is the maximum locally `(k, l)`-connected subgraph and ``is_same`` is a Boolean representing whether ``G`` is locally `(k, l)`-connected (and hence, whether ``H`` is simply a copy of the input graph ``G``). Returns ------- NetworkX graph or two-tuple If ``same_as_graph`` is ``True``, then this function returns a two-tuple as described above. Otherwise, it returns only the maximum locally `(k, l)`-connected subgraph. See also -------- is_kl_connected References ---------- .. [1]: Chung, Fan and Linyuan Lu. "The Small World Phenomenon in Hybrid Power Law Graphs." *Complex Networks*. Springer Berlin Heidelberg, 2004. 89--104. """ H=copy.deepcopy(G) # subgraph we construct by removing from G graphOK=True deleted_some=True # hack to start off the while loop while deleted_some: deleted_some=False for edge in H.edges(): (u,v)=edge ### Get copy of graph needed for this search if low_memory: verts=set([u,v]) for i in range(k): [verts.update(G.neighbors(w)) for w in verts.copy()] G2=G.subgraph(list(verts)) else: G2=copy.deepcopy(G) ### path=[u,v] cnt=0 accept=0 while path: cnt += 1 # Found a path if cnt>=l: accept=1 break # record edges along this gr
aph prev=u for w in path: if prev!=w:
G2.remove_edge(prev,w) prev=w # path=shortest_path(G2,u,v,k) # ??? should "Cutoff" be k+1? try: path=nx.shortest_path(G2,u,v) # ??? should "Cutoff" be k+1? except nx.NetworkXNoPath: path = False # No Other Paths if accept==0: H.remove_edge(u,v) deleted_some=True if graphOK: graphOK=False # We looked through all edges and removed none of them. # So, H is the maximal (k,l)-connected subgraph of G if same_as_graph: return (H,graphOK) return H def is_kl_connected(G, k, l, low_memory=False): """Returns ``True`` if and only if ``G`` is locally `(k, l)`-connected. A graph is locally `(k, l)`-connected if for each edge `(u, v)` in the graph there are at least `l` edge-disjoint paths of length at most `k` joining `u` to `v`. Parameters ---------- G : NetworkX graph The graph to test for local `(k, l)`-connectedness. k : integer The maximum length of paths to consider. A higher number means a looser connectivity requirement. l : integer The number of edge-disjoint paths. A higher number means a stricter connectivity requirement. low_memory : bool If this is ``True``, this function uses an algorithm that uses slightly more time but less memory. Returns ------- bool Whether the graph is locally `(k, l)`-connected subgraph. See also -------- kl_connected_subgraph References ---------- .. [1]: Chung, Fan and Linyuan Lu. "The Small World Phenomenon in Hybrid Power Law Graphs." *Complex Networks*. Springer Berlin Heidelberg, 2004. 89--104. """ graphOK=True for edge in G.edges(): (u,v)=edge ### Get copy of graph needed for this search if low_memory: verts=set([u,v]) for i in range(k): [verts.update(G.neighbors(w)) for w in verts.copy()] G2=G.subgraph(verts) else: G2=copy.deepcopy(G) ### path=[u,v] cnt=0 accept=0 while path: cnt += 1 # Found a path if cnt>=l: accept=1 break # record edges along this graph prev=u for w in path: if w!=prev: G2.remove_edge(prev,w) prev=w # path=shortest_path(G2,u,v,k) # ??? should "Cutoff" be k+1? try: path=nx.shortest_path(G2,u,v) # ??? should "Cutoff" be k+1? except nx.NetworkXNoPath: path = False # No Other Paths if accept==0: graphOK=False break # return status return graphOK
mogui/pyorient
tests/test_raw_messages_2.py
Python
apache-2.0
12,897
0.016283
__author__ = 'Ostico <[email protected]>' import sys import os import unittest from pyorient.exceptions import * from pyorient import OrientSocket from pyorient.messages.database import * from pyorient.messages.commands import * from pyorient.messages.cluster import * from pyorient.messages.records import * from pyorient.messages.connection import * from pyorient.constants import DB_TYPE_DOCUMENT, QUERY_SYNC, \ STORAGE_TYPE_PLOCAL, DB_TYPE_GRAPH, STORAGE_TYPE_MEMORY os.environ['DEBUG'] = "0" os.environ['DEBUG_VERBOSE'] = "0" if os.path.realpath( '../' ) not in sys.path: sys.path.insert( 0, os.path.realpath( '../' ) ) if os.path.realpath( '.' ) not in sys.path: sys.path.insert( 0, os.path.realpath( '.' ) ) class RawMessages_2_TestCase(unittest.TestCase): """ Command Test Case """ def test_record_object(self): x = OrientRecord() assert x._rid is None assert x._version is None assert x._class is None def test_record_load(self): connection = OrientSocket( "localhost", 2424 ) assert connection.session_id == -1 # ################## msg = DbOpenMessage( connection ) db_name = "GratefulDeadConcerts" cluster_info = msg.prepare( (db_name, "admin", "admin", DB_TYPE_DOCUMENT, "") ).send().fetch_response() assert len(cluster_info) != 0 def _test_callback(record): assert record is not [] assert record._rid is not None # assert no exception req_msg = RecordLoadMessage( connection ) res = req_msg.prepare( [ "#11:0", "*:2", _test_callback ] ) \ .send().fetch_response() assert res._rid == "#11:0" assert res._class == 'followed_by' assert res._in != 0 assert res._out != 0 def test_record_count_with_no_opened_db(self): connection = OrientSocket( "localhost", 2424 ) assert connection.session_id == -1 # ################## conn_msg = ConnectMessage( connection ) session_id = conn_msg.prepare( ("root", "root") )\ .send().fetch_response() assert session_id == connection.session_id assert session_id != -1 try: count_msg = DbCountRecordsMessage( connection ) res = count_msg.prepare().send().fetch_response() assert False # we expect an exception because we need a db opened except PyOrientDatabaseException: assert True def test_record_count(self): connection = OrientSocket( "localhost", 2424 ) assert connection.session_id == -1 # ################## msg = DbOpenMessage( connection ) db_name = "GratefulDeadConcerts" cluster_info = msg.prepare( (db_name, "admin", "admin", DB_TYPE_DOCUMENT, "") ).send().fetch_response() assert len(cluster_info) != 0 session_id = connection.session_id assert session_id != -1 count_msg = DbCountRecordsMessage( connection ) res = count_msg.prepare().send().fetch_response() assert res is not 0 assert res > 0 def test_record_create_update(self): connection = OrientSocket( "localhost", 2424 ) conn_msg = ConnectMessage( connection ) assert connection.protocol != -1 session_id = conn_msg.prepare( ("root", "root") ) \ .send().fetch_response() assert session_id == connection.session_id assert session_id != -1 # ################## db_name = "my_little_test" msg = DbExistsMessage( connection ) exists = msg.prepare( [db_name] ).send().fetch_response() print("Before %r" % exists) try: ( DbDropMessage( connection ) ).prepare([db_name]) \ .send().fetch_response() assert True except PyOrientCommandException as e: print(str(e)) finally: ( DbCreateMessage( connection ) ).prepare( (db_name, DB_TYPE_GRAPH, STORAGE_TYPE_MEMORY) ).send().fetch_response() msg = DbOpenMessage( connection ) cluster_info = msg.prepare( (db_name, "admin", "admin", DB_TYPE_GRAPH, "") ).send().fetch_response() assert len(cluster_info) != 0 try: create_class = CommandMessage(connection) cluster = create_class.prepare((QUERY_CMD, "create class my_class " "extends V"))\ .send().fetch_response()[0] except PyOrientCommandException: # class my_class already exists pass # classes are not allowed in record create/update/load rec = { '@my_class': { 'alloggio': 'casa', 'lavoro': 'ufficio', 'vacanza': 'mare' } } rec_position = ( RecordCreateMessage(connection) )\ .prepare( ( cluster, rec ) )\ .send().fetch_response() print("New Rec Position: %s" % rec_position._rid) assert rec_position._rid is not None rec = { '@my_class': { 'alloggio': 'albergo', 'lavoro': 'ufficio', 'vacanza': 'montagna' } } update_success = ( RecordUpdateMessage(connection) )\
.prepare( ( cluster, rec_position._rid, rec ) )\ .send().fetch_response() assert update_success[0] != 0 if connection.protocol <= 21: return unittest.skip("Protocol {!r} does not works well".format( connection.protocol )) # ski
p test res = ( CommandMessage( connection ) )\ .prepare( [ QUERY_SYNC, "select from " + rec_position._rid ] )\ .send().fetch_response() # res = [ ( RecordLoadMessage(connection) ).prepare( # [ rec_position._rid ] # ).send().fetch_response() ] print("%r" % res[0]._rid) print("%r" % res[0]._class) print("%r" % res[0]._version) print("%r" % res[0].alloggio) print("%r" % res[0].lavoro) print("%r" % res[0].vacanza) assert res[0]._rid == '#11:0' # assert res[0]._class == 'my_class' assert res[0]._version >= 0 assert res[0].alloggio == 'albergo' assert res[0].lavoro == 'ufficio' assert res[0].vacanza == 'montagna' sid = ( ConnectMessage( connection ) ).prepare( ("root", "root") ) \ .send().fetch_response() # at the end drop the test database ( DbDropMessage( connection ) ).prepare([db_name]) \ .send().fetch_response() def test_record_delete(self): connection = OrientSocket( "localhost", 2424 ) conn_msg = ConnectMessage( connection ) assert connection.protocol != -1 session_id = conn_msg.prepare( ("root", "root") ) \ .send().fetch_response() print("Sid: %s" % session_id) assert session_id == connection.session_id assert session_id != -1 db_name = "my_little_test" msg = DbExistsMessage( connection ) exists = msg.prepare( [db_name] ).send().fetch_response() print("Before %r" % exists) try: ( DbDropMessage( connection ) ).prepare([db_name]) \ .send().fetch_response() assert True except PyOrientCommandException as e: print(str(e)) finally: ( DbCreateMessage( connection ) ).prepare( (db_name, DB_TYPE_DOCUMENT, STORAGE_TYPE_MEMORY) ).send().fetch_response() msg = DbOpenMessage( connection ) cluster_info = msg.prepare( (db_name, "admin", "admin", DB_TYPE_DOCUMENT, "") ).send().fetch_response() assert len(cluster_info) != 0 rec = { 'alloggio': 'casa', 'lavoro': 'ufficio', 'vacanza': 'mare' } rec_position = ( RecordCreateMessage(connection) )\ .prepare( ( 1, rec ) )\ .send().fetch_response() print("New Rec Position: %s" % rec_position._rid) assert rec_position._rid is not None ######################## Check Success
clarkperkins/stackdio
stackdio/api/formulas/exceptions.py
Python
apache-2.0
753
0
# -*- coding: utf-8 -*- # Copyright 2017, Digital Reasoning # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITION
S OF ANY KIND, either express or i
mplied. # See the License for the specific language governing permissions and # limitations under the License. # from __future__ import unicode_literals class InvalidFormula(Exception): pass class InvalidFormulaComponent(InvalidFormula): pass
facebookresearch/ParlAI
parlai/tasks/dialog_babi/build.py
Python
mit
1,182
0
#!/usr/bin/env python3 # Copyright (c) Facebook, Inc. and its affiliates. # This source code is licensed under the MIT license found in
the # LICENSE file in the root directory of this source tree. # Download and build the data if it does not exist. from parlai.core.build_data import DownloadableFile import parlai.core.build_data as build_data import os RESOURCES = [ DownloadableFile( 'http://parl.ai/downloads/dialog_babi/dialog_babi.tar.gz', 'dialog_babi.tar.gz', 'bb36155ccd41eac91f806446c5728ee90374e5596156a9f7c1b86f8342cfc383', ) ] def build(opt): dpath = os.path.
join(opt['datapath'], 'dialog-bAbI') version = None if not build_data.built(dpath, version_string=version): print('[building data: ' + dpath + ']') if build_data.built(dpath): # An older version exists, so remove these outdated files. build_data.remove_dir(dpath) build_data.make_dir(dpath) # Download the data. for downloadable_file in RESOURCES: downloadable_file.download_file(dpath) # Mark the data as built. build_data.mark_done(dpath, version_string=version)
barrachri/epcon
microblog/views.py
Python
bsd-2-clause
7,631
0.003014
# -*- coding: UTF-8 -*- from django.conf import settings as dsettings from django.contrib.auth import models as authModels from django.core.paginator import Paginator, InvalidPage, EmptyPage from django.http import HttpResponse, Http404 from django.shortcuts import render, render_to_response, get_object_or_404 from django.template import RequestContext from django.template.defaultfilters import slugify from microblog import models, settings from taggit.models import Tag, TaggedItem from decorator import decorator try: import json except ImportError: import simplejson as json def render_json(f): """ decoratore da applicare ad una vista per serializzare in json il risultato. """ if dsettings.DEBUG: ct = 'text/plain' j = lambda d: json.dumps(d, indent=2) else: ct = 'application/json' j = json.dumps def wrapper(func, *args, **kw): try: result = func(*args, **kw) except Exception, e: result = j(str(e)) status = 500 else: if isinstance(result, HttpResponse): return result else: result = j(result) status = 200 return HttpResponse(content=result, content_type=ct, status=status) return decorator(wrapper, f) def post_list(request): return render(request, 'microblog/post_list.html', {}) def category(request, category): category = get_object_or_404(models.Category, name=category) return render_to_response( 'microblog/category.html', { 'category': category, }, context_instance=RequestContext(request) ) def post_list_by_year(request, year, month=None): return render_to_response( 'microblog/list_by_year.html', { 'year': year, 'month': month, }, context_instance=RequestContext(request) ) def tag(request, tag): tag = get_object_or_404(Tag, name=tag) return render_to_response( 'microblog/tag.html', { 'tag': tag, }, context_instance=RequestContext(request) ) def author(request, author): user = [ u for u in authModels.User.objects.all() if slugify('%s-%s' % (u.first_name, u.last_name)) == author ] if not user: raise Http404() else: user = user[0] return render_to_response( 'microblog/author.html', { 'author': user, }, context_instance=RequestContext(request) ) def _paginate_posts(post_list, request): if settings.MICROBLOG_POST_LIST_PAGINATION: paginator = Paginator(post_list, settings.MICROBLOG_POST_PER_PAGE) try: page = int(request.GET.get("page", "1")) except ValueError: page = 1 try: posts = paginator.page(page) except (EmptyPage, InvalidP
age): posts = paginator.page(1) else: paginator = Paginator(post_list, len(post_list) or 1) posts = paginator.page(1) return posts def _posts_list(request, featured=False): if settings.MICROBLOG_LANGUAGE_FALLBACK_ON_POST_LIST: lang = None else: lang = request.LANGUAGE_CODE return models.Post.objects\ .byLanguage(lang)\ .byFeatured(featured)\ .published()
def _post_detail(request, content): if not settings.MICROBLOG_POST_FILTER([content.post], request.user): raise Http404() return render_to_response( 'microblog/post_detail.html', { 'post': content.post, 'content': content }, context_instance=RequestContext(request) ) def _trackback_ping(request, content): def success(): x = ('<?xml version="1.0" encoding="utf-8"?>\n' '<response><error>0</error></response>') return HttpResponse(content=x, content_type='text/xml') def failure(message=''): x = ('<?xml version="1.0" encoding="utf-8"?>\n' '<response><error>1</error><message>%s</message></response>') % message return HttpResponse(content=x, content_type='text/xml', status=400) if request.method != 'POST': return failure('only POST method is supported') if not request.POST.get('url'): return failure('url argument is mandatory') t = { 'url': request.POST['url'], 'blog_name': request.POST.get('blog_name', ''), 'title': request.POST.get('title', ''), 'excerpt': request.POST.get('excerpt', ''), } from microblog.moderation import moderate if not moderate(request, 'trackback', t['title'], url=t['url']): return failure('moderated') content.new_trackback(**t) return success() @render_json def _comment_count(request, content): post = content.post if settings.MICROBLOG_COMMENT == 'comment': import django_comments as comments from django.contrib.contenttypes.models import ContentType model = comments.get_model() q = model.objects.filter( content_type=ContentType.objects.get_for_model(post), object_pk=post.id, is_public=True ) return q.count() else: import httplib2 from urllib import quote h = httplib2.Http() params = { 'forum_api_key': settings.MICROBLOG_COMMENT_DISQUS_FORUM_KEY, 'url': content.get_url(), } args = '&'.join('%s=%s' % (k, quote(v)) for k, v in params.items()) url = settings.MICROBLOG_COMMENT_DISQUS_API_URL + 'get_thread_by_url?%s' % args resp, page = h.request(url) if resp.status != 200: return -1 page = json.loads(page) if not page['succeeded']: return -1 elif page['message'] is None: return 0 else: return page['message']['num_comments'] def _post404(f): def wrapper(*args, **kw): try: return f(*args, **kw) except models.PostContent.DoesNotExist: raise Http404() return wrapper if settings.MICROBLOG_URL_STYLE == 'date': def _get(slug, year, month, day): return models.PostContent.objects\ .select_related('post')\ .getBySlugAndDate(slug, year, month, day) @_post404 def post_detail(request, year, month, day, slug): return _post_detail( request, content=_get(slug, year, month, day) ) @_post404 def trackback_ping(request, year, month, day, slug): return _trackback_ping( request, content=_get(slug, year, month, day) ) @_post404 def comment_count(request, year, month, day, slug): return _comment_count( request, content = _get(slug, year, month, day) ) elif settings.MICROBLOG_URL_STYLE == 'category': def _get(slug, category): return models.PostContent.objects\ .select_related('post')\ .getBySlugAndCategory(slug, category) @_post404 def post_detail(request, category, slug): return _post_detail( request, content=_get(slug, category), ) @_post404 def trackback_ping(request, category, slug): return _trackback_ping( request, content=_get(slug, category), ) @_post404 def comment_count(request, category, slug): return _comment_count( request, content=_get(slug, category), )
nick-monto/SpeechRecog_CNN
create_spectrograms_16k.py
Python
mit
6,802
0.002205
#!/usr/bin/env python import os import numpy as np import math import fnmatch from my_spectrogram import my_specgram from collections import OrderedDict from scipy.io import wavfile import matplotlib.pylab as plt from pylab import rcParams from sklearn.model_selection import train_test_split rcParams['figure.figsize'] = 6, 3 SCRIPT_DIR = os.getcwd() INPUT_FOLDER = 'Input_audio_wav_16k/' OUTPUT_FOLDER = 'Input_spectrogram_16k/' languages = os.listdir(INPUT_FOLDER) languages.sort() audio_dict = OrderedDict() for l in languages: audio_dict[l] = sorted(os.listdir(INPUT_FOLDER + l)) def plot_spectrogram(audiopath, plotpath=None, NFFT_window=0.025, noverlap_window=0.023, freq_min=None, freq_max=None, axis='off'): fs, data = wavfile.read(audiopat
h) data = data / data.max() center = data.mean() * 0.2 data = data + np.random.normal(center, abs(center * 0.5), len(data)) NFFT = pow(2, int(math.log(int(fs*NFFT_window), 2) + 0.5)) # 25ms window, nearest power of 2 noverlap = int(fs*noverlap_window) fc = int(np.sqrt(freq_min*freq
_max)) # Pxx is the segments x freqs array of instantaneous power, freqs is # the frequency vector, bins are the centers of the time bins in which # the power is computed, and im is the matplotlib.image.AxesImage # instance Pxx, freqs, bins, im = my_specgram(data, NFFT=NFFT, Fs=fs, Fc=fc, detrend=None, window=np.hanning(NFFT), noverlap=noverlap, cmap='Greys', xextent=None, pad_to=None, sides='default', scale_by_freq=None, minfreq=freq_min, maxfreq=freq_max) plt.axis(axis) im.axes.axis('tight') im.axes.get_xaxis().set_visible(False) im.axes.get_yaxis().set_visible(False) if plotpath: plt.savefig(plotpath, bbox_inches='tight', transparent=False, pad_inches=0, dpi=96) else: plt.show() plt.clf() # same as training but no added noise def plot_spectrogram_val(audiopath, plotpath=None, NFFT_window=0.025, noverlap_window=0.023, freq_min=None, freq_max=None, axis='off'): fs, data = wavfile.read(audiopath) data = data / data.max() NFFT = pow(2, int(math.log(int(fs*NFFT_window), 2) + 0.5)) # 25ms window, nearest power of 2 noverlap = int(fs*noverlap_window) fc = int(np.sqrt(freq_min*freq_max)) # Pxx is the segments x freqs array of instantaneous power, freqs is # the frequency vector, bins are the centers of the time bins in which # the power is computed, and im is the matplotlib.image.AxesImage # instance Pxx, freqs, bins, im = my_specgram(data, NFFT=NFFT, Fs=fs, Fc=fc, detrend=None, window=np.hanning(NFFT), noverlap=noverlap, cmap='Greys', xextent=None, pad_to=None, sides='default', scale_by_freq=None, minfreq=freq_min, maxfreq=freq_max) plt.axis(axis) im.axes.axis('tight') im.axes.get_xaxis().set_visible(False) im.axes.get_yaxis().set_visible(False) if plotpath: plt.savefig(plotpath, bbox_inches='tight', transparent=False, pad_inches=0, dpi=96) else: plt.show() plt.clf() # create spectrograms of randomly drawn samples from each language def find(pattern, path): result = [] for root, dirs, files in os.walk(path): for name in files: if fnmatch.fnmatch(name, pattern): result.append(os.path.join(root, name)) return result[0] random_wav = [] for key in audio_dict: random_wav.append(sorted(np.random.choice(audio_dict[key], 500, replace=False))) training_list = [] validation_list = [] for i in range(0, len(random_wav)): x_train, x_val = train_test_split(random_wav[i], test_size=0.4, random_state=42) training_list.append(x_train) validation_list.append(x_val) if not os.path.exists(OUTPUT_FOLDER + 'Training'): os.makedirs(OUTPUT_FOLDER + 'Training') print('Successfully created a training folder!') print('Populating training folder with spectrograms...') for i in range(0, len(training_list)): if not os.path.exists(OUTPUT_FOLDER + 'Training/' + str(languages[i])): os.makedirs(OUTPUT_FOLDER + 'Training/' + str(languages[i])) print('Successfully created a {} training folder!'.format(languages[i])) print('Populating {} training folder with spectrograms...'.format(languages[i])) for j in range(0, len(training_list[i])): for k in range(0, 3): plot_spectrogram(find(training_list[i][j], INPUT_FOLDER), plotpath=OUTPUT_FOLDER + 'Training/' + str(languages[i]) + '/' + str(training_list[i][j][:-4]) + '_' + str(k) + '.jpeg', NFFT_window=0.025, noverlap_window=0.023, freq_min=0, freq_max=5500) print('Done with {}.'.format(training_list[i][j][:-4])) if not os.path.exists(OUTPUT_FOLDER + 'Validation'): os.makedirs(OUTPUT_FOLDER + 'Validation') print('Successfully created a validation folder!') print('Populating validation folder with spectrograms...') for i in range(0, len(validation_list)): if not os.path.exists(OUTPUT_FOLDER + 'Validation/' + str(languages[i])): os.makedirs(OUTPUT_FOLDER + 'Validation/' + str(languages[i])) print('Successfully created a {} validation folder!'.format(languages[i])) print('Populating {} validation folder with spectrograms...'.format(languages[i])) for j in range(0, len(validation_list[i])): for k in range(0, 1): plot_spectrogram_val(find(validation_list[i][j], INPUT_FOLDER), plotpath=OUTPUT_FOLDER + 'Validation/' + str(languages[i]) + '/' + str(validation_list[i][j][:-4]) + '_' + str(k) + '.jpeg', NFFT_window=0.025, noverlap_window=0.023, freq_min=0, freq_max=5500) print('Done with {}.'.format(validation_list[i][j][:-4]))
cypreess/csvkit
csvkit/cli.py
Python
mit
15,243
0.007479
#!/usr/bin/env python import argparse import bz2 import gzip import os.path import sys from csvkit import CSVKitReader from csvkit.exceptions import ColumnIdentifierError, RequiredHeaderE
rror def lazy_opener(fn): def wrapped(self, *args, **kwargs):
self._lazy_open() fn(*args, **kwargs) return wrapped class LazyFile(object): """ A proxy for a File object that delays opening it until a read method is called. Currently this implements only the minimum methods to be useful, but it could easily be expanded. """ def __init__(self, init, *args, **kwargs): self.init = init self.f = None self._is_lazy_opened = False self._lazy_args = args self._lazy_kwargs = kwargs def __getattr__(self, name): if not self._is_lazy_opened: self.f = self.init(*self._lazy_args, **self._lazy_kwargs) self._is_lazy_opened = True return getattr(self.f, name) def __iter__(self): return self def close(self): self.f.close() self.f = None self._is_lazy_opened = False def next(self): if not self._is_lazy_opened: self.f = self.init(*self._lazy_args, **self._lazy_kwargs) self._is_lazy_opened = True return self.f.next() class CSVFileType(object): """ An argument factory like argparse.FileType with compression support. """ def __init__(self, mode='rb'): """ Initialize the factory. """ self._mode = mode def __call__(self, path): """ Build a file-like object from the specified path. """ if path == '-': if 'r' in self._mode: return sys.stdin elif 'w' in self._mode: return sys.stdout else: raise ValueError('Invalid path "-" with mode {0}'.format(self._mode)) else: (_, extension) = os.path.splitext(path) if extension == '.gz': return LazyFile(gzip.open, path, self._mode) if extension == '.bz2': return LazyFile(bz2.BZ2File, path, self._mode) else: return LazyFile(open, path, self._mode) class CSVKitUtility(object): description = '' epilog = '' override_flags = '' def __init__(self, args=None, output_file=None): """ Perform argument processing and other setup for a CSVKitUtility. """ self._init_common_parser() self.add_arguments() self.args = self.argparser.parse_args(args) self.reader_kwargs = self._extract_csv_reader_kwargs() self.writer_kwargs = self._extract_csv_writer_kwargs() self._install_exception_handler() if output_file is None: self.output_file = sys.stdout else: self.output_file = output_file # Ensure SIGPIPE doesn't throw an exception # Prevents [Errno 32] Broken pipe errors, e.g. when piping to 'head' # To test from the shell: # python -c "for i in range(5000): print 'a,b,c'" | csvlook | head # Without this fix you will see at the end: # [Errno 32] Broken pipe # With this fix, there should be no error # For details on Python and SIGPIPE, see http://bugs.python.org/issue1652 try: import signal signal.signal(signal.SIGPIPE, signal.SIG_DFL) except (ImportError, AttributeError): #Do nothing on platforms that don't have signals or don't have SIGPIPE pass def add_arguments(self): """ Called upon initialization once the parser for common arguments has been constructed. Should be overriden by individual utilities. """ raise NotImplementedError('add_arguments must be provided by each subclass of CSVKitUtility.') def main(self): """ Main loop of the utility. Should be overriden by individual utilities and explicitly called by the executing script. """ raise NotImplementedError(' must be provided by each subclass of CSVKitUtility.') def _init_common_parser(self): """ Prepare a base argparse argument parser so that flags are consistent across different shell command tools. If you want to constrain which common args are present, you can pass a string for 'omitflags'. Any argument whose single-letter form is contained in 'omitflags' will be left out of the configured parser. Use 'f' for file. """ self.argparser = argparse.ArgumentParser(description=self.description, epilog=self.epilog) # Input if 'f' not in self.override_flags: self.argparser.add_argument('file', metavar="FILE", nargs='?', type=CSVFileType(), default=sys.stdin, help='The CSV file to operate on. If omitted, will accept input on STDIN.') if 'd' not in self.override_flags: self.argparser.add_argument('-d', '--delimiter', dest='delimiter', help='Delimiting character of the input CSV file.') if 't' not in self.override_flags: self.argparser.add_argument('-t', '--tabs', dest='tabs', action='store_true', help='Specifies that the input CSV file is delimited with tabs. Overrides "-d".') if 'q' not in self.override_flags: self.argparser.add_argument('-q', '--quotechar', dest='quotechar', help='Character used to quote strings in the input CSV file.') if 'u' not in self.override_flags: self.argparser.add_argument('-u', '--quoting', dest='quoting', type=int, choices=[0,1,2,3], help='Quoting style used in the input CSV file. 0 = Quote Minimal, 1 = Quote All, 2 = Quote Non-numeric, 3 = Quote None.') if 'b' not in self.override_flags: self.argparser.add_argument('-b', '--doublequote', dest='doublequote', action='store_true', help='Whether or not double quotes are doubled in the input CSV file.') if 'p' not in self.override_flags: self.argparser.add_argument('-p', '--escapechar', dest='escapechar', help='Character used to escape the delimiter if --quoting 3 ("Quote None") is specified and to escape the QUOTECHAR if --doublequote is not specified.') if 'z' not in self.override_flags: self.argparser.add_argument('-z', '--maxfieldsize', dest='maxfieldsize', type=int, help='Maximum length of a single field in the input CSV file.') if 'e' not in self.override_flags: self.argparser.add_argument('-e', '--encoding', dest='encoding', default='utf-8', help='Specify the encoding the input CSV file.') if 'S' not in self.override_flags: self.argparser.add_argument('-S', '--skipinitialspace', dest='skipinitialspace', default=False, action='store_true', help='Ignore whitespace immediately following the delimiter.') if 'H' not in self.override_flags: self.argparser.add_argument('-H', '--no-header-row', dest='no_header_row', action='store_true', help='Specifies that the input CSV file has no header row. Will create default headers.') if 'v' not in self.override_flags: self.argparser.add_argument('-v', '--verbose', dest='verbose', action='store_true', help='Print detailed tracebacks when errors occur.') # Output if 'l' not in self.override_flags: self.argparser.add_argument('-l', '--linenumbers', dest='line_numbers', action='store_true', help='Insert a column of line numbers at the front of the output. Useful when piping to grep or as a simple primary key.') # Input/Output if 'zero' not in self.override_flags: self.argpars
szaydel/psutil
test/_sunos.py
Python
bsd-3-clause
1,322
0.000756
#!/usr/bin/env python # Copyright (c) 2009, Giampaolo Rodola'. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. """Sun OS specific tests. These are implicitly run by test_psutil.py.""" import psutil from test_psutil import * class SunOSSpecificTestCase(unittest.TestCase): def test_swap_memory(self): out = sh('swap -l -k') lines = out.strip().split('\n')[1:]
if not lines: raise ValueError('no swap device(s) configured') total = free = 0 for l
ine in lines: line = line.split() t, f = line[-2:] t = t.replace('K', '') f = f.replace('K', '') total += int(int(t) * 1024) free += int(int(f) * 1024) used = total - free psutil_swap = psutil.swap_memory() self.assertEqual(psutil_swap.total, total) self.assertEqual(psutil_swap.used, used) self.assertEqual(psutil_swap.free, free) def test_main(): test_suite = unittest.TestSuite() test_suite.addTest(unittest.makeSuite(SunOSSpecificTestCase)) result = unittest.TextTestRunner(verbosity=2).run(test_suite) return result.wasSuccessful() if __name__ == '__main__': if not test_main(): sys.exit(1)
akkana/pi-zero-w-book
ch2/blink-rpigpio.py
Python
gpl-2.0
468
0
#!/usr/bin/env python # Blink an LED using the RPi.GPIO library. import RPi.GPIO as GPIO from time import sleep # Use GPIO numbering: GPIO.setmode(GPIO.BCM) # Set pin GPIO
14 to be output: GPIO.setup(14, GPIO.OUT) try: while True: GPIO.output(14, GPIO.HIGH) sleep(.5) GPIO.output(14, GPIO.LOW) sleep(.5) # If we get a Ctrl-C, clean up so
we don't get warnings from other programs: except KeyboardInterrupt: GPIO.cleanup()
RobLoach/lutris
tests/check_prefixes.py
Python
gpl-3.0
1,465
0.002048
#!/usr/bin/python3 import os import sys import subprocess sys.path.insert(0,
os.path.dirname(os.path.d
irname(os.path.abspath(__file__)))) from lutris.util.wineregistry import WineRegistry PREFIXES_PATH = os.path.expanduser("~/Games/wine/prefixes") def get_registries(): registries = [] directories = os.listdir(PREFIXES_PATH) directories.append(os.path.expanduser("~/.wine")) for prefix in directories: for path in os.listdir(os.path.join(PREFIXES_PATH, prefix)): if path.endswith(".reg"): registries.append(os.path.join(PREFIXES_PATH, prefix, path)) return registries def check_registry(registry_path): with open(registry_path, 'r') as registry_file: original_content = registry_file.read() try: registry = WineRegistry(registry_path) except: sys.stderr.write("Error parsing {}\n".format(registry_path)) raise content = registry.render() if content != original_content: wrong_path = os.path.join(os.path.dirname(__file__), 'error.reg') with open(wrong_path, 'w') as wrong_reg: wrong_reg.write(content) print("Content of parsed registry doesn't match: {}".format(registry_path)) subprocess.call(["meld", registry_path, wrong_path]) sys.exit(2) registries = get_registries() for registry in registries: check_registry(registry) print("All {} registry files validated!".format(len(registries)))
zrhans/python
exemplos/Examples.lnk/bokeh/glyphs/dateaxis.py
Python
gpl-2.0
1,293
0
from __future__ import print_function from numpy import pi, arange, sin import numpy as np import time from bokeh.browserlib import view from bokeh.document import Document from bokeh.embed import file_html from bokeh.models.glyphs import Circle from bokeh.models import ( Plot, DataRange1d, DatetimeAxis, ColumnDataSource, PanTool, WheelZoomTool ) from bokeh.resources import INLINE x = arange(-2 * pi, 2 * pi, 0.1) y = sin(x) # Create an array of times, starting at the current time, and extending # for len(x) number of hours. times = np.arange(len(x)) * 3600000 + time.time() source = ColumnDataSource( data=dict(x=x, y=y, times=times) ) xdr = DataRange1d(sources=[source.columns("times")]) ydr = DataRange1d(sources=[source.columns("y")]) plot = Plot(x_range=xdr, y_range=ydr, min_border=80) circle = Circle(x="times", y="y", fill_color="red", size=5, line_color="black") plot.add_glyph(source, circle) plot.add_layout(DatetimeAxis(), 'below') plot.add_layout(DatetimeAxis(), 'left') plot.add_tools(PanTool(), WheelZoomTool()) doc = Document() doc.add(plot) if __name__ == "__main__": filename = "date
axis.html" with open(filename, "w") as f: f.write(file_html(doc, INLINE, "Date Axis
Example")) print("Wrote %s" % filename) view(filename)
joeymeyer/raspberryturk
raspberryturk/core/vision/chessboard_frame.py
Python
mit
371
0.002695
import numpy as np from square import Square from constants import SQUARE_SIZE, BOARD_SIZE class ChessboardFrame(): def __init__(self,
img): self.img = img def square_at(self, i): y = BOARD_SIZE - ((i / 8) % 8) * SQUARE_SIZE - SQUARE_SIZE x = (i % 8) * SQUARE_SIZE return Square(i, self.img[y:y+SQUARE_SIZE, x:x+SQUA
RE_SIZE, :])
Mlieou/leetcode_python
leetcode/python/ex_402.py
Python
mit
405
0.002469
class Solution(object):
def removeKdigits(self, num, k): """ :type num: str :type k: int :rtype: str """ stack = [] length = len(num) - k for c in num: while k and stack and stack[-1] > c: stack.pop() k -= 1 stack.append(c)
return ''.join(stack[:length]).lstrip('0') or '0'
liulion/mayavi
tvtk/plugins/scene/scene_manager.py
Python
bsd-3-clause
2,756
0.002177
""" Manage the TVTK scenes. """ # Enthought library imports. from tvtk.pyface.tvtk_scene
import TVTKScene from
pyface.workbench.api import WorkbenchWindow from traits.api import HasTraits, List, Instance, Property from traits.api import implements, on_trait_change from tvtk.plugins.scene.scene_editor import SceneEditor # Local imports. from i_scene_manager import ISceneManager class SceneManager(HasTraits): """ Manage the TVTK scenes. """ implements(ISceneManager) #### 'SceneManager' interface ############################################# # The currently active scene (None, if no scene is active). current_scene = Property(Instance(TVTKScene)) # A list of all open scenes. scenes = List(TVTKScene) # The workbench window that the manager is in (there is one scene manager # per workbench window). window = Instance(WorkbenchWindow) #### Private interface #################################################### # Shadow trait for the 'current_scene' property. _current_scene = Instance(TVTKScene) ########################################################################### # 'SceneManager' interface. ########################################################################### #### Trait properties ##################################################### def _get_current_scene(self): """ Property getter. """ scene_count = len(self.scenes) if scene_count == 0: scene = None elif scene_count == 1: scene = self.scenes[0] else: scene = self._current_scene return scene def _set_current_scene(self, scene): """ Property setter. """ self._current_scene = scene return #### Trait change handlers ################################################ @on_trait_change('window:editor_opened') def _on_editor_opened(self, obj, trait_name, old, new): """ Dynamic trait change handler. """ if isinstance(new, SceneEditor): self.scenes.append(new.scene) return @on_trait_change('window:editor_closing') def _on_editor_closed(self, obj, trait_name, old, new): """ Dynamic trait change handler. """ if isinstance(new, SceneEditor): self.scenes.remove(new.scene) return @on_trait_change('window:active_editor') def _on_active_editor_changed(self, obj, trait_name, old, new): """ Dynamic trait change handler. """ if isinstance(new, SceneEditor): self.current_scene = new.scene else: self.current_scene = None return #### EOF ######################################################################
vbeffara/Simulations
tools/massage-box.py
Python
gpl-3.0
341
0.01173
#! /usr/bin/env python import sys
g = {} n = {} for line in sys.stdin: (n1, n2, p,
q, t, tg, x) = line.strip().split(' ') t = int(t) x = float(x) key = ' '.join((n1,n2,p,q)) if not key in n: n[key] = 0 g[key] = 0 n[key] += t g[key] += x*t for key in n: print key, n[key], g[key]/n[key]
jsexauer/networkx_viewer
networkx_viewer/viewer.py
Python
gpl-3.0
17,151
0.005073
try: # Python 3 import tkinter as tk import tkinter.messagebox as tkm import tkinter.simpledialog as tkd except ImportError: # Python 2 import Tkinter as tk import tkMessageBox as tkm import tkSimpleDialog as tkd import networkx as nx from networkx_viewer.graph_canvas import GraphCanvas from networkx_viewer.tokens import TkPassthroughEdgeToken, TkPassthroughNodeToken from networkx_viewer.autocomplete_entry import AutocompleteEntry class ViewerApp(tk.Tk): """Example simple GUI to plot a NetworkX Graph""" def __init__(self, graph, **kwargs): """Additional keyword arguments beyond graph are passed down to the GraphCanvas. See it's docs for details""" tk.Tk.__init__(self) self.geometry('1000x600') self.title('NetworkX Viewer') bottom_row = 10 self.columnconfigure(0, weight=1) self.rowconfigure(bottom_row, weight=1) self.canvas = GraphCanvas(graph, width=400, height=400, **kwargs) self.canvas.grid(row=0, column=0, rowspan=bottom_row+2, sticky='NESW') self.canvas.onNodeSelected = self.onNodeSelected self.canvas.onEdgeSelected = self.onEdgeSelected r = 0 # Current row tk.Label(self, text='Nodes:').grid(row=r, column=1, sticky='W') self.node_entry = AutocompleteEntry(self.canvas.dataG.nodes) self.node_entry.bind('<Return>',self.add_node, add='+') self.node_entry.bind('<Control-Return>', self.buildNewShortcut, add='+') self.node_entry.grid(row=r, column=2, columnspan=2, sticky='NESW', pady=2) tk.Button(self, text='+', command=self.add_node, width=2).grid( row=r, column=4,sticky=tk.NW,padx=2,pady=2) r += 1 nlsb = tk.Scrollbar(self, orient=tk.VERTICAL) self.node_list = tk.Listbox(self, yscrollcommand=nlsb.set, height=5) self.node_list.grid(row=r, column=1, columnspan=3, sticky='NESW') self.node_list.bind('<Delete>',lambda e: self.node_list.delete(tk.ANCHOR)) nlsb.config(command=self.node_list.yview) nlsb.grid(row=r, column=4, sticky='NWS') r += 1 tk.Label(self, text='Neighbors Levels:').grid(row=r, column=1, columnspan=2, sticky=tk.NW) self.level_entry = tk.Entry(self, width=4) self.level_entry.insert(0,'1') self.level_entry.grid(row=r, column=3, sticky=tk.NW, padx=5) r += 1 tk.Button(self, text='Build New', command=self.onBuildNew).grid( row=r, column=1) tk.Button(self, text='Add to Existing', command=self.onAddToExisting ).grid(row=r, column=2, columnspan=2) r += 1 line = tk.Canvas(self, height=15, width=200) line.create_line(0,13,250,13) line.create_line(0,15,250,15) line.grid(row=r, column=1, columnspan=4, sticky='NESW') r += 1 tk.Label(self, text='Filters:').grid(row=r, column=1, sticky=tk.W) self.filter_entry = tk.Entry(self) self.filter_entry.bind('<Return>',self.add_filter, add='+') self.filter_entry.grid(row=r, column=2, columnspan=2, sticky='NESW', pady=2) tk.Button(self, text='+', command=self.add_filter, width=2).grid( row=r, column=4,sticky=tk.NW,padx=2,pady=2) r += 1 flsb = tk.Scrollbar(self, orient=tk.VERTICAL) self.filter_list = tk.Listbox(self, yscrollcommand=flsb.set, height=5) self.filter_list.grid(row=r, column=1, columnspan=3, sticky='NESW')
self.filter_list.bind('<Delete>',self.remove_filter) flsb.config(command=self.node_list.yview) flsb.grid(row=r, column=4, sticky='NWS') r += 1 tk.Button(self, text='Clear',command=self.remove_filter).grid( row=r, column=1, sticky='W') tk.Button(self, text='?', command=self.filter_help ).grid(row=r, column=4, stick='NESW', padx=2)
r += 1 line2 = tk.Canvas(self, height=15, width=200) line2.create_line(0,13,250,13) line2.create_line(0,15,250,15) line2.grid(row=r, column=1, columnspan=4, sticky='NESW') r += 1 self.lbl_attr = tk.Label(self, text='Attributes', wraplength=200, anchor=tk.SW, justify=tk.LEFT) self.lbl_attr.grid(row=r, column=1, columnspan=4, sticky='NW') r += 1 self.tbl_attr = PropertyTable(self, {}) self.tbl_attr.grid(row=r, column=1, columnspan=4, sticky='NESW') assert r == bottom_row, "Set bottom_row to %d" % r self._build_menu() def _build_menu(self): self.menubar = tk.Menu(self) self.config(menu=self.menubar) view = tk.Menu(self.menubar, tearoff=0) view.add_command(label='Undo', command=self.canvas.undo, accelerator="Ctrl+Z") self.bind_all("<Control-z>", lambda e: self.canvas.undo()) # Implement accelerator view.add_command(label='Redo', command=self.canvas.redo) view.add_separator() view.add_command(label='Center on node...', command=self.center_on_node) view.add_separator() view.add_command(label='Reset Node Marks', command=self.reset_node_markings) view.add_command(label='Reset Edge Marks', command=self.reset_edge_markings) view.add_command(label='Redraw Plot', command=self.canvas.replot) view.add_separator() view.add_command(label='Grow display one level...', command=self.grow_all) self.menubar.add_cascade(label='View', menu=view) def center_on_node(self): node = NodeDialog(self, "Name of node to center on:").result if node is None: return self.canvas.center_on_node(node) def reset_edge_markings(self): for u,v,k,d in self.canvas.dispG.edges(data=True, keys=True): token = d['token'] if token.is_marked: self.canvas.mark_edge(u,v,k) def reset_node_markings(self): for u,d in self.canvas.dispG.nodes(data=True): token = d['token'] if token.is_marked: self.canvas.mark_node(u) def add_node(self, event=None): node = self.node_entry.get() if node.isdigit() and self.canvas.dataG.has_node(int(node)): node = int(node) if self.canvas.dataG.has_node(node): self.node_list.insert(tk.END, node) self.node_entry.delete(0, tk.END) else: tkm.showerror("Node not found", "Node '%s' not in graph."%node) def add_filter(self, event=None, filter_lambda=None): if filter_lambda is None: filter_lambda = self.filter_entry.get() if self.canvas.add_filter(filter_lambda): # We successfully added the filter; add to list and clear entry self.filter_list.insert(tk.END, filter_lambda) self.filter_entry.delete(0, tk.END) def filter_help(self, event=None): msg = ("Enter a lambda function which returns True if you wish\n" "to show nodes with ONLY a given property.\n" "Parameters are:\n" " - u, the node's name, and \n" " - d, the data dictionary.\n\n" "Example: \n" " d.get('color',None)=='red'\n" "would show only red nodes.\n" "Example 2:\n" " str(u).is_digit()\n" "would show only nodes which have a numerical name.\n\n" "Multiple filters are ANDed together.") tkm.showinfo("Filter Condition", msg) def remove_filter(self, event=None): all_items = self.filter_list.get(0, tk.END) if event is None: # When no event passed, this function was called via the "clear" # button. items = all_items else: # Remove currently selected item items = (self.filter_list.get(tk.ANCHOR),) for item in items: self.canvas.remove_filter(item) idx = all_items.index(item) self.filter_list.delete(idx) all_items = self.fi
open-mmlab/mmdetection
mmdet/datasets/coco_panoptic.py
Python
apache-2.0
24,271
0
# Copyright (c) OpenMMLab. All rights reserved. import itertools import os from collections import defaultdict import mmcv import numpy as np from mmcv.utils import print_log from terminaltables import AsciiTable from mmdet.core import INSTANCE_OFFSET from .api_wrappers import COCO, pq_compute_multi_core from .builder import DATASETS from .coco i
mport CocoDataset try: import panopticapi from panopticapi.evaluation import VOID from panopticapi.utils import id2rgb except ImportError: panopticapi = None id2rgb = None VOID = None __all__ =
['CocoPanopticDataset'] class COCOPanoptic(COCO): """This wrapper is for loading the panoptic style annotation file. The format is shown in the CocoPanopticDataset class. Args: annotation_file (str): Path of annotation file. """ def __init__(self, annotation_file=None): if panopticapi is None: raise RuntimeError( 'panopticapi is not installed, please install it by: ' 'pip install git+https://github.com/cocodataset/' 'panopticapi.git.') super(COCOPanoptic, self).__init__(annotation_file) def createIndex(self): # create index print('creating index...') # anns stores 'segment_id -> annotation' anns, cats, imgs = {}, {}, {} img_to_anns, cat_to_imgs = defaultdict(list), defaultdict(list) if 'annotations' in self.dataset: for ann, img_info in zip(self.dataset['annotations'], self.dataset['images']): img_info['segm_file'] = ann['file_name'] for seg_ann in ann['segments_info']: # to match with instance.json seg_ann['image_id'] = ann['image_id'] seg_ann['height'] = img_info['height'] seg_ann['width'] = img_info['width'] img_to_anns[ann['image_id']].append(seg_ann) # segment_id is not unique in coco dataset orz... if seg_ann['id'] in anns.keys(): anns[seg_ann['id']].append(seg_ann) else: anns[seg_ann['id']] = [seg_ann] if 'images' in self.dataset: for img in self.dataset['images']: imgs[img['id']] = img if 'categories' in self.dataset: for cat in self.dataset['categories']: cats[cat['id']] = cat if 'annotations' in self.dataset and 'categories' in self.dataset: for ann in self.dataset['annotations']: for seg_ann in ann['segments_info']: cat_to_imgs[seg_ann['category_id']].append(ann['image_id']) print('index created!') self.anns = anns self.imgToAnns = img_to_anns self.catToImgs = cat_to_imgs self.imgs = imgs self.cats = cats def load_anns(self, ids=[]): """Load anns with the specified ids. self.anns is a list of annotation lists instead of a list of annotations. Args: ids (int array): integer ids specifying anns Returns: anns (object array): loaded ann objects """ anns = [] if hasattr(ids, '__iter__') and hasattr(ids, '__len__'): # self.anns is a list of annotation lists instead of # a list of annotations for id in ids: anns += self.anns[id] return anns elif type(ids) == int: return self.anns[ids] @DATASETS.register_module() class CocoPanopticDataset(CocoDataset): """Coco dataset for Panoptic segmentation. The annotation format is shown as follows. The `ann` field is optional for testing. .. code-block:: none [ { 'filename': f'{image_id:012}.png', 'image_id':9 'segments_info': { [ { 'id': 8345037, (segment_id in panoptic png, convert from rgb) 'category_id': 51, 'iscrowd': 0, 'bbox': (x1, y1, w, h), 'area': 24315, 'segmentation': list,(coded mask) }, ... } } }, ... ] """ CLASSES = [ 'person', 'bicycle', 'car', 'motorcycle', 'airplane', 'bus', 'train', ' truck', 'boat', 'traffic light', 'fire hydrant', 'stop sign', 'parking meter', 'bench', 'bird', 'cat', 'dog', 'horse', 'sheep', 'cow', 'elephant', 'bear', 'zebra', 'giraffe', 'backpack', 'umbrella', 'handbag', 'tie', 'suitcase', 'frisbee', 'skis', 'snowboard', 'sports ball', 'kite', 'baseball bat', 'baseball glove', 'skateboard', 'surfboard', 'tennis racket', 'bottle', 'wine glass', 'cup', 'fork', 'knife', 'spoon', 'bowl', 'banana', 'apple', 'sandwich', 'orange', 'broccoli', 'carrot', 'hot dog', 'pizza', 'donut', 'cake', 'chair', 'couch', 'potted plant', 'bed', 'dining table', 'toilet', 'tv', 'laptop', 'mouse', 'remote', 'keyboard', 'cell phone', 'microwave', 'oven', 'toaster', 'sink', 'refrigerator', 'book', 'clock', 'vase', 'scissors', 'teddy bear', 'hair drier', 'toothbrush', 'banner', 'blanket', 'bridge', 'cardboard', 'counter', 'curtain', 'door-stuff', 'floor-wood', 'flower', 'fruit', 'gravel', 'house', 'light', 'mirror-stuff', 'net', 'pillow', 'platform', 'playingfield', 'railroad', 'river', 'road', 'roof', 'sand', 'sea', 'shelf', 'snow', 'stairs', 'tent', 'towel', 'wall-brick', 'wall-stone', 'wall-tile', 'wall-wood', 'water-other', 'window-blind', 'window-other', 'tree-merged', 'fence-merged', 'ceiling-merged', 'sky-other-merged', 'cabinet-merged', 'table-merged', 'floor-other-merged', 'pavement-merged', 'mountain-merged', 'grass-merged', 'dirt-merged', 'paper-merged', 'food-other-merged', 'building-other-merged', 'rock-merged', 'wall-other-merged', 'rug-merged' ] THING_CLASSES = [ 'person', 'bicycle', 'car', 'motorcycle', 'airplane', 'bus', 'train', 'truck', 'boat', 'traffic light', 'fire hydrant', 'stop sign', 'parking meter', 'bench', 'bird', 'cat', 'dog', 'horse', 'sheep', 'cow', 'elephant', 'bear', 'zebra', 'giraffe', 'backpack', 'umbrella', 'handbag', 'tie', 'suitcase', 'frisbee', 'skis', 'snowboard', 'sports ball', 'kite', 'baseball bat', 'baseball glove', 'skateboard', 'surfboard', 'tennis racket', 'bottle', 'wine glass', 'cup', 'fork', 'knife', 'spoon', 'bowl', 'banana', 'apple', 'sandwich', 'orange', 'broccoli', 'carrot', 'hot dog', 'pizza', 'donut', 'cake', 'chair', 'couch', 'potted plant', 'bed', 'dining table', 'toilet', 'tv', 'laptop', 'mouse', 'remote', 'keyboard', 'cell phone', 'microwave', 'oven', 'toaster', 'sink', 'refrigerator', 'book', 'clock', 'vase', 'scissors', 'teddy bear', 'hair drier', 'toothbrush' ] STUFF_CLASSES = [ 'banner', 'blanket', 'bridge', 'cardboard', 'counter', 'curtain', 'door-stuff', 'floor-wood', 'flower', 'fruit', 'gravel', 'house', 'light', 'mirror-stuff', 'net', 'pillow', 'platform', 'playingfield', 'railroad', 'river', 'road', 'roof', 'sand', 'sea', 'shelf', 'snow', 'stairs', 'tent', 'towel', 'wall-brick', 'wall-stone', 'wall-tile', 'wall-wood', 'water-other', 'window-blind', 'window-other', 'tree-merged', 'fence-merged', 'ceiling-merged', 'sky-other-merged', 'cabinet-merged', 'table-merged', 'floor-other-merged', 'pavement-merged', 'mountain-merged', 'grass-merged', 'dirt-merged', 'paper-merged', 'food-other-merged', 'building-other-merged', 'rock-merged', 'wall-other-merged', 'rug-merged' ] PALETTE = [(220, 20, 60
windskyer/k_nova
paxes_nova/compute/notify_messages.py
Python
apache-2.0
4,325
0
# vim: tabstop=4 shiftwidth=4 softtabstop=4 # ================================================================= # ================================================================= # NOTE: notify message MUST follow these rules: # # - Messages must be wrappered with _() for translation # # - Replacement variables must be wrappered with brackets # # - Replacement variables must be from the following list:' # {instance_id} # {instance_name} # {host_name} # {source_host_name} # {target_host_name} # {error} from paxes_nova import _ PAUSE_SUCCESS = (_("Pause of virtual machine {instance_name} on host " "{host_name} was successful.")) PAUSE_ERROR = (_("Pause of virtual machine {instance_name} on host " "{host_name} failed with exception: {error}")) SUSPEND_SUCCESS = (_("Suspend of virtual machine {instance_name} on host " "{host_name} was successful.")) SUSPEND_ERROR = (_("Suspend of virtual machine {instance_name} on host " "{host_name} failed with exception: {error}")) RESUME_SUCCESS = (_("Resume of virtual machine {instance_name} on host " "{host_name} was successful.")) RESUME_ERROR = (_("Resume of virtual machine {instance_name} on host " "{host_name} failed with exception: {error}")) DEPLOY_SUCCESS = (_("Deploy of virtual machine {instanc
e_name} on host " "{host_name} was successful.")) DEPLOY_ERROR = (_("Deploy of virtual machine {instance_name} on host " "{host_name} failed with exception: {error}")) START_SUCCESS = (_("Start of virtual machine {instance_name} on host " "{host_name} was successful.")) START_ERROR = (_("Start of virtual machine {instance_name} on host " "{host_name
} failed with exception: {error}")) STOP_SUCCESS = (_("Stop of virtual machine {instance_name} on host " "{host_name} was successful.")) STOP_ERROR = (_("Stop of virtual machine {instance_name} on host " "{host_name} failed with exception: {error}")) RESTART_SUCCESS = (_("Restart of virtual machine {instance_name} on host " "{host_name} was successful.")) RESTART_ERROR = (_("Restart of virtual machine {instance_name} on host " "{host_name} failed with exception: {error}")) LPM_SUCCESS = (_("Migration of virtual machine {instance_name} from host " "{source_host_name} to host {target_host_name} was " "successful.")) LPM_ERROR = (_("Migration of virtual machine {instance_name} to host " "{target_host_name} failed with exception: {error}")) LPM_ERROR_DEST = (_("Migration of virtual machine {instance_name} to host " "{host_name} failed with exception: {error}")) DELETE_ERROR = (_("Delete of virtual machine {instance_name} on host " "{host_name} failed with exception: {error}")) DELETE_SUCCESS = (_("Delete of virtual machine {instance_name} on host " "{host_name} was successful. ")) RESIZE_ERROR = (_("Resize of virtual machine {instance_name} on host " "{host_name} failed with exception: {error}")) RESIZE_SUCCESS = (_("Resize of virtual machine {instance_name} on host " "{host_name} was successful.")) CAPTURE_SUCCESS = (_("Capture of virtual machine {instance_name} on host " "{host_name} was successful")) CAPTURE_ERROR = (_("Capture of virtual machine {instance_name} on host " "{host_name} failed with exception: {error}")) ATTACH_SUCCESS = (_("Volume {volume_id} was successfully attached to " "virtual machine {instance_name}.")) ATTACH_ERROR = (_("Volume {volume_id} could not be attached to " "virtual machine {instance_name}. Error message: {error}")) DETACH_SUCCESS = (_("Volume {volume_id} was successfully detached from " "virtual machine {instance_name}.")) DETACH_ERROR = (_("Volume {volume_id} could not be detached from " "virtual machine {instance_name}. Error message: {error}"))
codeaudit/ampcrowd
ampcrowd/crowd_server/wsgi.py
Python
apache-2.0
399
0.002506
""" WSGI config for crowd_server pr
oject. It exposes the WSGI callable as a module-level variable named ``application``. For more information on this file, see https://docs.djangoproject.com/en/1.6/howto/deployment/wsgi/ """ import os os.environ.setdefault("DJANGO_SETTINGS_MODULE", "crowd_server.settings") from django.core.
wsgi import get_wsgi_application application = get_wsgi_application()
Alfredx/django-db2charts
db2charts/router.py
Python
mit
619
0.003231
# -*- coding: utf-8 -*- # author: Alfred import os import re DB_MODULE_PATTERN = re.compile(r'db2charts_models\.(?P<module>.*)_models') class DB2ChartsRouter(object): def db_for_module(self, module): mat
ch = DB_MODULE_PATTERN.match(module) if match: return match.groupdict()['module'] return None def db_for_read(self, model, **hints): return self.d
b_for_module(model.__module__) def db_for_write(self, model, **hints): return self.db_for_module(model.__module__) def allow_migrate(self, db, app_label, model=None, **hints): return False
SickGear/SickGear
lib/apprise/plugins/NotifyD7Networks.py
Python
gpl-3.0
16,906
0
# -*- coding: utf-8 -*- # # Copyright (C) 2019 Chris Caron <[email protected]> # All rights reserved. # # This code is licensed under the MIT License. # # Permission is hereby granted, free of charge, to any person obtaining a copy # of this software and associated documentation files(the "Software"), to deal # in the Software without restriction, including without limitation the rights # to use, copy, modify, merge, publish, distribute, sublicense, and / or sell # copies of the Software, and to permit persons to whom the Software is # furnished to do so, subject to the following conditions : # # The above copyright notice and this permission notice shall be included in # all copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.IN NO EVENT SHALL THE # AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN # THE SOFTWARE. # To use this service you will need a D7 Networks account from their website # at https://d7networks.com/ # # After you've established your account you can get your api login credentials # (both user and password) from the API Details section from within your # account profile area: https://d7networks.com/accounts/profile/ import re import six import requests import base64 from json import dumps from json import loads from .NotifyBase import NotifyBase from ..URLBase import PrivacyMode from ..common import NotifyType from ..utils import parse_list from ..utils import parse_bool from ..AppriseLocale import gettext_lazy as _ # Extend HTTP Error Messages D7NETWORKS_HTTP_ERROR_MAP = { 401: 'Invalid Argument(s) Specified.', 403: 'Unauthorized - Authentication Failure.', 412: 'A Routing Error Occured', 500: 'A Serverside Error Occured Handling the Request.', } # Some Phone Number Detection IS_PHONE_NO = re.compile(r'^\+?(?P<phone>[0-9\s)(+-]+)\s*$') # Priorities class D7SMSPriority(object): """ D7 Networks SMS Message Priority """ LOW = 0 MODERATE = 1 NORMAL = 2 HIGH = 3 D7NETWORK_SMS_PRIORITIES = ( D7SMSPriority.LOW, D7SMSPriority.MODERATE, D7SMSPriority.NORMAL, D7SMSPriority.HIGH, ) class NotifyD7Networks(NotifyBase): """ A wrapper for D7 Networks Notifications """ # The default descriptive name associated with the Notification service_name = 'D7 Networks' # The services URL service_url = 'https://d7networks.com/' # All notification requests are secure secure_protocol = 'd7sms' # Allow 300 requests per minute. # 60/300 = 0.2 request_rate_per_sec = 0.20 # A URL that takes you to the setup/help of the specific protocol setup_url = 'https://github.com/caronc/apprise/wiki/Notify_d7networks' # D7 Networks batch notification URL notify_batch_url = 'http://rest-api.d7networks.com/secure/sendbatch' # D7 Networks single notification URL notify_url = 'http://rest-api.d7networks.com/secure/send' # The maximum length of the body body_maxlen = 160 # A title can not be used for SMS Messages. Setting this to zero will # cause any title (if defined) to get placed into the message body. title_maxlen = 0 # Define object templates templates = ( '{schema}://{user}:{password}@{targets}', ) # Define our template tokens t
emplate_tokens = dict(NotifyBase.template_tokens, **{ 'user': { 'name': _('Username'), 'type': 'string', 'required': True, }, 'password': { 'name': _('Password'),
'type': 'string', 'private': True, 'required': True, }, 'target_phone': { 'name': _('Target Phone No'), 'type': 'string', 'prefix': '+', 'regex': (r'^[0-9\s)(+-]+$', 'i'), 'map_to': 'targets', }, 'targets': { 'name': _('Targets'), 'type': 'list:string', }, }) # Define our template arguments template_args = dict(NotifyBase.template_args, **{ 'priority': { 'name': _('Priority'), 'type': 'choice:int', 'min': D7SMSPriority.LOW, 'max': D7SMSPriority.HIGH, 'values': D7NETWORK_SMS_PRIORITIES, # The website identifies that the default priority is low; so # this plugin will honor that same default 'default': D7SMSPriority.LOW, }, 'batch': { 'name': _('Batch Mode'), 'type': 'bool', 'default': False, }, 'to': { 'alias_of': 'targets', }, 'source': { # Originating address,In cases where the rewriting of the sender's # address is supported or permitted by the SMS-C. This is used to # transmit the message, this number is transmitted as the # originating address and is completely optional. 'name': _('Originating Address'), 'type': 'string', 'map_to': 'source', }, 'from': { 'alias_of': 'source', }, }) def __init__(self, targets=None, priority=None, source=None, batch=False, **kwargs): """ Initialize D7 Networks Object """ super(NotifyD7Networks, self).__init__(**kwargs) # The Priority of the message if priority not in D7NETWORK_SMS_PRIORITIES: self.priority = self.template_args['priority']['default'] else: self.priority = priority # Prepare Batch Mode Flag self.batch = batch # Setup our source address (if defined) self.source = None \ if not isinstance(source, six.string_types) else source.strip() # Parse our targets self.targets = list() for target in parse_list(targets): # Validate targets and drop bad ones: result = IS_PHONE_NO.match(target) if result: # Further check our phone # for it's digit count # if it's less than 10, then we can assume it's # a poorly specified phone no and spit a warning result = ''.join(re.findall(r'\d+', result.group('phone'))) if len(result) < 11 or len(result) > 14: self.logger.warning( 'Dropped invalid phone # ' '({}) specified.'.format(target), ) continue # store valid phone number self.targets.append(result) continue self.logger.warning( 'Dropped invalid phone # ({}) specified.'.format(target)) if len(self.targets) == 0: msg = 'There are no valid targets identified to notify.' self.logger.warning(msg) raise TypeError(msg) return def send(self, body, title='', notify_type=NotifyType.INFO, **kwargs): """ Depending on whether we are set to batch mode or single mode this redirects to the appropriate handling """ # error tracking (used for function return) has_error = False auth = '{user}:{password}'.format( user=self.user, password=self.password) if six.PY3: # Python 3's versio of b64encode() expects a byte array and not # a string. To accomodate this, we encode the content here auth = auth.encode('utf-8') # Prepare our headers headers = { 'User-Agent': self.app_id, 'Accept': 'application/json', 'Authorization': 'Basic {}'.format(base64.b64encode(auth)) } # Our URL varies depending if we're doing a batch m
schreiberx/sweet
mule/platforms/50_cheyenne_intel/JobPlatform.py
Python
mit
8,312
0.006136
import platform import socket import sys import os from mule_local.JobGeneration import * from mule.JobPlatformResources import * from . import JobPlatformAutodetect def _whoami(depth=1): """ String of function name to recycle code https://www.oreilly.com/library/view/python-cookbook/0596001673/ch14s08.html Returns ------- string Return function name """ return sys._getframe(depth).f_code.co_name def p_gen_script_info(jg : JobGeneration): return """# # Generating function: """+_whoami(2)+""" # Platform: """+get_platform_id()+""" # Job id: """+jg.getUniqueID()+""" # """ def get_platform_autodetect(): """ Returns ------- bool True if current platform matches, otherwise False """ return JobPlatformAutodetect.autodetect() def get_platform_id(): """ Return platform ID Returns ------- string unique ID of platform """ return "cheyenne_intel" def get_platform_resources(): """ Return information about hardware """ r = JobPlatformResources() r.num_cores_per_node = 36 # Physical number of nodes, maybe the limit is different r.num_nodes = 4032 r.num_cores_per_socket = 18 # 12h limit r.max_wallclock_seconds = 60*60*12 return r def jobscript_setup(jg : JobGeneration): """ Setup data to generate job script """ return def jobscript_get_header(jg : JobGeneration): """ These headers typically contain the information on e.g. Job exection, number of compute nodes, etc. Returns ------- string multiline text for scripts """ job_id = jg.getUniqueID() p = jg.parallelization time_str = p.get_max_wallclock_seconds_hh_mm_ss() # Available queues: # premium (only use this in extreme cases) # regular # economy queue = 'economy' # Use regular queue if we need more than 32 nodes # Otherwise, the job doesn't seem to be scheduled if p.num_nodes >= 32: queue = 'premium' elif p.num_nodes >= 16: queue = 'regular' # # See https://www.lrz.de/services/compute/linux-cluster/batch_parallel/example_jobs/ # content = """#! /bin/bash # ## project code #PBS -A NCIS0002 #PBS -q """+queue+""" ## wall-clock time (hrs:mins:secs) #PBS -l walltime="""+time_str+""" ## select: number of nodes ## ncpus: number of CPUs per node ## mpiprocs: number of ranks per node #PBS -l select="""+str(p.num_nodes)+""":ncpus="""+str(p.num_cores_per_node)+""":mpiprocs="""+str(p.num_ranks_per_node)+""":ompthreads="""+str(p.num_threads_per_rank)+"\n" #"default": 2301000 #"turbo": 2301000 #"rated": 2300000 #"slow": 1200000 if p.force_turbo_off: content += "#PBS -l select=cpufreq=2300000\n" content += """# #PBS -N """+job_id[0:100]+""" #PBS -o """+jg.p_job_stdout_filepath+""" #PBS -e """+jg.p_job_stderr_filepath+""" #source /etc/profile.d/modules.sh #module load openmpi """+("module load mkl" if jg.compile.mkl==True or jg.compile.mkl=='enable' else "")+""" """+p_gen_script_info(jg)+""" echo echo "hostname" hostname echo echo echo "lscpu -e" lscpu -e echo echo echo "CPU Frequencies (uniquely reduced):" cat /sys/devices/system/cpu/cpu*/cpufreq/scaling_cur_freq | sort -u echo """ if jg.compile.threading != 'off': content += """ export OMP_NUM_THREADS="""+str(p.num_threads_per_rank)+""" """ # if jg.compile.sweet_mpi != 'enable': if True: # # https://software.intel.com/en-us/node/522691 if p.core_oversubscription: if p.core_affinity != None: if p.core_affinity == 'compact': content += "export KMP_AFFINITY=granularity=fine,compact\n" elif p.core_affinity == 'scatter': content += "export KMP_AFFINITY=granularity=fine,scatter\n" else: Exception("Affinity '"+str(p.core_affinity)+"' not supported") else: #raise Exception("Please specify core_affinity!") content += "# No core affinity selected\n" else: if p.core_affinity != None: content += "\necho \"Affnity: "+str(p.core_affinity)+"\"\n" if p.core_affinity == 'compact': content += "export KMP_AFFINITY=granularity=fine,compact,1,0\n" elif p.core_affinity == 'scatter': content += "export KMP_AFFINITY=granularity=fine,scatter\n" else: raise Exception("Affinity '"+str(
p.core_affinity)+"' not supported") else: #raise Exception("Please specify core_affinity!") content += "# No core affinity selected\n" if p.core_affinity != None: content += "export KMP_AFFINITY=\"verbose,$KMP_AFFINITY\"\n" return content def jobscript_get_exec_prefix(jg : JobGeneration): """ Prefix before executable Returns ------- st
ring multiline text for scripts """ content = "" content += jg.runtime.get_jobscript_plan_exec_prefix(jg.compile, jg.runtime) content += """ EXEC=\""""+jg.compile.getProgramPath()+"""\" PARAMS=\""""+jg.runtime.getRuntimeOptions()+"""\" """ return content def jobscript_get_exec_command(jg : JobGeneration): """ Prefix to executable command Returns ------- string multiline text for scripts """ p = jg.parallelization mpiexec = "" # # Only use MPI exec if we are allowed to do so # We shouldn't use mpiexec for validation scripts # if not p.mpiexec_disabled: # Use mpiexec_mpt for Intel MPI #mpiexec = "mpiexec_mpt -n "+str(p.num_ranks) # Use mpiexec for GNU if jg.compile.sweet_mpi == 'enable': mpiexec = "mpiexec_mpt -n "+str(p.num_ranks) mpiexec += " omplace " mpiexec += " -nt "+str(p.num_threads_per_rank)+" " mpiexec += " -tm intel" mpiexec += " -vv" if mpiexec[-1] != ' ': mpiexec += ' ' # # Fix the mess on Cheyenne! # # We prefix the current LD_LIBRARY_PATH with the one from the shell where the job was submitted # This is required since Cheyenne scripts mess around with the existing path in a way # which results in e.g. the system-wide installed fftw to be loaded. # # What we basically accomplish here is to suggest to really first # lookup the MULE local_software/local/lib directory, then the system libraries # sweet_ld_library_path = os.getenv('MULE_LD_LIBRARY_PATH') if sweet_ld_library_path == None: raise Exception("Environment variable MULE_LD_LIBRARY_PATH not found!") content = """ # Make sure that MULE library path is really known export LD_LIBRARY_PATH=\""""+sweet_ld_library_path+""":$LD_LIBRARY_PATH\" echo echo "LD_LIBRARY_PATH" echo "${LD_LIBRARY_PATH}" echo echo echo "ldd" ldd $EXEC echo E=\""""+mpiexec+"""${EXEC} ${PARAMS}\" echo echo "Executing..." echo "$E" $E || exit 1 """ return content def jobscript_get_exec_suffix(jg : JobGeneration): """ Suffix before executable Returns ------- string multiline text for scripts """ content = """ echo echo "CPU Frequencies (uniquely reduced):" cat /sys/devices/system/cpu/cpu*/cpufreq/scaling_cur_freq | sort -u echo """ content += jg.runtime.get_jobscript_plan_exec_suffix(jg.compile, jg.runtime) return content def jobscript_get_footer(jg : JobGeneration): """ Footer at very end of job script Returns ------- string multiline text for scripts """ content = "" return content def jobscript_get_compile_command(jg : JobGeneration): """ Compile command(s) This is separated here to put it either * into the job script (handy for workstations) or * into a separate compile file (handy for clusters) Returns ------- string multiline text with compile command to generate executable """
sandervenema/netzpolitik
petitions/urls.py
Python
gpl-2.0
251
0
from django.conf.urls import url from . import view
s urlpatterns = [ url(r'^(?P<lang>[a-z]{2})?$', views.index, name='index'), url(r'^sign/$', views.sign, name='sign'), url(r'^co
nfirm/([0-9a-z]{64})/$', views.confirm, name='confirm'), ]
tkaitchuck/nupic
examples/opf/experiments/spatial_classification/base/description.py
Python
gpl-3.0
14,847
0.002694
# ---------------------------------------------------------------------- # Numenta Platform for Intelligent Computing (NuPIC) # Copyright (C) 2013, Numenta, Inc. Unless you have purchased from # Numenta, Inc. a separate commercial license for this software code, the # following terms and conditions apply: # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License version 3 as # published by the Free Software Foundation. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. # See the GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see http://www.gnu.org/licenses. # # http://numenta.org/licenses/ # ---------------------------------------------------------------------- """ Template file used by the OPF Experiment Generator to generate the actual description.py file by replacing $XXXXXXXX tokens with desired values. """ from nupic.frameworks.opf.expdescriptionapi import ExperimentDescriptionAPI from nupic.frameworks.opf.expdescriptionhelpers import ( updateConfigFromSubConfig, applyValueGettersToContainer, DeferredDictLookup) from nupic.frameworks.opf.clamodelcallbacks import * from nupic.frameworks.opf.metrics import MetricSpec from nupic.frameworks.opf.opfutils import (InferenceType, InferenceElement) from nupic.support import aggregationDivide from nupic.frameworks.opf.opftaskdriver import ( IterationPhaseSpecLearnOnly, IterationPhaseSpecInferOnly, IterationPhaseSpecLearnAndInfer) # Model Configuration Dictionary: # # Define the model parameters and adjust for any modifications if imported # from a sub-experiment. # # These fields might be modified by a sub-experiment; this dict is passed # between the sub-experiment and base experiment # # # NOTE: Use of DEFERRED VALUE-GETTERs: dictionary fields and list elements # within the config dictionary may be assigned futures derived from the # ValueGetterBase class, such as DeferredDictLookup. # This facility is particularly handy for enabling substitution of values in # the config dictionary from other values in the config dictionary, which is # needed by permutation.py-based experiments. These values will be resolved # during the call to applyValueGettersToContainer(), # which we call after the base experiment's config dictionary is updated from # the sub-experiment. See ValueGetterBase and # DeferredDictLookup for more details about value-getters. # # For each custom encoder parameter to be exposed to the sub-experiment/ # permutation overrides, define a variable in this section, using key names # beginning with a single underscore character to avoid collisions with # pre-defined keys (e.g., _dsEncoderFieldName2_N). # # Example: # config = dict( # _dsEncoderFieldName2_N = 70, # _dsEncoderFieldName2_W = 5, # dsEncoderSchema = [ # base=dict( # fieldname='Name2', type='ScalarEncoder', # name='Name2', minval=0, maxval=270, clipInput=True, # n=DeferredDictLookup('_dsEncoderFieldName2_N'), # w=DeferredDictLookup('_dsEncoderFieldName2_W')), # ], # ) # updateConfigFromSubConfig(config) # applyValueGettersToContainer(config) config = { # Type of model that the rest of these parameters apply to. 'model': "CLA", # Version that specifies the format of the config. 'version': 1, # Intermediate variables used to compute fields in modelParams and also # referenced from the control section. 'aggregationInfo': { 'days': 0, 'fields': [], 'hours': 0, 'microseconds': 0, 'milliseconds': 0, 'minutes': 0, 'months': 0, 'seconds': 0, 'weeks': 0, 'years': 0}, 'predictAheadTime': None, # Model parameter dictionary. 'modelParams': { # The type of inference that this model will perform 'inferenceType': 'NontemporalClassification', 'sensorParams': { # Sensor diagnostic output verbosity control; # if > 0: sensor region will print out on screen what it's sensing # at each step 0: silent; >=1: some info; >=2: more info; # >=3: even more info (see compute() in py/regions/RecordSensor.py) 'verbosity' : 0, # Example: # dsEncoderSchema = [ # DeferredDictLookup('__field_name_encoder'), # ], # # (value generated from DS_ENCODER_SCHEMA) 'encoders': { u'field1': { 'fieldname': u'field1', 'n': 121, 'name': u'field1', 'type': 'SDRCategoryEncoder', 'w': 21}, u'classification': { 'classifierOnly': True, 'fieldname': u'classification', 'n': 121, 'name': u'classification', 'type': 'SDRCategoryEncoder', 'w': 21}, }, # A dictionary specifying the period for automatically-generated # resets from a RecordSensor; # # None = disable automatically-generated resets (also disabled if # all of the specified values evaluate to 0). # Valid keys is the desired combination of the following: # days, hours, minutes, seconds, milliseconds, microseconds, weeks # # Example for 1.5 days: sensorAutoReset = dict(days=1,hours=12), # # (value generated from SENSOR_AUTO_RESET) 'sensorAutoReset' : None, }, 'spEnable': False, 'spParams': { # SP diagnostic output verbosity control; # 0: silent; >=1: some info; >=2: more info; 'spVerbosity' : 0, 'globalInhibition': 1, # Number of cell columns in the cortical region (same number for # SP and TP) # (see also tpNCellsPerCol) 'columnCount': 2048, 'inputWidth': 0, # SP inhibition control (absolute value); # Maximum number of active columns in the SP region's output (when # there are more, the weaker ones are suppressed) 'numActivePerInhArea': 40, 'seed': 1956, # coincInputPoolPct # What percent of the columns's receptive field is available # for potential synapses. At initialization time, we will # choose coincInputPoolPct * (2*coincInputRadius+1)^2 'coincInputPoolPct': 0.5, # The default connected threshold. Any synapse whose # permanence value is above the connected threshold is # a "connected synapse", meaning it can contribute to the # cell's firing. Typical value is 0.10. Cells whose activity # level bef
ore inhibition falls below minDutyCycleBeforeInh # will have their own internal synPermConnectedCell # threshold set below this default value. # (This concept applies to both SP and TP and so 'cells' # is correct here as opposed to 'columns') 'synPermConnected': 0.1, 'synPermActiveInc': 0.1, 'synPermInactiveDec': 0.01, 'randomSP': 0, }, # Controls whether TP is enable
d or disabled; # TP is necessary for making temporal predictions, such as predicting # the next inputs. Without TP, the model is only capable of # reconstructing missing sensor inputs (via SP). 'tpEnable' : False, 'tpParams': { # TP diagnostic output ver
tensorflow/benchmarks
scripts/tf_cnn_benchmarks/variable_mgr_util.py
Python
apache-2.0
26,469
0.005743
# Copyright 2017 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """Utilities for VariableMgr.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function import collections as pycoll import operator import numpy as np import tensorflow.compat.v1 as tf # pylint: disable=g-direct-tensorflow-import from tensorflow.python.framework import ops from tensorflow.python.framework import tensor_shape from tensorflow.python.ops import array_ops from tensorflow.python.ops import data_flow_ops from tensorflow.python.ops import math_ops PS_SHADOW_VAR_PREFIX = 'ps_var' AutoLossScaleParams = pycoll.namedtuple( 'AutoLossScaleParams', [ # If true, enable automatic loss scaling. 'enable_auto_loss_scale', # The value to scale the loss before computing gradients. 'loss_scale', # Number of normal steps with the current `loss_scale`. 'loss_scale_normal_steps', # Increase loss scale every n steps. 'inc_loss_scale_every_n', # If true, the current worker is chief. The current implementation # relies on the chief to update loss_scale value, but in future, we # might change this to ask the parameter server to update loss_scales # for better performance. # TODO(tanmingxing): remove this if loss_scale is updated in ps. 'is_chief', ]) def get_loss_scale_update_op(loss_scale, loss_scale_normal_steps, inc_loss_scale_every_n): """Returns the update op for loss scaling variables. We maintain the counter `loss_scale_normal_steps` to count the number of steps we have been using the current `loss_scale`. In most cases, this function increments `loss_scale_normal_steps`. However, if `loss_scale_normal_steps` is greater than the threshold `inc_loss_scale_every_n`, we double `loss_scale` and reset `loss_scale_normal_steps` to zero. This op is only called if the gradients don't have any infs or nans. Instead, if infs or nans occur in the gradients, we immeditately halve `loss_scale` and reset `loss_scale_normal_steps` to zero. Args: loss_scale: a tf.Variable represneting the loss_scale value. loss_scale_normal_steps: a tf.Variable representing the number of training steps that have run since the loss_scale last changed. inc_loss_scale_every_n: a Python integer threshold. `loss_scale` is increased every `inc_loss_scale_every_n` steps, unless the gradients have infs or nans. Returns: An op for updating `loss_scale` and `loss_scale_normal_steps`. """ def increment_loss_scale_normal_steps_func(): return tf.group(loss_scale_normal_steps.assign_add(1)) def increase_loss_scale_func(): return tf.group( tf.assign(loss_scale_normal_steps, 0), tf.assign(loss_scale, loss_scale * 2)) # true_fn and false_fn must have the same type. return tf.cond(loss_scale_normal_steps < inc_loss_scale_every_n, increment_loss_scale_normal_steps_func, increase_loss_scale_func) def append_gradients_with_loss_scale(training_ops, get_apply_gradients_ops_func, loss_scale_params, grad_has_inf_nan): """Selectively appends gradients update ops with loss scaling. Args: training_ops: a list of training ops to be executed. get_apply_gradients_ops_func: a function that returns a list of ops for applying gradients. Here, we must pass a function instead of the actual list of ops; otherwise, those ops would be executed unconditionally due to the semantics of tf.cond. loss_scale_params: An AutoLossScaleParams tuple. grad_has_inf_nan: Boolean tensor indicating whether the gradients have infs or nans. """ is_chief = loss_scale_params.is_chief loss_scale = loss_scale_params.loss_scale loss_scale_normal_steps = loss_scale_params.loss_scale_normal_steps inc_loss_scale_every_n = loss_scale_params.inc_loss_scale_every_n enable_auto_loss_scale = loss_scale_params.enable_auto_loss_scale if loss_scale is None or not enable_auto_loss_scale or not is_chief: training_ops.extend(get_apply_gradients_ops_func()) else: # If nans/infs occurred, skip applying gradients and instead update # loss_scale (halve loss_scale and reset loss_scale_normal_steps to zero). def update_op_if_nan_or_inf(): """Update loss_scale and discard gradients if nans/infs occurred.""" return tf.group( tf.assign(loss_scale, loss_scale / 2.), tf.assign(loss_scale_normal_steps, 0)) # Otherwise, apply gradients, and update loss_scale and # loss_scal
e_normal_steps. def update_op_if_no_nan_or_inf(): """Apply gradients, and update loss scaling.""" return tf.group( get_loss_scale_update_op(loss_scale, loss_scale_normal_steps, inc_loss_scale_every_n), *get_apply_gradients_ops_func()) # T
ODO(tanmingxing): Add support for independent and distributed all_reduce. assert grad_has_inf_nan is not None update_op = tf.cond( grad_has_inf_nan, update_op_if_nan_or_inf, update_op_if_no_nan_or_inf, name='cond_if_grad_has_inf_nan' ) training_ops.append(update_op) # To be used with custom_getter on tf.get_variable. class OverrideCachingDevice(object): """Variable getter which caches variables on the least loaded device. Variables smaller than a certain threshold are cached on a single specific device, as specified in the constructor. All other variables are load balanced across a pool of devices, by caching each variable on the least loaded device. Note that variable creation only happen when building the model graph on the first device (see how it sets the 'reuse' parameter in VariableMgr.*.create_outer_variable_scope()). That means, for all other devices, the variable scope will reuse the variables created before, which requires that we set the caching_device correctly as otherwise it may not be able to find the previously created variable and will create a new one. This requires when building the model graph on different devices, variables with the same name should have same size. TODO(laigd): consider adding tests or verification logic to enforce this, or refactor it. """ def __init__(self, devices, device_for_small_variables, small_variable_size_threshold): self.devices = devices self.sizes = [0] * len(self.devices) self.device_for_small_variables = device_for_small_variables self.small_variable_size_threshold = small_variable_size_threshold def __call__(self, getter, *args, **kwargs): size = tf.TensorShape(kwargs['shape']).num_elements() if size < self.small_variable_size_threshold: device_name = self.device_for_small_variables else: device_index, _ = min(enumerate(self.sizes), key=operator.itemgetter(1)) device_name = self.devices[device_index] self.sizes[device_index] += size kwargs['caching_device'] = device_name var = getter(*args, **kwargs) return var # To be used with custom_getter on tf.get_variable. Ensures the created variable # is in LOCAL_VARIABLES and not GLOBAL_VARIBLES collection. class OverrideToLocalVariableIfNotPsVar(object): # args and kwargs come from the custom_getter interface for Tensorflow # variables, and matches tf.get_variable's signature, with the addition of # 'getter' at the beginning. de
att-comdev/deckhand
deckhand/context.py
Python
apache-2.0
1,765
0
# Copyright 2017 AT&T Intellectual Property. All other rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from oslo_config import cfg from oslo_context import context CONF = cfg.CONF class RequestContext(context.RequestContext): """User security context object Stores information about the security context under which the user accesses the system, as well as additional request information. """ def __init__(self, project=None, **kwargs): if project: kwargs['tenant'] = project
self.project = project super(RequestContext, self).__init__(**kwargs)
def to_dict(self): out_dict = super(RequestContext, self).to_dict() out_dict['roles'] = self.roles if out_dict.get('tenant'): out_dict['project'] = out_dict['tenant'] out_dict.pop('tenant') return out_dict @classmethod def from_dict(cls, values): return cls(**values) def get_context(): """A helper method to get a blank context (useful for tests).""" return RequestContext(user_id=None, project_id=None, roles=[], is_admin=False, overwrite=False)
UFRB/chdocente
cadastro/migrations/0001_initial.py
Python
agpl-3.0
11,352
0.007488
# -*- coding: utf-8 -*- import datetime from south.db import db from south.v2 import SchemaMigration from django.db import models class Migration(SchemaMigration): def forwards(self, orm): # Adding model 'Docente' db.create_table('cadastro_docente', ( ('id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('matricula', self.gf('django.db.models.fields.CharField')(max_length=7, unique=True)), ('nome', self.gf('django.db.models.fields.CharField')(max_length=100, unique=True)), )) db.send_create_signal('cadastro', ['Docente']) # Adding model 'Disciplina' db.create_table('cadastro_disciplina', ( ('id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('codigo', self.gf('django.db.models.fields.CharField')(max_length=7)), ('nivel', self.gf('django.db.models.fields.CharField')(max_length=11)), ('multicampia', self.gf('django.db.models.fields.BooleanField')(default=False)), ('tipo', self.gf('django.db.models.fields.CharField')(max_length=11)), ('cargahoraria', self.gf('django.db.models.fields.IntegerField')(max_length=3)), ('estudantes', self.gf('django.db.models.fields.IntegerField')(max_length=3)), )) db.send_create_signal('cadastro', ['Disciplina']) # Adding model 'Pesquisa' db.create_table('cadastro_pesquisa', ( ('id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('area', self.gf('django.db.models.fields.CharField')(max_length=20)), ('financiador', self.gf('django.db.models.fields.CharField')(max_length=20)), ('estudantes_graduacao', self.gf('django.db.models.fields.IntegerField')(max_length=2, blank=True)), ('estudantes_pos', self.gf('django.db.models.fields.IntegerField')(max_length=2, blank=True)), ('bolsistas_pibic', self.gf('django.db.models.fields.IntegerField')(max_length=2, blank=True)), ('bolsistas_ppq', self.gf('django.db.models.fields.IntegerField')(max_length=2, blank=True)), ('voluntarios', self.gf('django.db.models.fields.IntegerField')(max_length=2, blank=True)), ('parceria', self.gf('django.db.models.fields.CharField')(max_length=255, blank=True)), ('parceria_inter', self.gf('django.db.models.fields.CharField')(max_length=255, blank=True)), )) db.send_create_signal('cadastro', ['Pesquisa']) # Adding model 'Extensao' db.create_table('cadastro_extensao', ( ('id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('area', self.gf('django.db.models.fields.CharField')(max_length=20)), ('financiador', self.gf('django.db.models.fields.CharField')(max_length=20)), ('estudantes_graduacao', self.gf('django.db.models.fields.IntegerField')(max_length=2, blank=True)), ('estudantes_pos', self.gf('django.db.models.fields.IntegerField')(max_length=2, blank=True)), ('bolsistas_pibex', self.gf('django.db.models.fields.IntegerField')(max_length=2, blank=True)), ('bolsistas_ppq', self.gf('django.db.models.fields.IntegerField')(max_length=2, blank=True)), ('voluntarios', self.gf('django.db.models.fields.IntegerField')(max_length=2, blank=True)), ('parceria', self.gf('django.db.models.fields.CharField')(max_length=255, blank=True)), ('parceria_inter', self.gf('django.db.models.fields.CharField')(max_length=255, blank=True)), )) db.send_create_signal('cadastro', ['Extensao']) # Adding model 'Atividade' db.create_table('cadastro_atividade', ( ('id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('docente',
self.gf('django.db.models.fields.related.ForeignKey')(to=orm['cadastro.Docente'])), ('afastamento', self.gf('django.db.models.fields.BooleanField')(default=True)), ('cargo', self.gf('django.db.models.fields.CharField')(max_length=100, blank=True)), ('comissoes', self.gf('django.db.models.fields.IntegerField')()),
('semestre', self.gf('django.db.models.fields.CharField')(max_length=6)), )) db.send_create_signal('cadastro', ['Atividade']) # Adding M2M table for field disciplinas on 'Atividade' m2m_table_name = db.shorten_name('cadastro_atividade_disciplinas') db.create_table(m2m_table_name, ( ('id', models.AutoField(verbose_name='ID', primary_key=True, auto_created=True)), ('atividade', models.ForeignKey(orm['cadastro.atividade'], null=False)), ('disciplina', models.ForeignKey(orm['cadastro.disciplina'], null=False)) )) db.create_unique(m2m_table_name, ['atividade_id', 'disciplina_id']) # Adding M2M table for field pesquisa on 'Atividade' m2m_table_name = db.shorten_name('cadastro_atividade_pesquisa') db.create_table(m2m_table_name, ( ('id', models.AutoField(verbose_name='ID', primary_key=True, auto_created=True)), ('atividade', models.ForeignKey(orm['cadastro.atividade'], null=False)), ('pesquisa', models.ForeignKey(orm['cadastro.pesquisa'], null=False)) )) db.create_unique(m2m_table_name, ['atividade_id', 'pesquisa_id']) # Adding M2M table for field extensao on 'Atividade' m2m_table_name = db.shorten_name('cadastro_atividade_extensao') db.create_table(m2m_table_name, ( ('id', models.AutoField(verbose_name='ID', primary_key=True, auto_created=True)), ('atividade', models.ForeignKey(orm['cadastro.atividade'], null=False)), ('extensao', models.ForeignKey(orm['cadastro.extensao'], null=False)) )) db.create_unique(m2m_table_name, ['atividade_id', 'extensao_id']) def backwards(self, orm): # Deleting model 'Docente' db.delete_table('cadastro_docente') # Deleting model 'Disciplina' db.delete_table('cadastro_disciplina') # Deleting model 'Pesquisa' db.delete_table('cadastro_pesquisa') # Deleting model 'Extensao' db.delete_table('cadastro_extensao') # Deleting model 'Atividade' db.delete_table('cadastro_atividade') # Removing M2M table for field disciplinas on 'Atividade' db.delete_table(db.shorten_name('cadastro_atividade_disciplinas')) # Removing M2M table for field pesquisa on 'Atividade' db.delete_table(db.shorten_name('cadastro_atividade_pesquisa')) # Removing M2M table for field extensao on 'Atividade' db.delete_table(db.shorten_name('cadastro_atividade_extensao')) models = { 'cadastro.atividade': { 'Meta': {'object_name': 'Atividade'}, 'afastamento': ('django.db.models.fields.BooleanField', [], {'default': 'True'}), 'cargo': ('django.db.models.fields.CharField', [], {'max_length': '100', 'blank': 'True'}), 'comissoes': ('django.db.models.fields.IntegerField', [], {}), 'disciplinas': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['cadastro.Disciplina']", 'symmetrical': 'False'}), 'docente': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['cadastro.Docente']"}), 'extensao': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['cadastro.Extensao']", 'symmetrical': 'False'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'pesquisa': ('django.db.models.fields.related.ManyToManyField', [], {'to': "orm['cadastro.Pesquisa']", 'symmetrical': 'False'}), 'semestre': ('django.db.models.fields.CharField', [], {'max_length': '6'}) }, 'cadastro.disciplina': { 'Meta': {'object_name': 'Disciplina'}, 'cargahoraria': ('django.db.models.fields.IntegerField', [], {'max_length': '3'}), 'codigo': ('django.db.models.fields.CharField', [], {'max_length': '7'})
GoogleCloudPlatform/ml-on-gcp
example_zoo/tensorflow/models/ncf_main/official/recommendation/ncf_main.py
Python
apache-2.0
17,012
0.006348
# Copyright 2018 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """NCF framework to train and evaluate the NeuMF model. The NeuMF model assembles both MF and MLP models under the NCF framework. Check `neumf_model.py` for more details about the models. """ from __future__ import absolute_import from __future__ import division from __future__ import print_function import contextlib import heapq import json import logging import math import multiprocessing import os import signal import typing # pylint: disable=g-bad-import-order import numpy as np from absl import app as absl_app from absl import flags flags.DEFINE_string(name="job-dir", default="/tmp", help="AI Platform Training passes this to the training script.") import tensorflow as tf # pylint: enable=g-bad-import-order from tensorflow.contrib.compiler import xla from official.datasets import movielens from official.recommendation import constants as rconst from official.recommendation import data_pipeline from official.recommendation import data_preprocessing from official.recommendation import neumf_model from official.utils.flags import core as flags_core from official.utils.logs import hooks_helper from official.utils.logs import logger from official.utils.logs import mlperf_helper from official.utils.misc import distribution_utils from official.utils.misc import model_helpers FLAGS = flags.FLAGS def construct_estimator(model_dir, params): """Construct either an Estimator or TPUEstimator for NCF. Args: model_dir: The model directory for the estimator params: The params dict for the estimator Returns: An Estimator or TPUEstimator. """ if params["use_tpu"]: # Some of the networking libraries are quite chatty. for name in ["googleapiclient.discovery", "googleapiclient.discovery_cache", "oauth2client.transport"]: logging.getLogger(name).setLevel(logging.ERROR) tpu_cluster_resolver = tf.contrib.
cluster_resolver.TPUClusterResolver( tpu=params["tpu"], zone=params["tpu_zone"], project=params["tpu_gcp_project"], coordinator_name="coordinator" ) tf.logging.info("Issuing reset command to TPU to ensure a clean state.") tf.Session.reset(tpu_cluster_resolver.get_mast
er()) # Estimator looks at the master it connects to for MonitoredTrainingSession # by reading the `TF_CONFIG` environment variable, and the coordinator # is used by StreamingFilesDataset. tf_config_env = { "session_master": tpu_cluster_resolver.get_master(), "eval_session_master": tpu_cluster_resolver.get_master(), "coordinator": tpu_cluster_resolver.cluster_spec() .as_dict()["coordinator"] } os.environ['TF_CONFIG'] = json.dumps(tf_config_env) distribution = tf.contrib.distribute.TPUStrategy( tpu_cluster_resolver, steps_per_run=100) else: distribution = distribution_utils.get_distribution_strategy( num_gpus=params["num_gpus"]) run_config = tf.estimator.RunConfig(train_distribute=distribution, eval_distribute=distribution) model_fn = neumf_model.neumf_model_fn if params["use_xla_for_gpu"]: tf.logging.info("Using XLA for GPU for training and evaluation.") model_fn = xla.estimator_model_fn(model_fn) estimator = tf.estimator.Estimator(model_fn=model_fn, model_dir=model_dir, config=run_config, params=params) return estimator def log_and_get_hooks(eval_batch_size): """Convenience function for hook and logger creation.""" # Create hooks that log information about the training and metric values train_hooks = hooks_helper.get_train_hooks( FLAGS.hooks, model_dir=FLAGS.model_dir, batch_size=FLAGS.batch_size, # for ExamplesPerSecondHook tensors_to_log={"cross_entropy": "cross_entropy"} ) run_params = { "batch_size": FLAGS.batch_size, "eval_batch_size": eval_batch_size, "number_factors": FLAGS.num_factors, "hr_threshold": FLAGS.hr_threshold, "train_epochs": FLAGS.train_epochs, } benchmark_logger = logger.get_benchmark_logger() benchmark_logger.log_run_info( model_name="recommendation", dataset_name=FLAGS.dataset, run_params=run_params, test_id=FLAGS.benchmark_test_id) return benchmark_logger, train_hooks def parse_flags(flags_obj): """Convenience function to turn flags into params.""" num_gpus = flags_core.get_num_gpus(flags_obj) num_devices = FLAGS.num_tpu_shards if FLAGS.tpu else num_gpus or 1 batch_size = (flags_obj.batch_size + num_devices - 1) // num_devices eval_divisor = (rconst.NUM_EVAL_NEGATIVES + 1) * num_devices eval_batch_size = flags_obj.eval_batch_size or flags_obj.batch_size eval_batch_size = ((eval_batch_size + eval_divisor - 1) // eval_divisor * eval_divisor // num_devices) return { "train_epochs": flags_obj.train_epochs, "batches_per_step": num_devices, "use_seed": flags_obj.seed is not None, "batch_size": batch_size, "eval_batch_size": eval_batch_size, "learning_rate": flags_obj.learning_rate, "mf_dim": flags_obj.num_factors, "model_layers": [int(layer) for layer in flags_obj.layers], "mf_regularization": flags_obj.mf_regularization, "mlp_reg_layers": [float(reg) for reg in flags_obj.mlp_regularization], "num_neg": flags_obj.num_neg, "num_gpus": num_gpus, "use_tpu": flags_obj.tpu is not None, "tpu": flags_obj.tpu, "tpu_zone": flags_obj.tpu_zone, "tpu_gcp_project": flags_obj.tpu_gcp_project, "beta1": flags_obj.beta1, "beta2": flags_obj.beta2, "epsilon": flags_obj.epsilon, "match_mlperf": flags_obj.ml_perf, "use_xla_for_gpu": flags_obj.use_xla_for_gpu, "epochs_between_evals": FLAGS.epochs_between_evals, } def main(_): with logger.benchmark_context(FLAGS), \ mlperf_helper.LOGGER(FLAGS.output_ml_perf_compliance_logging): mlperf_helper.set_ncf_root(os.path.split(os.path.abspath(__file__))[0]) run_ncf(FLAGS) def run_ncf(_): """Run NCF training and eval loop.""" if FLAGS.download_if_missing and not FLAGS.use_synthetic_data: movielens.download(FLAGS.dataset, FLAGS.data_dir) if FLAGS.seed is not None: np.random.seed(FLAGS.seed) params = parse_flags(FLAGS) total_training_cycle = FLAGS.train_epochs // FLAGS.epochs_between_evals if FLAGS.use_synthetic_data: producer = data_pipeline.DummyConstructor() num_users, num_items = data_preprocessing.DATASET_TO_NUM_USERS_AND_ITEMS[ FLAGS.dataset] num_train_steps = rconst.SYNTHETIC_BATCHES_PER_EPOCH num_eval_steps = rconst.SYNTHETIC_BATCHES_PER_EPOCH else: num_users, num_items, producer = data_preprocessing.instantiate_pipeline( dataset=FLAGS.dataset, data_dir=FLAGS.data_dir, params=params, constructor_type=FLAGS.constructor_type, deterministic=FLAGS.seed is not None) num_train_steps = (producer.train_batches_per_epoch // params["batches_per_step"]) num_eval_steps = (producer.eval_batches_per_epoch // params["batches_per_step"]) assert not producer.train_batches_per_epoch % params["batches_per_step"] assert not producer.eval_batches_per_epoch % params["batches_per_step"] producer.start() params["num_users"], params["num_items"] = num_users, num_items model_helpers.apply_clean(flags.FLAGS) estimator = construct_estimator(model_dir
eyeofhell/parabridge
parabridge/settings.py
Python
gpl-3.0
3,770
0.032891
#!/usr/bin/env python # coding:utf-8 vi:et:ts=2 # parabridge persistent settings module. # Copyright 2013 Grigory Petrov # See LICENSE for details. import xmlrpclib import socket import sqlite3 import uuid import info SQL_CREATE = """ CREATE TABLE IF NOT EXISTS task ( guid TEXT UNIQUE, name TEXT UNIQUE, src TEXT, dst TEXT); CREATE TABLE IF NOT EXISTS index_last ( guid TEXT, file TEXT, index_last INTEGER); """ SQL_TASK_ADD = """INSERT INTO task (guid, name, src, dst) VALUES (:guid, :name, :src, :dst)""" SQL_TASK_LIST = """SELECT * FROM task""" SQL_TASK_DEL_BY_NAME = """DELETE FROM task WHERE name = :name""" SQL_TASK_GUID_BY_NAME = """SELECT guid FROM task WHERE name = :name""" SQL_INDEX_LAST_DEL = """DELETE FROM index_last WHERE guid = :guid""" SQL_INDEX_LAST_UPDATE = """UPDATE index_last SET index_last = :index_last WHERE guid = :guid AND file = :file""" SQL_INDEX_LAST_ADD = """INSERT INTO index_last (guid, file, index_last) VALUES (:guid, :file, :index_last)""" SQL_INDEX_LAST_GET = """SELECT index_last FROM index_last WHERE guid = :guid AND file = :file""" class Settings( object ): def __init__( self ): self._init_f = False self._notify_f = False def init( self, f_notify = False ): self._notify_f = f_notify self._init_f = True with sqlite3.connect( info.FILE_CFG ) as oConn: oConn.executescript( SQL_CREATE ) ## Notify daemon process so it can read updated settings. def notifyIfNeeded( self ): if not self._notify_f: return try: xmlrpclib.ServerProxy( info.COMM_ADDR ).cfg_changed() except socket.error: pass def taskAdd( self, s_name, s_src, s_dst ): with sqlite3.connect( info.FILE_CFG ) as oConn: try: mValues = { 'guid': str( uuid.uuid4() ), 'name': s_name, 'src': s_src, 'dst': s_dst } oConn.execute( SQL_TASK_ADD, mValues ) except sqlite3.IntegrityError: ## Name not unique. return False else: return True finally: self.notifyIfNeeded() def indexLastSet( self, s_guid, s_file, n_index ): with sqlite3.connect( info.FILE_CFG ) as oConn: mArgs = { 'guid': s_guid, 'file': s_file, 'index_last': n_index } oRet = oConn.execute( SQL_INDEX_LAST_UPDATE, mArgs ) if oRet.rowcount > 0: return ## No record for guid and name pair: add one. oConn.execute( SQL_INDEX_LAST_ADD, mArgs ) def indexLastGet( self, s_guid, s_file ): with sqlite3.connect( info.FILE_CFG ) as oConn: oConn.row_factory = sqlite3.Row mArgs = { 'guid': s_guid, 'file': s_file } lRet = oConn.execute( SQL_INDEX_LAST_GET, mArgs ).fetchall() if 0 == len( lRet ): return None if len( lRet ) > 1: raise Exception( "Consistency error." ) return lRet[ 0 ][ 'index_last' ] def taskDelByName( self, s_name ): with sqlite3.
connect( info.FILE_CFG ) as oConn: oConn.row_factory = sqlite3.Row try: mArgs = { 'name': s_name } oRow = oConn.execute( SQL_TASK_GUID_BY_NAME, mArgs ).fetchone() if oRow is None: return False mArgs[ 'guid' ] = oRow[ 'guid' ] oRet = oConn.execute( SQL_TASK_DEL_BY_NAME, mArgs ) if 0 == oRet.rowcount: raise Exception( "Consistency error" ) oConn.execute( SQL_INDEX_LAST_DEL, mArgs ) return True
finally: self.notifyIfNeeded() def taskList( self ): with sqlite3.connect( info.FILE_CFG ) as oConn: try: oConn.row_factory = sqlite3.Row return oConn.execute( SQL_TASK_LIST ).fetchall() finally: self.notifyIfNeeded() instance = Settings()
stan-cap/bt_rssi
test/main_test.py
Python
mit
1,713
0.010508
from bt_proximity import BluetoothRSSI import time import sys import datetime #//////////////////////////////// BT_ADDR = 'xx:xx:xx:xx:xx:xx'#/// Enter your bluetooth address here! #//////////////////////////////// # ----------------------- DO NOT EDIT ANYTHING BELOW THIS LINE --------------------------- # def write(records, count
): f = open("test_records.txt", "a+") # open records for append. If not present create for i in range(count): # write out each record f.write(str(records[i][0]) + "," + str(records[i][1]) + '\n') f.close() def time_diff(start_time): current_time = datetime
.datetime.now() # get current time diff = (current_time - start_time).total_seconds() # get difference of startime and current time return str(round(diff,2)) def main(start_time): records = [] # initialize array of records count = 0 # initialize count addr = BT_ADDR # assign BT_ADDR num = 10 # amount of records to be recorded while(count < num): btrssi = BluetoothRSSI(addr=addr) time_e = time_diff(start_time) # get seconds elapsed record = (btrssi.get_rssi(), time_e) # create record records.append(record) # add record to records array count += 1 time.sleep(.5) # wait time to get next record write(records, count) # write out records if __name__ == '__main__': main()
atvcaptain/enigma2
lib/python/Plugins/SystemPlugins/FrontprocessorUpgrade/plugin.py
Python
gpl-2.0
2,732
0.032211
from Screens.Screen import Screen from Components.ActionMap import ActionMap from Components.Label import Label from Plugins.Plugin import PluginDescriptor def getUpgradeVersion(): import os try: r = os.popen("fpupgrade --version").read() except IOError: return None if r[:16] != "FP update tool v": return None else: return int(r[16:17]) class FPUpgrade(Screen): skin = """ <screen position="150,200" size="450,200" title="FP upgrade required" > <widget name="text" position="0,0" size="550,50" font="Regular;20" /> <widget name="oldversion_label" position="10,100" size="290,25" font="Regular;20" /> <widget name="newversion_label" position="10,125" size="290,25" font="Regular;20" /> <widget name="oldversion" position="300,100" size="50,25" font="Regular;20" /> <widget name="newversion" position="300,125" size="50,25" font="Regular;20" /> </screen>""" def __init__(self, session): self.skin = FPUpgrade.skin Screen.__init__(self, session) from Tools.StbHardware import getFPVersion version = str(getFPVersion() or "N/A") newversion = str(getUpgradeVersion() or "N/A") self["text"] = Label(_("Your frontprocessor firmware must be upgraded.\nPress OK to start upgrade.")) self["oldversion_label"] = Label(_("Current version:")) self["newversion_label"] = Label(_("New version:")) self["oldversion"] = Label(version) self["newversion"] = Label(newversion) self["actions"] = ActionMap(["OkCancelActions"], { "ok": self.ok, "cancel": self.close, }) def ok(self): self.close(4) class SystemMessage(Screen): skin = """ <screen position="150,200" size="450,200" title="System Message" > <widget source="text" position="0,0" size="450,200" font="Regular;20" halign="center" valign="center" render="Label" /> <ePixmap pixmap="icons/input_error.png" position="5,5" size="53,53" alphatest="on" /> </screen>""" def __init__(self, session, message): from Components.Sources.StaticText import StaticText Screen.__init__(self, session) self["text"] = StaticText(message) self["actions"] = ActionMap(["OkCancelActions"], { "cancel": self.ok, }) def ok(self): self.close() def Plugins(**kwar
gs): from Tools.StbHardware import getFPVersion version = getFPVersion() newversion = getUpgradeVersion() or 0 list = [] if version is not None and version < newversion:
list.append(PluginDescriptor(name=_("FP Upgrade"), where = PluginDescriptor.WHERE_WIZARD, needsRestart = True, fnc=(8, FPUpgrade))) try: msg = open("/proc/stb/message").read() list.append(PluginDescriptor(name=_("System Message Check"), where = PluginDescriptor.WHERE_WIZARD, needsRestart = True, fnc=(9, SystemMessage, msg))) except: pass return list
schakrava/rockstor-core
src/rockstor/scripts/pwreset.py
Python
gpl-3.0
2,030
0.00197
""" Copyright (c) 2012-2013 RockStor, Inc. <http://rockstor.com> This file is part of RockStor. RockStor is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. RockStor is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FI
TNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program. If not, see <http://www.gnu.org/licenses/>. """ import sys import pwd from django.db import transaction from django.co
ntrib.auth.models import User as DjangoUser from storageadmin.models import User from system import users @transaction.atomic def change_password(username, password): try: duser = DjangoUser.objects.get(username=username) duser.set_password(password) duser.save() except: sys.exit('username: %s does not exist in the admin database' % username) try: User.objects.get(username=username) except: sys.exit('username: %s does not exist in the database' % username) try: pwd.getpwnam(username) except KeyError: sys.exit('username: %s does not exist in the system' % username) try: users.usermod(username, password) users.smbpasswd(username, password) except: sys.exit('Low level error occured while changing password of user: %s' % username) def main(): if (len(sys.argv) < 3 or (len(sys.argv) > 1 and sys.argv[1] == '-h')): sys.exit('Usage: pwreset <username> <new_password>') try: change_password(sys.argv[1], sys.argv[2]) except: sys.exit('Error changing password for user: %s. Check the username ' 'and try again.' % sys.argv[1])
reinbach/django-machina
example_projects/demo/demo_project/urls.py
Python
bsd-3-clause
1,208
0
# -*- coding: utf-8 -*- from __future__ import unicode_literals from django.conf import settings from django.conf.urls import include from django.conf.urls import url from django.contrib import admin from django.views.i18n import JavaScriptCatalog from demo.apps.app import application js_info_dict = { 'packages': ('b
ase', ), } urlpatterns = [ url(r'^jsi18n/$', JavaScriptCatalog.as_view(), name='javascript_catalog'), # Admin url(r'^' + settings.ADMIN_URL, admin.site.urls), # Apps url(r'', include(application.urls)), ] if settings.DEBUG: # Ad
d the Debug Toolbar’s URLs to the project’s URLconf import debug_toolbar urlpatterns += [url(r'^__debug__/', include(debug_toolbar.urls)), ] # In DEBUG mode, serve media files through Django. from django.contrib.staticfiles.urls import staticfiles_urlpatterns from django.views import static urlpatterns += staticfiles_urlpatterns() # Remove leading and trailing slashes so the regex matches. media_url = settings.MEDIA_URL.lstrip('/').rstrip('/') urlpatterns += [ url(r'^%s/(?P<path>.*)$' % media_url, static.serve, {'document_root': settings.MEDIA_ROOT}), ]
persandstrom/home-assistant
homeassistant/components/switch/netio.py
Python
apache-2.0
5,530
0
""" The Netio switch component. For more details about this platform, please refer to the documentation at https://home-assistant.io/components/switch.netio/ """ import logging from collections import namedtuple from datetime import timedelta import voluptuous as vol from homeassistant.core import callback from homeassistant import util from homeassistant.components.http import HomeAssistantView from homeassistant.const import ( CONF_HOST, CONF_PORT, CONF_USERNAME, CONF_PASSWORD, EVENT_HOMEASSISTANT_STOP, STATE_ON) from homeassistant.components.switch import (SwitchDevice, PLATFORM_SCHEMA) import homeassistant.helpers.config_validation as cv REQUIREMENTS = ['pynetio==0.1.6'] _LOGGER = logging.getLogger(__name__) ATTR_START_DATE = 'start_date' ATTR_TOTAL_CONSUMPTION_KWH = 'total_energy_kwh' CONF_OUTLETS = 'outlets' DEFAULT_PORT = 1234 DEFAULT_USERNAME = 'admin' DEPENDENCIES = ['http'] Device = namedtuple('device', ['netio', 'entities']) DEVICES = {} MIN_TIME_BETWEEN_SCANS = timedelta(seconds=10) REQ_CONF = [CONF_HOST, CONF_OUTLETS] URL_API_NETIO_EP = '/api/netio/{host}' PLATFORM_SCHEMA = PLATFORM_SCHEMA.extend({ vol.Required(CONF_HOST): cv.string, vol.Required(CONF_PORT, default=DEFAULT_PORT): cv.port, vol.Required(CONF_USERNAME, default=DEFAULT_USERNAME): cv.string, vol.Required(CONF_PASSWORD): cv.string, vol.Optional(CONF_OUTLETS): {cv.string: cv.string}, }) def setup_platform(hass, config, add_entities, discovery_info=None): """Set up the Netio platform.""" from pynetio import Netio host = config.get(CONF_HOST) username = config.get(CONF_USERNAME) password = config.get(CONF_PASSWORD) port = config.get(CONF_PORT) if not DEVICES: hass.http.register_view(NetioApiView) dev = Netio(host, port, username, password) DEVICES[host] = Device(dev, []) # Throttle the update for all Netio switches of one Netio dev.update = util.Throttle(MIN_TIME_BETWEEN_SCANS)(dev.update) for key in config[CONF_OUTLETS]: switch = NetioSwitch( DEVICES[host].netio, key, config[CONF_OUTLETS][key]) DEVICES[host].entities.append(switch) add_entities(DEVICES[host].entities) hass.bus.listen_once(EVENT_HOMEASSISTANT_STOP, dispose) return True def dispose(event): """Close connections to Netio Devices.""" for _, value in DEVICES.items(): value.netio.stop() class NetioApiView(HomeAssistantView): """WSGI handler class.""" url = URL_API_NETIO_EP name = 'api:netio' @callback def get(self, request, host): """Request handler.""" hass = request.app['hass'] data = request.query states, consumptions, cumulated_consumptions, start_dates = \ [], [], [], [] for i in range(1, 5): out = 'output%d' % i states.append(data.get('%s_state' % out) == STATE_ON) consumptions.append(float(data.get('%s_consumption' % out, 0))) cumulated_consumptions.append( float(data.get('%s_cumulatedConsumption' % out, 0)) / 1000) start_dates.append(data.get('%s_consumptionStart' % out, "")) _LOGGER.debug('%s: %s, %s, %s since %s', host, states, consumptions, cumulated_consumptions, start_dates) ndev = DEVICES[host].netio ndev.consumptions = consumptions ndev.cumulated_consumptions = cumulated_consumptions ndev.states = states ndev.start_dates = start_dates for dev in DEVICES[host].entities: hass.async_add_job(dev.async_update_ha_state()) return self.json(True) class NetioSwitch(SwitchDevice): """Provide a Netio linked switch.""" def __init__(self, netio, outlet, name): """Initialize the Netio switch.""" self._name = name self.outlet = outlet self.netio = netio @property def name(self): """Return the device's name.""" return self._name @property def available(self): """Return true if entity is available.""" return not hasattr(self, 'telnet') def t
urn_on(self, **kwargs): """Turn switch on.""" self._set(True) def turn_off(self, **kwargs): """Turn switch off.""" self._set(False) def _set(self, value): val = list('uuuu') val[self.outlet - 1] = '1' if value else '0' self.netio.get('port list %s' % ''.join(val)) self.netio.states[self
.outlet - 1] = value self.schedule_update_ha_state() @property def is_on(self): """Return the switch's status.""" return self.netio.states[self.outlet - 1] def update(self): """Update the state.""" self.netio.update() @property def state_attributes(self): """Return optional state attributes.""" return { ATTR_TOTAL_CONSUMPTION_KWH: self.cumulated_consumption_kwh, ATTR_START_DATE: self.start_date.split('|')[0] } @property def current_power_w(self): """Return actual power.""" return self.netio.consumptions[self.outlet - 1] @property def cumulated_consumption_kwh(self): """Return the total enerygy consumption since start_date.""" return self.netio.cumulated_consumptions[self.outlet - 1] @property def start_date(self): """Point in time when the energy accumulation started.""" return self.netio.start_dates[self.outlet - 1]
MakersLab/Farm-server
server/main.py
Python
gpl-3.0
3,234
0.002474
#!/usr/bin/env python3.7 from multiprocessing import Process import time import os from printerState import main as printerStateMain from server import main as serverMain from websocket import main as websocketServerMain servicesTemplate = { 'server': { 'name': 'Server', 'run': serverMain, 'running': False }, 'printerState': { 'name': 'Printer State', 'run': printerStateMain, 'running': False }, 'websocketServer': { 'name': 'Websocket server', 'run': websocketServerMain, 'running': False } } class ServiceManager: def __init__(self, services, autoStart=False): self.log('Creating processes') self.services = services for serviceName in services: newProcess = Process(target=self.services[serviceName]['run']) newProcess.daemon = True self.services[serviceName]['process'] = newProcess if (autoStart): newProcess.start() self.log('Creating and starting process for {0} with pid {1}'.format(self.services[serviceName]['name'], newProcess.pid)) self.services[serviceName]['running'] = True else: self.log('Creating process for {0}'.format(self.services[serviceName]['name'])) self.services[serviceName]['running'] = False def updateServiceState(self): servicesRunning = [] servicesStopped = [] for serviceName in self.services: self.services[serviceName]['running'] = self.services[serviceName]['process'].is_alive() if(self.services[serviceName]['running']): servicesRunning.append(self.services[serviceName]['name']) else: servicesStopped.append(self.services[serviceName]['name']) if(len(servicesStopped) != 0): self.log('Services stopped: {0}'.format(','.join(servicesStopped))) def restartStoppedServices(self): for serviceName in self.services: if (not self.services[serviceName]['running']): self.startService(serviceName) def startService(self, serviceName): if(self.services[serviceName]['running']): self.log('Cant start service which is already running', 'warning') else: self.services[serviceName]['process'].terminate() self.services[serviceName]['process'] = Proc
ess(target=self.services[serviceName]['run']) self.services[serviceName]['proc
ess'].start() self.log('Creating and starting process for {0} with pid {1}'.format( self.services[serviceName]['name'], self.services[serviceName]['process'].pid)) self.services[serviceName]['running'] = True def loop(self): while True: self.updateServiceState() self.restartStoppedServices() time.sleep(4) def log(self, message, level='info'): print('{0}-[Service Manager][{2}] {1}'.format(round(time.time()), message, level)) def main(): services = ServiceManager(servicesTemplate, autoStart=True) services.loop() if __name__ == '__main__': main()
DaVinAhn/EPubMaker
EPubMaker.py
Python
mit
16,500
0.030364
# -*- coding: utf-8 -*- import sublime, sublime_plugin import os import shutil import subprocess import zipfile import glob import sys import codecs import re import json import xml.etree.ElementTree ### ### Global Value ### PACKAGE_NAME = 'EPubMaker' OPEN_COMMAND = 'epub_maker_open' SAVE_COMMAND = 'epub_maker_save' PREVIEW_COMMAND = 'epub_maker_preview' WORKSPACES_PATH = None SUMMARY_EXTENSION = 'sublime-epub-summary' IDENTIFIER_EXTENSION = 'sublime-epub-identifier' PROJECT_EXTENSION = 'sublime-project' IGNORE_EXTENSIONS = [ SUMMARY_EXTENSION, IDENTIFIER_EXTENSION, PROJECT_EXTENSION, 'sublime-workspace' ] PREVIEW_PREFIX = 'epub-preview-' SETTINGS = {} ST3 = sublime.version() >= '3000' ### ### EventListener ### class EpubMakerEventListener(sublime_plugin.EventListener): def on_load(self, view): filename = view.file_name() if is_valid_format(filename, [SUMMARY_EXTENSION]): # summary 파일은 수정할 수 없도록 view.set_read_only(True) elif not is_valid_format(filename): # epub 확장자 확인 return elif ST3: # Sublime Text 3 확인 global WORKSPACES_PATH if WORKSPACES_PATH is None: # workspaces 초기화 확인 return else: view.run_command(OPEN_COMMAND) # epub 열기 def on_post_save(self, view): if not get_setting('auto_save'): return view.run_command(SAVE_COMMAND) # epub 저장 ### ### TextCommand ### class EpubMakerOpenCommand(sublime_plugin.TextCommand): def is_enabled(self): return is_valid_format(self.view.file_name()) def run(self, edit): def extract(workpath, namelist): os.makedirs(workpath) for name in namelist: filepath = os.path.join(workpath, name) dirname = os.path.dirname(filepath) if not os.path.exists(dirname): # 디렉토리가 존재하지 않는지 os.makedirs(dirname) if os.path.isdir(filepath): # 디렉토리인지 continue else: with open(filepath, 'wb') as descriptor: descriptor.write(epub.read(name)) def close_views(workpath, namelist): activewindow = sublime.active_window() activeview = activewindow.active_view() for name in namelist: if name.startswith(workpath): # 절대경로 인지 filepath = name else: filepath = os.path.join(workpath, name) for window in sublime.windows(): for view in window.views(): if view.file_name() == filepath: view.set_scratch(True) window.focus_view(view) window.run_command('close_file') break activewindow.focus_view(activeview) def close_folders(workpath): for window in sublime.windows(): for folder in window.folders(): if folder == workpath: window.run_command('remove_folder', {'dirs': [folder]}) break window.run_command('refresh_folder_list') # 압축 해제 epubpath = self.view.file_name() try: epub = zipfile.ZipFile(epubpath) except Exception as e: sublime.error_message('압축을 해제하는 중 오류가 발생했습니다') print(PACKAGE_NAME + ':open: \'' + epubpath + '\'의 압축을 해제하는 중 오류가 발생했습니다') return # workspace 생성 global WORKSPACES_PATH workpath = os.path.join(WORKSPACES_PATH, os.path.splitext(os.path.basename(epubpath))[0]) namelist = epub.namelist() close_views(workpath, namelist + [get_sumblime_project_path(workpath), get_epub_identifier_path(workpath), get_epub_summary_path(workpath), get_preview_path(workpath)]) close_folders(workpath) if not os.path.exists(workpath): extract(workpath, namelist) elif not sublime.ok_cancel_dialog('이전에 작업하던 ePub입니다.\n이어서 작업하시겠습니까?'): shutil.rmtree(workpath) extract(workpath, namelist) # 프로젝트 파일 생성 idpath = create_epub_identifier(workpath, epubpath) projectpath = create_sublime_project(workpath) summarypath = create_epub_summary(workpath, epubpath) # epub 뷰 닫음 view = self.view window = view.window() view.set_scratch(True) window.focus_view(view) window.run_command('close_file') # 생성된 프로젝트 오픈 if is_windows(): sumlpath = os.path.join(os.path.dirname(sublime.__file__), 'subl.exe') else: sumlpath = os.path.join(os.path.dirname(os.path.dirname(sublime.__file__)), 'SharedSupport', 'bin', 'subl') cmd = '"' + sumlpath + '" --project "' + projectpath + '" --add "' + summarypath + '"' if get_setting('new_window'): cmd += ' --new-window' subprocess.Popen(cmd, shell=True) window.run_command('refresh_folder_list') sublime.status_message('Opend ePub ' + epubpath) print(PACKAGE_NAME + ':open: \'' + epubpath + '\' -> \'' + workpath + '\'') class EpubMakerSaveCommand(sublime_plugin.TextCommand): def run(self, edit): workpath = get_work_path(self.view) if workpath is None: return # epub-identifier 찾기 idpath = get_epub_identifier_path(workpath) if not os.path.exists(idpath): sublime.error_message('\'' + idpath + '\'를 찾을 수 없습니다') print(PACKAGE_NAME + ':save: \'' + idpath + '\'를 찾을 수 없습니다') return if get_setting('require_confirm_save'): if not sublime.ok_cancel_dialog('변경된 내용을 ePub에도 반영 하시겠습니까?'): return # epub-identifier 읽기 idfile = open(idpath, 'r') epubid = json.loads(idfile.read()) idfile.close() epubpath = None if get_setting('overwite_original'): epubpath = epubid['src_path'] if not epubpath is None and get_setting('backup_original'): def backup(path): try: shutil.copy(path, set_extension(path, get_setting('backup_extension'))) except Exception as e: sublime.error_message('\'' + epubpath + '\'을 백업하는 중 오류가 발생했습니다') print(PACKAGE_NAME + ':save: \'' + epubpath + '\'을 백업하는 중 오류가 발생했습니다') backup(epubpath) if epubpath is None: epubpath = set_extension(os.path.join(workpath, '..', os.path.basename(workpath)), 'epub') epub = zipfile.ZipFile(epubpath, 'w') # ePub OCF에 따라 mimetype을 제일 먼저 압축없이 압축파일에 포함 epub.writestr('mimetype', 'application/epub+zip', zipfile
.ZIP_STORED) # 이후 디렉토리와 파일을 추가 for root, dirs, files in os.walk(workpath):
if root == workpath: continue epub.write(root, root[len(workpath + os.sep):], zipfile.ZIP_STORED) for f in files: if is_ignore_file(f) or f == 'mimetype' or f.startswith(PREVIEW_PREFIX): continue f = os.path.join(root, f) epub.write(f, f[len(workpath + os.sep):], zipfile.ZIP_DEFLATED) epub.close() sublime.status_message('Saved ePub ' + epubpath) print(PACKAGE_NAME + ':save: \'' + epubpath + '\'') class EpubMakerPreviewCommand(sublime_plugin.TextCommand): def run(self, edit): workpath = get_work_path(self.view) if workpath is None: return filename = self.view.file_name() if not is_valid_format(filename, ['html', 'htm', 'xhtml', 'xhtm']): return previewfile = open(get_resource_path('preview.html'), 'r') preview = previewfile.read() previewfile.close() preview = preview.replace('#EPUB_NAME#', os.path.basename(workpath)) preview = preview.replace('#EPUB_SPINE_NAME#', os.path.basename(filename)) preview = preview.replace('#EPUB_SPINE_PATH#', filename.replace(workpath + os.sep, '')) previewpath = get_preview_path(workpath) with codecs.open(previewpath, 'w', 'utf-8') as html: html.write(preview) html.close() sublime.active_window().run_command('side_bar_open_in_browser', {'browser': 'chromium', 'paths': [previewpath], 'type': 'testing'}) ### ### Global Def (utility) ### def get_platform_name(): return sublime.platform() def is_windows(): return get_platform_name().startswith('windows') def is_osx(): return get_platform_name().startswith('osx') def natural_sort(l): convert = lambda text: int(text) if text.isdigit() else text.lower() alphanum_key = lambda key: [ convert(c) for c in re.split('([0-9]+)', key) ] return sorted(l, key = alphanum_key) def set_extension(path=None, extension=None): if path is None or extension is None: return None else: return path + '.' + extension def is_valid_format(filename=None, extensions=['epub']): if filename is None or '.' not in filename: return False else: return filename.rsplit('.', 1)[1] in extensions def is_ignore_file(filename=None): if filename is None: return True elif is_valid_format(filename, IGNORE_EXTENSIONS): return True else: return False def get_setting(key): return SETTINGS[key]; def load_settings(): settings = sublime.load_settings(PACKAGE_NAME + '
BRAINSia/ITK
Modules/Core/Common/wrapping/test/itkVariableLengthVectorTest.py
Python
apache-2.0
1,870
0
# ========================================================================== # # Copyright NumFOCUS # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with t
he License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0.txt # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions a
nd # limitations under the License. # # ==========================================================================*/ import itk itk.auto_progress(2) n_channels = 31 # Verify UC addition operation vector_type = itk.VariableLengthVector[itk.UC] vector1 = vector_type(n_channels) vector2 = vector_type(n_channels) assert len(vector1) == n_channels and len(vector2) == n_channels vector1.Fill(16) for idx in range(n_channels): vector2[idx] = idx sum = vector1 + vector2 print(f'UC sum: {sum}') for idx in range(n_channels): assert sum[idx] == 16 + idx, "Got unexpected result from vector sum" # Verify float addition operation vector_float_type = itk.VariableLengthVector[itk.F] vector3 = vector_float_type(n_channels) vector4 = vector_float_type(n_channels) assert len(vector3) == n_channels and len(vector4) == n_channels vector3.Fill(0.5) for idx in range(n_channels): vector4.SetElement(idx, 0.1 * idx) float_sum = vector3 + vector4 print(f'float sum: {float_sum}') tolerance = 1e-6 for idx in range(n_channels): diff = abs(float_sum[idx] - (0.5 + 0.1 * idx)) print(f'float sum[{idx}]: {float_sum[idx]:0.9f} diff: {diff:0.2e}') assert diff < tolerance, "Got unexpected result from vector float sum"
drewrobb/marathon-python
marathon/_compat.py
Python
mit
173
0
""" Support for python 2 & 3, ripped pieces from si
x.py """ import sys PY3 = sys.version_info[0] == 3 if PY3: string_types = str, else: string_types
= basestring,
DIT524-V17/group-7
TCP raspberry/server.py
Python
gpl-3.0
181
0.005525
# Author: Pontus Laestadius. # Since: 2nd of March,
2017. # Maintained since: 17th of April 2017. from receiver import Receiver print("Version 2.2") R
eceiver("172.24.1.1", 9005)
KonradBreitsprecher/espresso
doc/tutorials/06-active_matter/SOLUTIONS/rectification_geometry.py
Python
gpl-3.0
5,253
0.008186
################################################################################ # # # Copyright (C) 2010,2011,2012,2013,2014, 2015,2016 The ESPResSo project # # # # This file is part of ESPResSo. # # # # ESPResSo is free software: you can redistribute it and/or modify # # it und
er the terms of the GNU General Public License as published by # # the Free Software Foundation, either version 3 of the License, or # # (at your option) any later version. # #
# # ESPResSo is distributed in the hope that it will be useful, # # but WITHOUT ANY WARRANTY; without even the implied warranty of # # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # # GNU General Public License for more details. # # # # You should have received a copy of the GNU General Public License # # along with this program. If not, see <http://www.gnu.org/licenses/>. # # # ################################################################################ # # # Active Matter: Rectification System Setup # # # ################################################################################ from __future__ import print_function from math import cos, pi, sin import numpy as np import os import sys from espressomd import assert_features, lb from espressomd.lbboundaries import LBBoundary from espressomd.shapes import Cylinder, Wall, HollowCone assert_features(["LB_GPU","LB_BOUNDARIES_GPU"]) # Setup constants outdir = "./RESULTS_RECTIFICATION_GEOMETRY/" try: os.makedirs(outdir) except: print("INFO: Directory \"{}\" exists".format(outdir)) # Setup the box (we pad the diameter to ensure that the LB boundaries # and therefore the constraints, are away from the edge of the box) length = 100 diameter = 20 dt = 0.01 # Setup the MD parameters system = espressomd.System(box_l=[length, dieameter+4, diameter+4]) system.cell_system.skin = 0.1 system.time_step = dt system.min_global_cut = 0.5 # Setup LB parameters (these are irrelevant here) and fluid agrid = 1 vskin = 0.1 frict = 20.0 visco = 1.0 densi = 1.0 lbf = lb.LBFluidGPU(agrid=agrid, dens=densi, visc=visco, tau=dt, fric=frict) system.actors.add(lbf) ################################################################################ # # Now we set up the three LB boundaries that form the rectifying geometry. # The cylinder boundary/constraint is actually already capped, but we put # in two planes for safety's sake. If you want to create an cylinder of # 'infinite length' using the periodic boundaries, then the cylinder must # extend over the boundary. # ################################################################################ # Setup cylinder cylinder = LBBoundary(shape=Cylinder(center=[length/2.0, (diameter+4)/2.0, (diameter+4)/2.0], axis=[1,0,0], radius=diameter/2.0, length=length, direction=-1)) system.lbboundaries.add(cylinder) # Setup walls wall = LBBoundary(shape=Wall(dist=2, normal=[1,0,0])) system.lbboundaries.add(wall) wall = LBBoundary(shape=Wall(dist=-(length - 2), normal=[-1,0,0])) system.lbboundaries.add(wall) # Setup cone irad = 4.0 angle = pi/4.0 orad = (diameter - irad)/sin(angle) shift = 0.25*orad*cos(angle) hollow_cone = LBBoundary(shape=HollowCone(position_x=length/2.0 - shift, position_y=(diameter+4)/2.0, position_z=(diameter+4)/2.0, orientation_x=1, orientation_y=0, orientation_z=0, outer_radius=orad, inner_radius=irad, width=2.0, opening_angle=angle, direction=1)) system.lbboundaries.add(hollow_cone) ################################################################################ # Output the geometry lbf.print_vtk_boundary("{}/boundary.vtk".format(outdir)) ################################################################################
everyevery/programming_study
lgecodejam/2014-mar/c/c.py
Python
mit
1,284
0.010125
def process(target, other): result = [[] for ch in target] ret = [] for xi, xv in enumerate(target): for yi, yv in enumerate(other): if xv != yv: result[xi].append(0) elif 0 == xi or 0 == yi: result[xi].append(1) else: result[xi].append(result[xi-1][yi-1]+1) ret.append(max(result[xi])) return ret def find_shortest(word_lengt
h, sub_map): for l in range(1, word_length+1): # print "LEN: ", l for pos in range(l-1, word_length): # print "POS: ", pos flag = True for other in sub_map: #
print l, other[pos] if l <= other[pos]: flag = False break if flag: return l def solve(n, word_list): for (xi, xv) in enumerate(word_list): result = [] for (yi, yv) in enumerate(word_list): if (xv != yv): result.append(process(xv, yv)) # print xv, len(xv), result print find_shortest(len(xv), result) if __name__ == '__main__': N = int(raw_input()) WORD = [] for n in xrange(N): WORD.append(raw_input().strip()) solve(N, WORD)
tobikausk/nest-simulator
pynest/nest/tests/test_sp/test_enable_multithread.py
Python
gpl-2.0
2,237
0
# -*- coding: utf-8 -*- # # test_enable_multithread.py # # This file is part of NEST. # # Copyright (C) 2004 The NEST Initiative # # NEST is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 2 of the License, or # (at your option) any later version. # # NEST is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR P
URPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along
with NEST. If not, see <http://www.gnu.org/licenses/>. import nest import unittest __author__ = 'sdiaz' # Structural plasticity currently does not work with multiple threads. # An exception should be rised if structural plasticity is enabled # and multiple threads are set, or if multiple threads are set and # the enable_structural_plasticity function is called. HAVE_OPENMP = nest.sli_func("is_threaded") @unittest.skipIf(not HAVE_OPENMP, 'NEST was compiled without multi-threading') class TestEnableMultithread(unittest.TestCase): def setUp(self): nest.ResetKernel() nest.set_verbosity('M_ERROR') def test_enable_multithread(self): nest.ResetKernel() nest.EnableStructuralPlasticity() # Setting multiple threads when structural plasticity is enabled should # throw an exception with self.assertRaises(nest.NESTError): nest.SetKernelStatus( { 'local_num_threads': 2 } ) def test_multithread_enable(self): nest.ResetKernel() nest.SetKernelStatus( { 'local_num_threads': 2 } ) # Setting multiple threads when structural plasticity is enabled should # throw an exception with self.assertRaises(nest.NESTError): nest.EnableStructuralPlasticity() def suite(): test_suite = unittest.makeSuite(TestEnableMultithread, 'test') return test_suite if __name__ == '__main__': unittest.main()
cnvogelg/fs-uae-gles
launcher/fs_uae_launcher/editor/XMLControl.py
Python
gpl-2.0
2,828
0.001061
from __future__ import division from __future__ import print_function from __future__ import absolute_import from __future__ import unicode_literals import os import xml.etree.ElementTree from xml.etree.cElementTree import ElementTree, Element, SubElement from xml.etree.cElementTree import fromstring, tostring import fs_uae_launcher.fsui as fsui from ..Config import Config from ..Settings import Settings from ..I18N import _, ngettext class XMLControl(fsui.TextArea): def __init__(self, parent): fsui.TextArea.__init__(self, parent, horizontal_scroll=True) self.path = "" def connect_game(self, info): tree = self.get_tree() root = tree.getroot() if not root.tag == "config": return game_node = self.find_or_create_node(root, "game") game_node.set("uuid", info["uuid"]) game_name_node = self.find_or_create_node(game_node, "name") game_name_nod
e.text = info["name"] self.set_tree(tree) def find_or_create_node(self, element, name): node = element.find(name) if node is None: node = SubElement(element, name) return node def set_path(self, path): if not os.path.exists(path): path = "" self.path = path if path: self.load_xml(path) else: self.set_text("") def g
et_tree(self): text = self.get_text().strip() try: root = fromstring(text.encode("UTF-8")) except Exception: # FIXME: show message import traceback traceback.print_exc() return tree = ElementTree(root) indent_tree(root) return tree def set_tree(self, tree): data = tostring(tree.getroot(), encoding="UTF-8").decode("UTF-8") std_decl = "<?xml version='1.0' encoding='UTF-8'?>" if data.startswith(std_decl): data = data[len(std_decl):].strip() self.set_text(data) def load_xml(self, path): with open(path, "rb") as f: data = f.read() self.set_text(data) def save(self): if not self.path: print("no path to save XML to") return self.save_xml(self.path) def save_xml(self, path): self.get_tree().write(self.path) def indent_tree(elem, level=0): i = "\n" + level*" " if len(elem): if not elem.text or not elem.text.strip(): elem.text = i + " " if not elem.tail or not elem.tail.strip(): elem.tail = i for elem in elem: indent_tree(elem, level+1) if not elem.tail or not elem.tail.strip(): elem.tail = i else: if level and (not elem.tail or not elem.tail.strip()): elem.tail = i
gwq5210/litlib
thirdparty/sources/protobuf/python/google/protobuf/descriptor.py
Python
gpl-3.0
37,400
0.006364
# Protocol Buffers - Google's data interchange format # Copyright 2008 Google Inc. All rights reserved. # https://developers.google.com/protocol-buffers/ # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are # met: # # * Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # * Redistributions in binary form must reproduce the above # copyright notice, this list of conditions and the following disclaimer # in the documentation and/or other materials provided with the # distribution. # * Neither the name of Google Inc. nor the names of its # contributors may be used to endorse or promote products derived from # this software without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS # "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT # LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR # A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT # OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, # SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT # LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, # DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY # THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT # (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE # OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. """Descriptors essentially contain exactly the information found in a .proto file, in types that make this information accessible in Python. """ __author__ = '[email protected] (Will Robinson)' import six from google.protobuf.internal import api_implementation _USE_C_DESCRIPTORS = False if api_implementation.Type() == 'cpp': # Used by MakeDescriptor in cpp mode import os import uuid from google.protobuf.pyext import _message _USE_C_DESCRIPTORS = getattr(_message, '_USE_C_DESCRIPTORS', False) class Error(Exception): """Base error for this module.""" class TypeTransformationError(Error): """Error transforming between python proto type and corresponding C++ type.""" if _USE_C_DESCRIPTORS: # This metaclass allows to override the behavior of code like # isinstance(my_descriptor, FieldDescriptor) # and make it return True when the descriptor is an instance of the extension # type written in C++. class DescriptorMetaclass(type): def __instancecheck__(cls, obj): if super(DescriptorMetaclass, cls).__instancecheck__(obj): return True if isinstance(obj, cls._C_DESCRIPTOR_CLASS): return True return False else: # The standard metaclass; nothing changes. DescriptorMetaclass = type class DescriptorBase(six.with_metaclass(DescriptorMetaclass)): """Descriptors base class. This class is the base of all descriptor classes. It provides common options related functionality. Attributes: has_options: True if the descriptor has non-default options. Usually it is not necessary to read this -- just call GetOptions() which will happily return the default instance. However, it's sometimes useful for efficiency, and also useful inside the protobuf implementation to avoid some bootstrapping issues. """ if _USE_C_DESCRIPTORS: # The class, or tuple of classes, that are considered as "virtual # subclasses" of this descriptor class. _C_DESCRIPTOR_CLASS = () def __init__(self, options, options_class_name): """Initialize the descriptor given its options message and the name of the class of the options message. The name of the class is required in case the options message is None and has to be created. """ self._options = options self._options_class_name = options_class_name # Does this descriptor have non-default options? self.has_options = options is not None def _SetOptions(self, options, options_class_name): """Sets the descriptor's options This function is used in generated proto2 files to update descriptor options. It must not be used outside proto2. """ self._options = options self._options_class_name = options_class_name # Does this descriptor have non-default options? self.has_options = options is not None def GetOptions(self): """Retrieves descriptor options. This method returns the options set or creates the default options for the descriptor. """ if self._options: return self._options from google.protobuf import descriptor_pb2 try: options_class = getattr(descriptor_pb2, self._options_class_name) except AttributeError: raise RuntimeError('Unknown options class name %s!' % (self._options_class_name)) self._options = options_class() return self._options class _NestedDescriptorBase(DescriptorBase): """Common class for descriptors that can be nested.""" def __init__(self, options, options_class_name, name, full_name, file, containing_type, serialized_start=None, serialized_end=None): """Constructor. Args: options: Protocol message options or None to use default message options. options_class_name: (str) The class name of the above options. name: (str) Name of this protocol message type. full_name: (str) Fully-qualified name of this protocol message type, which will include protocol "package" name and the name of any enclosing types. file: (FileDescriptor) Reference to file info. containing_type: if provided, this is a nested descriptor, with this descriptor as parent, otherwise None. serialized_start: The start index (inclusive) in block in the file.serialized_pb that describes this descriptor. serialized_end: The end index (exclusive) in block in the file.serialized_pb that describes this descriptor. """ super(_NestedDescriptorBase, self).__init__( options, options_class_name) self.name = name # TODO(falk): Add function to calculate full_name instead of having it in # memory? self.full_name = full_name self.file = file self.containing_type = containing_type self._serialized_start = serialized_start self._serialized_end = serialized_end def GetTopLevelContainingType(self): """Returns the root if this is a nested type, or itself if its the root.""" desc = self while desc.containing_type is not None: desc = desc.containing_type return desc def CopyToProto(self, proto): """Copies this to the matching proto in descriptor_pb2. Args: proto: An empty proto instance from descriptor_pb2. Raises: Error: If self couldnt be serialized, due to to few constructor arguments. """ if (self.file is not None and self._serialized_start is not None and self._serialized_end is not None): proto.ParseFromString(self.file.serialized_pb[ self._serialized_start:self._serialized_end]) else: raise Error('Descriptor does not contain serialization.') class Descriptor(_NestedDescriptorBase): """Descriptor for a protocol message type. A Descriptor instance has the following attributes: name: (str) Name of this protocol message type. full_name: (str) Fully-qualified name of this protocol message type, which will include prot
ocol "package" name and the name of any enclosing types. containing_type: (Descriptor) Reference to the descriptor of the type containing us, or None if this is top-level. fields: (list of FieldDescriptors) Field descriptors
for all fields in this type. fields_by_number: (dict int -> FieldDescriptor) Same FieldDescriptor objects as in |fields|, but indexed by "number" attribute in each FieldDescriptor. fields_by_name: (dict str -> FieldDescriptor) Same FieldDescriptor objects as in |f
hlmnrmr/liveblog
server/liveblog/syndication/exceptions.py
Python
agpl-3.0
199
0
class APIConnectionError(Exception): pass class DownloadErro
r(Exception): pass class ProducerAPIError(APIConnectionError): pass class ConsumerAPIError(APIConnectionE
rror): pass
libor-m/scrimer
scrimer/primer3_connector.py
Python
agpl-3.0
7,094
0.006061
""" A Python interface to the primer3_core executable. TODO: it is not possible to keep a persistent primer3 process using subprocess module - communicate() terminates the input stream and waits for the process to finish Author: Libor Morkovsky 2012 """ # This file is a part of Scrimer. # See LICENSE.txt for details on licensing. # Copyright (C) 2012, 2013 Libor Morkovsky class BoulderIO: """Provides Python interface for ``BoulderIO`` format used by Primer3. """ @classmethod def parse(self, string): r"""Parse a BoulderIO string ``(KEY=VAL\n)`` return a list of records, where each record is a dictionary end of the string implies a single ``'=\n'`` (record separator). """ record_strings = string.split("=\n") return [dict(tuple(line.split("=", 1)) for line in record.split("\n") if len(line) > 3) for record in record_strings if len(record) > 3] @classmethod def deparse(self, records): r"""Accepts a dict or a list of dicts, produces a BoulderIO string ``(KEY=VAL\n)`` with records separated by ``'=\n'``. """ # unify the input, create a list with single element if type(records) == dict: records = [records] return "\n=\n".join("\n".join("=".join(kval) for kval in record.iteritems()) for record in records) + "\n=\n" class Primer3: """Wraps Primer3 executable. `kwargs` are converted to strings and used as default parameters for each call of primer3 binary. """ def __init__(self, p3path="primer3_core", **kwargs): # store path to primer3 self.p3path = p3path # add stringized versions of all kwargs to default args self.default_params = {} str_kw = dict((key, str(val)) for key, val in kwargs.iteritems()) self.default_params.update(str_kw) def call(self, records): """Merge each of the records with `default_params`, the record taking precedence, call the ``primer3`` binary, parse the output and return a list of dictionaries, ``{RIGHT:[], LEFT:[], PAIR:[], INTERNAL:[]}`` for each input record uppercase keys (in the result) are the original names from BoulderIO format, lowercase keys have no direct equivalent in primer3 output (``position``, ``other-keys``) """ # merge the defaults with current query full_records = [dict(self.default_params.items() + record.items()) for record in records] # call primer3 import subprocess self.child = subprocess.Popen([self.p3path, '-strict_tags'], stdin=subprocess.PIPE, stdout=subprocess.PIPE, stderr=subprocess.PIPE) out, err = self.child.communicate(BoulderIO.deparse(full_records)) # simple check for errors in stderr if len(err): raise Exception(err) results = BoulderIO.parse(out) # parse the results to {RIGHT:[], LEFT:[], PAIR:[], INTERNAL:[]} sides = ['RIGHT', 'LEFT', 'PAIR', 'INTERNAL'] primers = [] for result in results: # primers for current result res_primers = dict((side, []) for side in sides) used_keys = [] for side in sides: nret_key = 'PRIMER_%s_NUM_RETURNED' % side nret = int(result.get(nret_key, 0)) used_keys.append(nret_key) # extract the values for each single primer and put those to # equivalent key for num in xrange(nret): template = 'PRIMER_%s_%d_' % (side, num) primer_keys = filter(lambda k: template in k, result.iterkeys()) primer = dict((key[len(template):], result[key]) for key in primer_keys) # extract the position, which itself has no extractible name in BoulderIO # only 'PRIMER_LEFT_0' if side != 'PAIR': pos_key = template[:len(template)-1] primer['position'] = result.get(pos_key, "#error!") used_keys.append(pos_key) # keep track of keys used in current record used_keys.extend(primer_keys) res_primers[side].append(primer) # store all the unused keys for current result res_primers['other-keys'] = dict((key, result[key]) for key in result.iterkeys() if key not in used_keys) primers.append(res_primers) return primers if __name__ == "__main__": print "Running tests" import textwrap record = BoulderIO.parse(textwrap.dedent( """ SEQUENCE_ID=example SEQUENCE_TEMPLATE=GTAGTCAGTAGACGATGACTACTGACGATGCAGACNACACACACACACACAGCACACAGGTATTAGTGGGCCATTCGATCCCGACCCAAATCGATAGCTACGATGACG SEQUENCE_TARGET=37,21 PRIMER_PICK_INTERNAL_OLIGO=0 PRIMER_OPT_SIZE=18 PRIMER_MIN_SIZE=15 PRIMER_MAX_SIZE=21 PRIMER_MAX_NS_ACCEPTED=3 PRIMER_PRODUCT_SIZE_RANGE=50-100 """)) record_no_res = BoulderIO.parse(textwrap.dedent( """ SEQUENCE_ID=example SEQUENCE_TEMPLATE=GTAGTCAGTAGACNATGACNACTGACGATGCAGACNACACACACACACACAGCACACAGGTATTAGTGGGCCATTCGATCCCGACCCAAATCGATAGCTACGATGACG SEQUENCE_TARGET=37,21 PRIMER_TASK=pick_detection_primers PRIMER_PICK_LEFT_PRIMER=1 PRIMER_PICK_INTERNAL_OLIGO=1 PRIMER_PICK_RIGHT_PRIMER=1 PRIMER_OPT_SIZE=18 PRIMER_MIN_SIZE=15 PRIMER_MAX_SIZE=21 PRIMER_MAX_NS_ACCEPTED=1 PRIMER_PRODUCT_SIZE_RANGE=75-100 SEQUENCE_INTERNAL_EXCLUDED_REGION=37,21 """)) default_params = BoulderIO.parse(textwrap.dedent( """ PRIMER_THERMODYNAMIC_PARAMETERS_PATH=/opt/primer3/bin/primer3_config/ PRIMER_MAX_NS_ACCEPTED=0 PRIMER_EXPLAIN_FLAG=1 """))[0] print "Testing BoulderIO, single record:", record_dp = BoulderIO.deparse(record) record_reparsed = BoulderIO.parse(record_dp) if record == record_reparsed: print "OK
" else: print "Failed!" print "Testing BoulderIO, two records:", two_records = record + record_no_res record_dp = BoulderIO.deparse(two_records) record_reparsed = BoulderIO.parse(record_dp) if two_records == record_reparsed: print "OK" else: print "Failed!" print "Testing
Primer3, single record:", p3 = Primer3(**default_params) # test for single record res = p3.call(record) if res[0]['RIGHT'][0]['SEQUENCE'] == 'GTCGGGATCGAATGGCCC': print "OK" else: print "Failed!" # test for multiple records print "Testing Primer3, two records:", res = p3.call(two_records) # second record should produce no results if len(res[1]['RIGHT']) == 0: print "OK" else: print "Failed!" # if no exception occurs, the test should be OK print "Tests ran OK"
EricssonResearch/scott-eu
robot-emulator/main.py
Python
apache-2.0
3,749
0.005346
import paho.mqtt.client as mqtt import os,binascii import logging import time from enum import Enum from threading import Timer import json import random import math ID_STRING = binascii.hexlify(os.urandom(15)).decode('utf-8')[:4] CLIENT_ID = "robot-emulator-" + ID_STRING BROKER_HOST = "mosquitto" TOPIC_STATUS = "twin/%s/status" % ID_STRING TOPIC_PLANS = "twin/%s/plans" % ID_STRING TOPIC_REGISTRATION = "twins/registration/announce" TOPIC_HANDSHAKE = "twins/registration/handshake" class TwinStatus(Enum): NOT_CONNECTED = 1 SEARCHING = 2 SELECTED = 3 CONNECTED = 4 DISCONNECTED = 5 status = TwinStatus.NOT_CONNECTED timer = None def main(): logging.info("Client '%s' is connecting...", CLIENT_ID) # Client(client_id=””, clean_session=True, userdata=None, protocol=MQTTv311, transport=”tcp”) client = mqtt.Client(CLIENT_ID) client.on_connect = on_connect client.on_message = on_message try: client.connect(BROKER_HOST) logging.info("Client '%s' CONNECTED to '%s'", CLIENT_ID, BROKER_HOST) except Exception as e: logging.error("Failed to connect to the MQTT broker on host '%s' (CLIENT_ID='%s')", BROKER_HOST, CLIENT_ID) logging.debug(e) client.loop_forever() def twin_search_timeout(client, n): if not status == TwinStatus.CONNECTED: logging.warning("Twin connection is not established (%s)", status) request_twin(client) schedule_reconnect(client, n+1) def on_connect(client, userdata, flags, rc): print("Connected with result code "+str(rc)) # Subscribing in on_connect() means that if we lose the connection and # reconnect then subscriptions will be renewed. # no need to sub to our own statuses # sub(client, TOPIC_STATUS) sub(client, TOPIC_PLANS) sub(client, TOPIC_HANDSHAKE) # client.publish(TOPIC_STATUS, "{'status': 'on'}") request_twin(client) schedule_reconnect(client, 1) # TODO also publish some message on the 'registration' topic def sub(client, topic): client.subscribe(topic) logging.info("Subscribed to %s", topic) def schedule_reconnect(client, n): delay = min(0.1 * 2 ** (n-1) + (random.randint(0, 200) / 1000), 10) logging.debug("Next reconnection attempt in %fs", delay) timer = Timer(delay, twin_search_timeout, [client, n]) timer.start() def request_twin(client): client.publish(TOPIC_REGISTRATION, json.dumps({'twin': ID_STRING, 'status': 'awaiting'})) status = TwinStatus.SEARCHING # The callback for when a PUBLISH message is received from the server. def on_message(client, userdata, msg): logging.debug("New message '%s' (topic: '%s', QoS%d)", msg.payload, msg.topic, msg.qos) if not msg.topic == TOPIC_STATUS: client.publish(TOPIC_STATUS, json.dumps({'status': 'done'})) if msg.topic == TOPIC_HANDSHAKE: reg_reply = json.loads(msg.payload) process_reg_reply(reg_reply, client, msg) def process_reg_reply(reg_reply, client, msg): if reg_reply["device"] != ID_STRING: logging.debug("A registration message for another device received: %s", msg.payload) else: t = reg_reply["twin"] logging.debug("Trying to select
the twin '%s'", t) # TODO do we really need this status?
status = TwinStatus.SELECTED register_with_twin(t) def register_with_twin(t): logging.warning("Not implemented yet") status = TwinStatus.CONNECTED twin = t if __name__ == "__main__": logging.basicConfig(level=logging.DEBUG, format='%(asctime)s %(name)-12s %(levelname)-8s %(message)s', datefmt='%y-%m-%d %H:%M') main() logging.warning("Client '%s' is shutting down", CLIENT_ID)
auth0/auth0-python
auth0/v3/test/management/test_resource_servers.py
Python
mit
3,056
0.000327
import unittest import mock from ...management.resource_servers import ResourceServers class TestResourceServers(unittest.TestCase): def test_init_with_optionals(self): t = ResourceServers(domain='domain', token='jwttoken', telemetry=False, timeout=(10, 2)) self.assertEqual(t.client.options.timeout, (10, 2)) telemetry_header = t.client.base_headers.get('Auth0-Client', None) self.assertEqual(telemetry_header, None) @mock.patch('auth0.v3.management.resource_servers.RestClient') def test_create(self, mock_rc): mock_instance = mock_rc.return_value r = ResourceServers(domain='domain', token='jwttoken') r.create({'name': 'TestApi', 'identifier': 'https://test.com/api'}) mock_instance.post.assert_called_with( 'https://doma
in/api/v2/resource-servers', data={'name': 'TestApi', 'identifier': 'https://test.com/api'} ) @mock.patch('auth0.v3.management.resource_servers.RestClient') def test_get_all(self, mock_rc): mock_instance = mock_rc.return_value r = ResourceServers(domain='domain', token='jwttoken') # with
default params r.get_all() mock_instance.get.assert_called_with( 'https://domain/api/v2/resource-servers', params={ 'page': None, 'per_page': None, 'include_totals': 'false' } ) # with pagination params r.get_all(page=3, per_page=27, include_totals=True) mock_instance.get.assert_called_with( 'https://domain/api/v2/resource-servers', params={ 'page': 3, 'per_page': 27, 'include_totals': 'true' } ) @mock.patch('auth0.v3.management.resource_servers.RestClient') def test_get(self, mock_rc): mock_instance = mock_rc.return_value r = ResourceServers(domain='domain', token='jwttoken') r.get('some_id') mock_instance.get.assert_called_with( 'https://domain/api/v2/resource-servers/some_id' ) @mock.patch('auth0.v3.management.resource_servers.RestClient') def test_delete(self, mock_rc): mock_instance = mock_rc.return_value r = ResourceServers(domain='domain', token='jwttoken') r.delete('some_id') mock_instance.delete.assert_called_with( 'https://domain/api/v2/resource-servers/some_id' ) @mock.patch('auth0.v3.management.resource_servers.RestClient') def test_update(self, mock_rc): mock_instance = mock_rc.return_value r = ResourceServers(domain='domain', token='jwttoken') r.update('some_id', {'name': 'TestApi2', 'identifier': 'https://test.com/api2'}) mock_instance.patch.assert_called_with( 'https://domain/api/v2/resource-servers/some_id', data={'name': 'TestApi2', 'identifier': 'https://test.com/api2'} )
wandec/grr
client/client_actions/plist.py
Python
apache-2.0
2,452
0.008564
#!/usr/bin/env python # Copyright 2012 Google Inc. All Rights Reserved. """Client actions related to plist files.""" import cStringIO import types from grr.client import actions from grr.client import vfs from grr.lib import plist as plist_lib from grr.lib import rdfvalue from grr.parsers import binplist class PlistQuery(actions.ActionPlugin): """Parses the plist request specified and returns the results. PlistQuery allows you to obtain data from a plist, optionally only if it matches the given filter. Querying for a plist is done in two steps. First, its contents are retrieved. For plists where the top level element is a dict, you can use the key parameter of the PlistRequest to specify a path into the dict to retrieve. When specifying a key, the requested
key values are places under a dictionary key called "key". Whether you've specified a key or not, the query parameter allows you to filter based on the """ in_rdfvalue = rdfvalue.PlistRequest out_rdfvalue = rdfvalue.RDFValueArray MAX_PLIST_SIZE = 1024 * 1024 * 100 # 100 MB def Run(self, args): self.context = args.context self.filter_query = args.query with vfs.VFSOpen(args.pat
hspec, progress_callback=self.Progress) as fd: data = fd.Read(self.MAX_PLIST_SIZE) plist = binplist.readPlist(cStringIO.StringIO(data)) # Create the query parser parser = plist_lib.PlistFilterParser(self.filter_query).Parse() filter_imp = plist_lib.PlistFilterImplementation matcher = parser.Compile(filter_imp) if self.context: # Obtain the values for the context using the value expander value_expander = filter_imp.FILTERS["ValueExpander"] iterator = value_expander().Expand(plist, self.context) else: # If we didn't get a context, the context is the whole plist iterator = [plist] reply = rdfvalue.RDFValueArray() for item in iterator: # As we're setting the context manually, we need to account for types if isinstance(item, types.ListType): for sub_item in item: partial_plist = plist_lib.PlistValueToPlainValue(sub_item) if matcher.Matches(partial_plist): reply.Append(sub_item) else: partial_plist = plist_lib.PlistValueToPlainValue(item) if matcher.Matches(partial_plist): reply.Append(partial_plist) self.SendReply(reply)
renalreg/radar
radar/models/patient_addresses.py
Python
agpl-3.0
8,540
0.000117
#! -*- coding: utf-8 -*- from collections import OrderedDict from sqlalchemy import Column, Date, ForeignKey, Index, String from sqlalchemy import Integer from sqlalchemy.orm import relationship from radar.database import db from radar.models.common import MetaModelMixin, patient_id_column, patient_relationship, uuid_pk_column from radar.models.logs import log_changes COUNTRIES = OrderedDict([ ('AF', 'Afghanistan'), ('AX', 'Åland Islands'), ('AL', 'Albania'), ('DZ', 'Algeria'), ('AS', 'American Samoa'), ('AD', 'Andorra'), ('AO', 'Angola'), ('AI', 'Anguilla'), ('AQ', 'Antarctica'), ('AG', 'Antigua and Barbuda'), ('AR', 'Argentina'), ('AM', 'Armenia'), ('AW', 'Aruba'), ('AU', 'Australia'), ('AT', 'Austria'), ('AZ', 'Azerbaijan'), ('BS', 'Bahamas'), ('BH', 'Bahrain'), ('BD', 'Bangladesh'), ('BB', 'Barbados'), ('BY', 'Belarus'), ('BE', 'Belgium'), ('BZ', 'Belize'), ('BJ', 'Benin'), ('BM', 'Bermuda'), ('BT', 'Bhutan'), ('BO', 'Bolivia, Plurinational State of'), ('BQ', 'Bonaire, Sint Eustatius and Saba'), ('BA', 'Bosnia and Herzegovina'), ('BW', 'Botswana'), ('BV', 'Bouvet Island'), ('BR', 'Brazil'), ('IO', 'British Indian Ocean Territory'), ('BN', 'Brunei Darussalam'), ('BG', 'Bulgaria'), ('BF', 'Burkina Faso'), ('BI', 'Burundi'), ('KH', 'Cambodia'), ('CM', 'Cameroon'), ('CA', 'Canada'), ('CV', 'Cape Verde'), ('KY', 'Cayman Islands'), ('CF', 'Central African Republic'), ('TD', 'Chad'), ('CL', 'Chile'), ('CN', 'China'), ('CX', 'Christmas Island'), ('CC', 'Cocos (Keeling) Islands'), ('CO', 'Colombia'), ('KM', 'Comoros'), ('CG', 'Congo'), ('CD', 'Congo, the Democratic Republic of the'), ('CK', 'Cook Islands'), ('CR', 'Costa Rica'), ('CI', 'Côte d\'Ivoire'), ('HR', 'Croatia'), ('CU', 'Cuba'), ('CW', 'Curaçao'), ('CY', 'Cyprus'), ('CZ', 'Czech Republic'), ('DK', 'Denmark'), ('DJ', 'Djibouti'), ('DM', 'Dominica'), ('DO', 'Dominican Republic'), ('EC', 'Ecuador'), ('EG', 'Egypt'), ('SV', 'El Salvador'), ('GQ', 'Equatorial Guinea'), ('ER', 'Eritrea'), ('EE', 'Estonia'), ('ET', 'Ethiopia'), ('FK', 'Falkland Islands (Malvinas)'), ('FO', 'Faroe Islands'), ('FJ', 'Fiji'), ('FI', 'Finland'), ('FR', 'France'), ('GF', 'French Guiana'), ('PF', 'French Polynesia'), ('TF', 'French Southern Territories'), ('GA', 'Gabon'), ('GM', 'Gambia'), ('GE', 'Georgia'), ('DE', 'Germany'), ('GH', 'Ghana'), ('GI', 'Gibraltar'), ('GR', 'Greece'), ('GL', 'Greenland'), ('GD', 'Grenada'), ('GP', 'Guadeloupe'), ('GU', 'Guam'), ('GT', 'Guatemala'), ('GG', 'Guernsey'), ('GN', 'Guinea'), ('GW', 'Guinea-Bissau'), ('GY', 'Guyana'), ('HT', 'Haiti'), ('HM', 'Heard Island and McDonald Islands'), ('VA', 'Holy See (Vatican City State)'), ('HN', 'Honduras'), ('HK', 'Hong Kong'), ('HU', 'Hungary'), ('IS', 'Iceland'), ('IN', 'India'), ('ID', 'Indonesia'), ('IR', 'Iran, Islamic Republic of'), ('IQ', 'Iraq'), ('IE', 'Ireland'), ('IM', 'Isle of Man'), ('IL', 'Israel'), ('IT', 'Italy'), ('JM', 'Jamaica'), ('JP', 'Japan'), ('JE', 'Jersey'), ('JO', 'Jordan'), ('KZ', 'Kazakhstan'), ('KE', 'Kenya'), ('KI', 'Kiribati'), ('KP', 'Korea, Democratic People\'s Republic of'), ('KR', 'Korea, Republic of'), ('KW', 'Kuwait'), ('KG', 'Kyrgyzstan'), ('LA', 'Lao People\'s Democratic Republic'), ('LV', 'Latvia'), ('LB', 'Lebanon'), ('LS', 'Lesotho'), ('LR', 'Liberia'), ('LY', 'Libya'), ('LI', 'Liechtenstein'), ('LT', 'Lithuania'), ('LU', 'Luxembourg'), ('MO', 'Macao'), ('MK', 'Macedonia, the former Yugoslav Republic of'), ('MG', 'Madagascar'), ('MW', 'Malawi'), ('MY', 'Malaysia'), ('MV', 'Maldives'), ('ML', 'Mali'), ('MT', 'Malta'), ('MH', 'Marshall Islands'), ('MQ', 'Martinique'), ('MR', 'Mauritania'), ('MU', 'Mauritius'), ('YT', 'Mayotte'), ('MX', 'Mexico'), ('FM', 'Micronesia, Federated States of'), ('MD', 'Moldova, Republic of'), ('MC', 'Monaco'), ('MN', 'Mongolia'), ('ME', 'Montenegro'), ('MS', 'Montserrat'),
('MA', 'Morocco'), ('MZ', 'Mozambique'), ('MM', 'Myanmar'), ('NA', 'Na
mibia'), ('NR', 'Nauru'), ('NP', 'Nepal'), ('NL', 'Netherlands'), ('NC', 'New Caledonia'), ('NZ', 'New Zealand'), ('NI', 'Nicaragua'), ('NE', 'Niger'), ('NG', 'Nigeria'), ('NU', 'Niue'), ('NF', 'Norfolk Island'), ('MP', 'Northern Mariana Islands'), ('NO', 'Norway'), ('OM', 'Oman'), ('PK', 'Pakistan'), ('PW', 'Palau'), ('PS', 'Palestinian Territory, Occupied'), ('PA', 'Panama'), ('PG', 'Papua New Guinea'), ('PY', 'Paraguay'), ('PE', 'Peru'), ('PH', 'Philippines'), ('PN', 'Pitcairn'), ('PL', 'Poland'), ('PT', 'Portugal'), ('PR', 'Puerto Rico'), ('QA', 'Qatar'), ('RE', 'Réunion'), ('RO', 'Romania'), ('RU', 'Russian Federation'), ('RW', 'Rwanda'), ('BL', 'Saint Barthélemy'), ('SH', 'Saint Helena, Ascension and Tristan da Cunha'), ('KN', 'Saint Kitts and Nevis'), ('LC', 'Saint Lucia'), ('MF', 'Saint Martin (French part)'), ('PM', 'Saint Pierre and Miquelon'), ('VC', 'Saint Vincent and the Grenadines'), ('WS', 'Samoa'), ('SM', 'San Marino'), ('ST', 'Sao Tome and Principe'), ('SA', 'Saudi Arabia'), ('SN', 'Senegal'), ('RS', 'Serbia'), ('SC', 'Seychelles'), ('SL', 'Sierra Leone'), ('SG', 'Singapore'), ('SX', 'Sint Maarten (Dutch part)'), ('SK', 'Slovakia'), ('SI', 'Slovenia'), ('SB', 'Solomon Islands'), ('SO', 'Somalia'), ('ZA', 'South Africa'), ('GS', 'South Georgia and the South Sandwich Islands'), ('SS', 'South Sudan'), ('ES', 'Spain'), ('LK', 'Sri Lanka'), ('SD', 'Sudan'), ('SR', 'Suriname'), ('SJ', 'Svalbard and Jan Mayen'), ('SZ', 'Swaziland'), ('SE', 'Sweden'), ('CH', 'Switzerland'), ('SY', 'Syrian Arab Republic'), ('TW', 'Taiwan, Province of China'), ('TJ', 'Tajikistan'), ('TZ', 'Tanzania, United Republic of'), ('TH', 'Thailand'), ('TL', 'Timor-Leste'), ('TG', 'Togo'), ('TK', 'Tokelau'), ('TO', 'Tonga'), ('TT', 'Trinidad and Tobago'), ('TN', 'Tunisia'), ('TR', 'Turkey'), ('TM', 'Turkmenistan'), ('TC', 'Turks and Caicos Islands'), ('TV', 'Tuvalu'), ('UG', 'Uganda'), ('UA', 'Ukraine'), ('AE', 'United Arab Emirates'), ('GB', 'United Kingdom'), ('US', 'United States'), ('UM', 'United States Minor Outlying Islands'), ('UY', 'Uruguay'), ('UZ', 'Uzbekistan'), ('VU', 'Vanuatu'), ('VE', 'Venezuela, Bolivarian Republic of'), ('VN', 'Viet Nam'), ('VG', 'Virgin Islands, British'), ('VI', 'Virgin Islands, U.S.'), ('WF', 'Wallis and Futuna'), ('EH', 'Western Sahara'), ('YE', 'Yemen'), ('ZM', 'Zambia'), ('ZW', 'Zimbabwe'), ]) @log_changes class PatientAddress(db.Model, MetaModelMixin): __tablename__ = 'patient_addresses' id = uuid_pk_column() patient_id = patient_id_column() patient = patient_relationship('patient_addresses') source_group_id = Column(Integer, ForeignKey('groups.id'), nullable=False) source_group = relationship('Group') source_type = Column(String, nullable=False) from_date = Column(Date) to_date = Column(Date) address1 = Column(String) address2 = Column(String) address3 = Column(String) address4 = Column(String) postcode = Column(String) country = Column(String) @property def full_address(self): parts = [] parts.extend([ self.address1, self.address2, self.address3, self.address4, self.postcode, self.country, ]) return '\n'.join(x for x in parts if x) @propert
erangre/Dioptas
dioptas/model/util/smooth_bruckner_python.py
Python
gpl-3.0
2,059
0.004371
# -*- coding: utf-8 -*- # Dioptas - GUI program for fast processing of 2D X-ray diffraction data # Principal author: Clemens Prescher ([email protected]) # Copyright (C) 2014-2019 GSECARS, University of Chicago, USA # Copyright (C) 2015-2018 Institute for Geology and Mineralogy, University of Cologne, Germany # Copyright (C) 2019 DESY, Hamburg, Germany # # This program is free software: you can redistr
ibute it and/or modify # it under the terms of the GNU General Publ
ic License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. import numpy as np def smooth_bruckner(y, smooth_points, iterations): y_original = y N_data = y.size N = smooth_points N_float = float(N) y = np.empty(N_data + N + N) y[0:N].fill(y_original[0]) y[N:N + N_data] = y_original[0:N_data] y[N + N_data:N_data + N + N].fill(y_original[-1]) y_avg = np.average(y) y_min = np.min(y) y_c = y_avg + 2. * (y_avg - y_min) y[y > y_c] = y_c window_size = N_float*2+1 for j in range(0, iterations): window_avg = np.average(y[0: 2*N + 1]) for i in range(N, N_data - 1 - N - 1): if y[i]>window_avg: y_new = window_avg #updating central value in average (first bracket) #and shifting average by one index (second bracket) window_avg += ((window_avg-y[i]) + (y[i+N+1]-y[i - N]))/window_size y[i] = y_new else: #shifting average by one index window_avg += (y[i+N+1]-y[i - N])/window_size return y[N:N + N_data]
RedHatInsights/insights-core
examples/rules/stand_alone.py
Python
apache-2.0
2,746
0
#!/usr/bin/env python """ Standaone Rule ============== This is a customer spec, parser and rule and can be run against the local host using the following command:: $ insights-run -p examples.rules.stand_alone or from the examples/rules directory:: $ ./stand_alone.py """ from __future__ import print_function from collections import namedtuple from insights import get_active_lines, parser, Parser from insights import make_fail, make_pass, rule, run from insights.core.spec_factory import SpecSet, simple_file from insights.parsers.redhat_release import RedhatRelease # Error key used in make_fail ERROR_KEY = "TOO_MANY_HOSTS" # jinga2 template displayed for rule responses CONTENT = { make_fail: """Too many hosts in /etc/hosts: {{num}}""", make_pass: """Just right""" } class Specs(SpecSet): """ Datasources for collection from local host """ hosts = simple_file("/etc/hosts") @parser(Specs.hosts) class HostParser(Parser): """ Parses the results of the ``hosts`` Specs Attributes: hosts (list): List of the namedtuple Host which are the contents of the hosts file including ``.ip``, ``.host``, and ``.aliases``. """ Host = namedtuple("Host", ["ip", "host", "aliases
"]) def parse_content(self, content): """ Method to pars
e the contents of file ``/etc/hosts`` This method must be implemented by each parser. Arguments: content (list): List of strings that are the contents of the /etc/hosts file. """ self.hosts = [] for line in get_active_lines(content): # remove inline comments line = line.partition("#")[0].strip() # break the line into parts parts = line.split() ip, host = parts[:2] aliases = parts[2:] self.hosts.append(HostParser.Host(ip, host, aliases)) def __repr__(self): """ str: Returns string representation of the class """ me = self.__class__.__name__ msg = "%s([" + ", ".join([str(d) for d in self.hosts]) + "])" return msg % me @rule(HostParser, RedhatRelease, content=CONTENT) def report(hp, rhr): """ Rule reports a response if there is more than 1 host entry defined in the /etc/hosts file. Arguments: hp (HostParser): Parser object for the custom parser in this module. rhr (RedhatRelease): Parser object for the /etc/redhat-release file. """ if len(hp.hosts) > 1: return make_fail("TOO_MANY_HOSTS", num=len(hp.hosts)) return make_pass("TOO_MANY_HOSTS", num=len(hp.hosts)) if __name__ == "__main__": run(report, print_summary=True)
sdrogers/ms2ldaviz
ms2ldaviz/ms2ldaviz/views.py
Python
mit
936
0.013889
from django.shortcuts import render from django.template.loader import render_to_string def home(request): context_dict = {} return render(request,'ms2ldaviz/index.h
tml',context_dict) def people(request): context_dict = {} return render(request,'ms2ldaviz/people.html',context_dict) def api(request): context_dict = {} return render(request,'ms2ldaviz/api.html',context_dict) def user_guide(request): markdown_str = render_to_str
ing('markdowns/user_guide.md') return render(request, 'markdowns/user_guide.html', {'markdown_str':markdown_str}) def disclaimer(request): markdown_str = render_to_string('markdowns/disclaimer.md') return render(request, 'markdowns/disclaimer.html', {'markdown_str':markdown_str}) def confidence(request): markdown_str = render_to_string('markdowns/confidence.md') return render(request, 'markdowns/confidence.html', {'markdown_str':markdown_str})
walterbender/speak
sleepy.py
Python
gpl-3.0
2,928
0.000683
# Speak.activity # A simple front end to the espeak text-to-speech engine on the XO laptop # http://wiki.laptop.org/go/Speak # # Copyright (C) 2008 Joshua Minor # Copyright (C) 2014 Walter Bender # This file is part of Speak.activity # # Parts of Speak.activity are based on code from Measure.activity # Copyright (C) 2007 Arjun Sarwal - [email protected] # # Speak.activity is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Speak.activity is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Speak.activity. If not, see <http://www.gnu.org/licenses/>. from gi.repository import Gdk from gi.repository import GdkPixbuf from eye import Eye from utils import svg_str_to_pixbuf class Sleepy(Eye): def __init__(self, fill_color): Eye.__init__(self, fill_color) self._pixbuf = svg_str_to_pixbuf(eye_svg()) def draw(self, widget, cr): bounds = self.get_allocation() # background cr.set_source_rgba(*self.fill_color.get_rgba()) cr.rectangle(0, 0, bounds.width, bounds.height) cr.fill() w = h = min(bounds.width, bounds.height) x = int((bounds.width - w) // 2) y = int((bounds.height - h) // 2)
pixbuf = self._pixbuf.scale_simple(w, h, GdkPixbuf.InterpType.BILINEAR) cr.translate(x + w / 2., y + h / 2.) cr.translate(-x - w / 2., -y - h / 2.) Gdk.cairo_set_source_pixbuf(cr, pixbuf, x, y) cr.rectangle(x, y, w, h) cr.fill() return True def eye_svg(): return \ '<?xml version="1.0" encoding="UTF-8" standalone="no"?>\n' + \ '<svg\n' + \ ' xmlns:svg="http://www.w3.org/2000/svg"\n' + \ ' xm
lns="http://www.w3.org/2000/svg"\n' + \ ' version="1.1"\n' + \ ' width="300"\n' + \ ' height="300">\n' + \ ' <path\n' + \ ' d="m 260.26893,151.09803 c -6.07398,14.55176 -15.05894,27.89881 -26.27797,39.03563 -11.21904,11.13683 -24.66333,20.05466 -39.32004,26.08168 -14.65671,6.02702 -30.51431,9.15849 -46.37814,9.15849 -15.86384,0 -31.72144,-3.13147 -46.37815,-9.15849 C 87.257925,210.18832 73.813631,201.27049 62.594594,190.13366 51.375557,178.99684 42.3906,165.64979 36.316616,151.09803"\n' + \ ' style="fill:none;fill-opacity:1;fill-rule:nonzero;stroke:#000000;stroke-width:13.18636799;stroke-linecap:round;stroke-miterlimit:4;stroke-opacity:1;stroke-dasharray:none" />\n' + \ '</svg>\n'
NicovincX2/Python-3.5
Algorithmique/Algorithme/Algorithme de tri/Tri par tas (Heapsort)/maxheap.py
Python
gpl-3.0
1,134
0.000882
# -*- coding: utf-8 -*- from minheap import minheap class maxheap(minheap): """ Heap class - made of keys and items methods: build_heap, heappush, heappop """ MAX_HEAP = True def __str__(self): return "Max-heap with %s items" % (len(self.heap)) def heapify(self, i): l = self.leftchild(i) r = self.rightchild(i) largest = i if l < self.max_elements() and self.heap[l] > self.heap[largest]: largest = l if r < self.max_elements() and self.heap[r] > self.heap[largest]: largest = r if largest != i: self.heap[i], self.heap[largest] = self.heap[largest], self.heap[i] self.heapify(largest) def heappush(self, x): """ Adds a new item x in the heap""" i = len(self.heap) self.heap.append(x) parent = self.parent(i) while parent != -1 and self.heap[int(i)] > self.heap
[int(parent)]: self.heap[int(i)], self.heap[int(parent)] = self.heap[ int(parent)], self.heap[int(i)]
i = parent parent = self.parent(i)
vejmelkam/emotiv-reader
albow/grid_view.py
Python
gpl-3.0
1,254
0.039075
from pygame import Rect from widget import Widget class GridView(Widget): # cell_size (width, height) size of each cell # # Abstract methods: # # num_rows() --> no. of rows # num_cols() --> no. of columns # draw_cell(surface, row, col, rect) # click_cell(row, col, event) def __init__(self, cell_size, nrows, ncols, **kwds): """nrows, ncols are for calculating initial size of widget""" Widget.__init__(self, **kwds) self.cell_size = cell_size w, h = cell_size d = 2 * self.margin self.size = (w * ncols + d, h * nrows + d) self.cell_size = cell_size def draw(self, surface): for row in xrange(self.num_rows()): for col in xrange(self.num_cols()): r = self.cell_rect(row, col)
self.draw_cell(surface, r
ow, col, r) def cell_rect(self, row, col): w, h = self.cell_size d = self.margin x = col * w + d y = row * h + d return Rect(x, y, w, h) def draw_cell(self, surface, row, col, rect): pass def mouse_down(self, event): x, y = event.local w, h = self.cell_size W, H = self.size d = self.margin if d <= x < W - d and d <= y < H - d: row = (y - d) // h col = (x - d) // w self.click_cell(row, col, event) def click_cell(self, row, col, event): pass
zhaowenxiang/chisch
vod/views.py
Python
mit
446
0
# -*- cod
ing: utf-8 -*- import logging from chisch.common.retwrapper import RetWrapper import cores logger = logging.getLogger('django') def signature_url(request): params_query_dict = request.GET params = {k: v for k, v in params_query_dict.items()} try: url = cores.get_url() except Exception, e: return RetWrapper.wrap_and_return(e) result = {'url': url} return RetWrapper.wrap_and_return(
result)
AdrianGaudebert/socorro
webapp-django/crashstats/crashstats/urls.py
Python
mpl-2.0
3,962
0.000252
from django.conf.urls import patterns, url from django.views.generic import RedirectView from django.conf import settings from . import views products = r'/products/(?P<product>\w+)' versions = r'/versions/(?P<versions>[;\w\.()]+)' version = r'/versions/(?P<version>[;\w\.()]+)' perm_legacy_redirect = settings.PERMANENT_LEGACY_REDIRECTS
urlpatterns = patterns( '', # prefix url('^robots\.txt$', views.robots_txt, name='ro
bots_txt'), url(r'^status/json/$', views.status_json, name='status_json'), url(r'^status/revision/$', views.status_revision, name='status_revision'), url(r'^crontabber-state/$', views.crontabber_state, name='crontabber_state'), url('^crashes-per-day/$', views.crashes_per_day, name='crashes_per_day'), url(r'^exploitability/$', views.exploitability_report, name='exploitability_report'), url(r'^report/index/(?P<crash_id>[\w-]+)$', views.report_index, name='report_index'), url(r'^search/quick/$', views.quick_search, name='quick_search'), url(r'^buginfo/bug', views.buginfo, name='buginfo'), url(r'^rawdumps/(?P<crash_id>[\w-]{36})-(?P<name>\w+)\.' r'(?P<extension>json|dmp|json\.gz)$', views.raw_data, name='raw_data_named'), url(r'^rawdumps/(?P<crash_id>[\w-]{36}).(?P<extension>json|dmp)$', views.raw_data, name='raw_data'), url(r'^login/$', views.login, name='login'), url(r'^graphics_report/$', views.graphics_report, name='graphics_report'), url(r'^about/throttling/$', views.about_throttling, name='about_throttling'), # if we do a permanent redirect, the browser will "cache" the redirect and # it will make it very hard to ever change the DEFAULT_PRODUCT url(r'^$', RedirectView.as_view( url='/home/product/%s' % settings.DEFAULT_PRODUCT, permanent=False # this is not a legacy URL )), # redirect deceased Advanced Search URL to Super Search url(r'^query/$', RedirectView.as_view( url='/search/', query_string=True, permanent=True )), # redirect deceased Report List URL to Signature report url(r'^report/list$', RedirectView.as_view( pattern_name='signature:signature_report', query_string=True, permanent=True )), # redirect deceased Daily Crashes URL to Crasher per Day url(r'^daily$', RedirectView.as_view( pattern_name='crashstats:crashes_per_day', query_string=True, permanent=True )), # Redirect old independant pages to the unified Profile page. url(r'^your-crashes/$', RedirectView.as_view( url='/profile/', permanent=perm_legacy_redirect )), url(r'^permissions/$', RedirectView.as_view( url='/profile/', permanent=perm_legacy_redirect )), # Redirect deleted status page to monitoring page. url( r'^status/$', RedirectView.as_view( pattern_name='monitoring:index', permanent=not settings.DEBUG, ), name='status_redirect', ), # handle old-style URLs url(r'^products/(?P<product>\w+)/$', RedirectView.as_view( url='/home/products/%(product)s', permanent=perm_legacy_redirect )), url(r'^products/(?P<product>\w+)/versions/(?P<versions>[;\w\.()]+)/$', RedirectView.as_view( url='/home/products/%(product)s/versions/%(versions)s', permanent=perm_legacy_redirect )), url('^home' + products + '/versions/$', RedirectView.as_view( url='/home/products/%(product)s', permanent=perm_legacy_redirect )), )
mindcube/mindcube-django-cookiecutter
{{cookiecutter.repo_name}}/project/apps/geo_locator/views.py
Python
mit
265
0.003774
"""Main view for geo locator application""" from dja
ngo.shortcuts import render def index(request): if request.location: location = request.location else:
location = None return render(request, "homepage.html", {'location': location})
gcobos/rft
app/primitives/__init__.py
Python
agpl-3.0
1,163
0.029235
# Generated file. Do not edit __author__="drone" from Abs import Abs from And import And from Average import Average from Ceil import Ceil from Cube import Cube from Divide import Divide from Double import Double from Equal import Equal from Even import Even from Floor import Floor from Greaterorequal import Greaterorequal from Greaterthan import Greaterthan from Half import Half from If import If from Increment import Increment from Lessorequal import Lessorequal from Lessthan import Lessthan from Max import Max from
Min import Min from Modu
le import Module from Multiply import Multiply from Negate import Negate from Not import Not from Odd import Odd from One import One from Positive import Positive from Quadruple import Quadruple from Sign import Sign from Sub import Sub from Sum import Sum from Two import Two from Zero import Zero __all__ = ['Abs', 'And', 'Average', 'Ceil', 'Cube', 'Divide', 'Double', 'Equal', 'Even', 'Floor', 'Greaterorequal', 'Greaterthan', 'Half', 'If', 'Increment', 'Lessorequal', 'Lessthan', 'Max', 'Min', 'Module', 'Multiply', 'Negate', 'Not', 'Odd', 'One', 'Positive', 'Quadruple', 'Sign', 'Sub', 'Sum', 'Two', 'Zero']
sheagcraig/python-jss
jss/misc_endpoints.py
Python
gpl-3.0
13,525
0.000074
#!/usr/bin/env python # Copyright (C) 2014-2017 Shea G Craig # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. """misc_endpoints.py Classes representing API endpoints that don't subclass JSSObject """ from __future__ import print_function from __future__ import absolute_import import mimetypes import os import sys from xml.etree import ElementTree from .exceptions import MethodNotAllowedError, PostError from .tools import error_handler __all__ = ('CommandFlush', 'FileUpload', 'LogFlush') # Map Python 2 basestring type for Python 3. if sys.version_info.major == 3: basestring = str # pylint: disable=missing-docstring # pylint: disable=too-few-public-methods class CommandFlush(object): _endpoint_path = "commandflush" can_get = False can_put = False can_post = False def __init__(self, jss): """Initialize a new CommandFlush Args: jss: JSS object. """ self.jss = jss @property def url(self): """Return the path subcomponent of the url to this object.""" return self._endpoint_path def command_flush_with_xml(self, data): """Flush commands for devices with a supplied xml string. From the Casper API docs: Status and devices specified in an XML file. Id lists may be specified for <computers>, <computer_groups>, <mobile_devices>, <mobile_device_groups>. Sample file: <commandflush> <status>Pending+Failed</status> <mobile_devices> <mobile_device> <id>1</id> </mobile_device> <mobile_device> <id>2</id> </mobile_device> </mobile_devices> </commandflush> Args: data (string): XML string following the above structure or an ElementTree/Element. Raises: DeleteError if provided url_path has a >= 400 response. """ if not isinstance(data, basestring): data = ElementTree.tostring(data, encoding='UTF-8') self.jss.delete(self.url, data) def command_flush_for(self, id_type, command_id, status): """Flush commands for an individual device. Args: id_type (str): One of 'computers', 'computergroups', 'mobiledevices', or 'mobiledevicegroups'. id_value (str, int, list): ID value(s) for the devices to flush. More than one device should be passed as IDs in a list or tuple. status (str): One of 'Pending', 'Failed', 'Pending+Failed'. Raises: DeleteError if provided url_path has a >= 400 response. """ id_types = ('computers', 'computergroups', 'mobiledevices', 'mobiledevicegroups') status_types = ('Pending', 'Failed', 'Pending+Failed') if id_type not in id_types or status not in status_types: raise ValueError("Invalid arguments.") if isinstance(command_id, list): command_id = ",".join(str(item) for item in command_id) flush_url = "{}/{}/id/{}/status/{}".format( self.url, id_type, command_id, status) self.jss.delete(flush_url) # pylint: disable=too-few-public-methods class FileUpload(object): """FileUploads are a special case in the API. They allow you to add file resources to a number of objects on the JSS. To use, instantiate a new FileUpload object, then use the save() method to upload. Once the upload has been posted you may only interact with it through the web interface. You cannot list/get it or delete it through the API. However, you can reuse the FileUpload object if you wish, by changing the parameters, and issuing another save(). """ _endpoint_path = "fileuploads" allowed_kwargs = ('subset',) def __init__(self, j, resource_type, id_type, _id, resource): """Prepare a new FileUpload. Args: j: A JSS object to POST the upload to. resource_type: String. Acceptable Values: Attachments: computers mobiledevices enrollmentprofiles peripherals mobiledeviceenrollmentprofiles Icons: policies ebooks mobiledeviceapplicationsicon Mobile Device Application: mobile
deviceapplicationsipa Disk Encryption diskencryptionconfigurations diskencryptions (synonymous) PPD
printers id_type: String of desired ID type: id name _id: Int or String referencing the identity value of the resource to add the FileUpload to. resource: String path to the file to upload. """ resource_types = ["computers", "mobiledevices", "enrollmentprofiles", "peripherals", "mobiledeviceenrollmentprofiles", "policies", "ebooks", "mobiledeviceapplicationsicon", "mobiledeviceapplicationsipa", "diskencryptionconfigurations", "printers"] id_types = ["id", "name"] self.jss = j # Do some basic error checking on parameters. if resource_type in resource_types: self.resource_type = resource_type else: raise TypeError( "resource_type must be one of: %s" % ', '.join(resource_types)) if id_type in id_types: self.id_type = id_type else: raise TypeError("id_type must be one of: %s" % ', '.join(id_types)) self._id = str(_id) basename = os.path.basename(resource) content_type = mimetypes.guess_type(basename)[0] self.resource = {"name": (basename, open(resource, "rb"), content_type)} self._set_upload_url() def _set_upload_url(self): """Generate the full URL for a POST.""" # pylint: disable=protected-access self._upload_url = "/".join([ self.jss._url, self._endpoint_path, self.resource_type, self.id_type, str(self._id)]) # pylint: enable=protected-access def save(self): """POST the object to the JSS.""" try: response = self.jss.session.post( self._upload_url, files=self.resource) except PostError as error: if error.status_code == 409: raise PostError(error) else: raise MethodNotAllowedError(self.__class__.__name__) if response.status_code == 201: if self.jss.verbose: print("POST: Success") print(response.content) elif response.status_code >= 400: error_handler(PostError, response) class LogFlush(object): _endpoint_path = "logflush" def __init__(self, jss): """Initialize a new LogFlush Args: jss: JSS object. """ self.jss = jss @property def url(self): """Return the path subcomponent of the url to this object.""" return self._endpoint_path def log_flush_with_xml(self, data):
CanonicalLtd/landscape-client
landscape/client/upgraders/tests/test_monitor.py
Python
gpl-2.0
317
0
from landscape.client.tests.helpers import LandscapeTest from landscape.client.patch import UpgradeManager from landscape.client.upgraders import monitor c
lass TestMonitorUpgraders(LandscapeTest): def test_monitor_upgrade_manager(self): self.assertEqual(type(monitor.upgrade_
manager), UpgradeManager)
stryder199/RyarkAssignments
Assignment2/web2py/gaehandler.py
Python
mit
3,279
0.005489
#!/usr/bin/env python # -*- coding: utf-8 -*- """ This file is part of the web2py Web Framework Copyrighted by Massimo D
i Pierro <[email protected]> License: LGPLv3 (http://www.gnu.org/licenses/lgpl.html) """ ############################################################################## # Configuration parameters for Google App Engine ############################################################################## KEEP_CACHED = False # request a dummy url every 10secs to force caching app LOG_STATS = False # web2py l
evel log statistics APPSTATS = True # GAE level usage statistics and profiling DEBUG = False # debug mode AUTO_RETRY = True # force gae to retry commit on failure # # Read more about APPSTATS here # http://googleappengine.blogspot.com/2010/03/easy-performance-profiling-with.html # can be accessed from: # http://localhost:8080/_ah/stats ############################################################################## # All tricks in this file developed by Robin Bhattacharyya ############################################################################## import time import os import sys import logging import cPickle import pickle import wsgiref.handlers import datetime path = os.path.dirname(os.path.abspath(__file__)) sys.path = [path]+[p for p in sys.path if not p==path] sys.modules['cPickle'] = sys.modules['pickle'] from gluon.settings import global_settings from google.appengine.api.labs import taskqueue from google.appengine.ext import webapp from google.appengine.ext.webapp.util import run_wsgi_app global_settings.web2py_runtime_gae = True global_settings.db_sessions = True if os.environ.get('SERVER_SOFTWARE', '').startswith('Devel'): (global_settings.web2py_runtime, DEBUG) = \ ('gae:development', True) else: (global_settings.web2py_runtime, DEBUG) = \ ('gae:production', False) import gluon.main def log_stats(fun): """Function that will act as a decorator to make logging""" def newfun(env, res): """Log the execution time of the passed function""" timer = lambda t: (t.time(), t.clock()) (t0, c0) = timer(time) executed_function = fun(env, res) (t1, c1) = timer(time) log_info = """**** Request: %.2fms/%.2fms (real time/cpu time)""" log_info = log_info % ((t1 - t0) * 1000, (c1 - c0) * 1000) logging.info(log_info) return executed_function return newfun logging.basicConfig(level=logging.INFO) def wsgiapp(env, res): """Return the wsgiapp""" if env['PATH_INFO'] == '/_ah/queue/default': if KEEP_CACHED: delta = datetime.timedelta(seconds=10) taskqueue.add(eta=datetime.datetime.now() + delta) res('200 OK',[('Content-Type','text/plain')]) return [''] env['PATH_INFO'] = env['PATH_INFO'].encode('utf8') return gluon.main.wsgibase(env, res) if LOG_STATS or DEBUG: wsgiapp = log_stats(wsgiapp) if AUTO_RETRY: from gluon.contrib.gae_retry import autoretry_datastore_timeouts autoretry_datastore_timeouts() def main(): """Run the wsgi app""" if APPSTATS: run_wsgi_app(wsgiapp) else: wsgiref.handlers.CGIHandler().run(wsgiapp) if __name__ == '__main__': main()
wolvespack/alcor
alcor/services/plots/velocity_clouds.py
Python
mit
7,567
0.000793
from typing import (Tuple, List) import matplotlib # More info at # http://matplotlib.org/faq/usage_faq.html#what-is-a-backend for details # TODO: use this: https://stackoverflow.com/a/37605654/7851470 matplotlib.use('Agg') from matplotlib import pyplot as plt from matplotlib.patches import Ellipse from matplotlib.axes import Axes import numpy as np import pandas as pd from .utils import to_cartesian_from_equatorial # Kinematic properties of the thin disk taken from the paper of # N.Rowell and N.C.Hambly (mean motions are relative to the Sun): # "White dwarfs in the SuperCOSMOS Sky Survey: the thin disc, # thick disc and spheroid luminosity functions" # Mon. Not. R. Astron. Soc. 417, 93–113 (2011) # doi:10.1111/j.1365-2966.2011.18976.x AVERAGE_POPULATION_VELOCITY_U = -8.62 AVERAGE_POPULATION_VELOCITY_V = -20.04 AVERAGE_POPULATION_VELOCITY_W = -7.1 STD_POPULATION_U = 32.4 STD_POPULATION_V = 23 STD_POPULATION_W = 18.1 def plot(stars: pd.DataFrame, *, filename: str = 'velocity_clouds.ps', figure_size: Tuple[float, float] = (8, 12), spacing: float = 0.25, u_label: str = '$U(km/s)$', v_label: str = '$V(km/s)$', w_label: str = '$W(km/s)$', u_limits: Tuple[float, float] = (-150, 150), v_limits: Tuple[float, float] = (-150, 150), w_limits: Tuple[float, float] = (-150, 150)) -> None: figure, (uv_subplot, uw_subplot, vw_subplot) = plt.subplots(nrows=3, figsize=figure_size) draw_subplot(subplot=uv_subplot, xlabel=u_label, ylabel=v_label, xlim=u_limits, ylim=v_limits, x=stars['u_velocity'], y=stars['v_velocity'], x_avg=AVERAGE_POPULATION_VELOCITY_U, y_avg=AVERAGE_POPULATION_VELOCITY_V, x_std=STD_POPULATION_U, y_std=STD_POPULATION_V) draw_subplot(subplot=uw_subplot, xlabel=u_label, ylabel=w_label, xlim=u_limits, ylim=w_limits, x=stars['u_velocity'], y=stars['w_velocity'], x_avg=AVERAGE_POPULATION_VELOCITY_U, y_avg=AVERAGE_POPULATION_VELOCITY_W, x_std=STD_POPULATION_U, y_std=STD_POPULATION_W) draw_subplot(subplot=vw_subplot, xlabel=v_label, ylabel=w_label, xlim=v_limits, ylim=w_limits, x=stars['v_velocity'], y=stars['w_velocity'], x_avg=AVERAGE_POPULATION_VELOCITY_V, y_avg=AVERAGE_POPULATION_VELOCITY_W, x_std=STD_POPULATION_V, y_std=STD_POPULATION_W) figure.subplots_adjust(hspace=spacing) plt.savefig(filename) def plot_lepine_case(stars: pd.DataFrame, *, filename: str = 'velocity_clouds.ps', figure_size: Tuple[float, float] = (8, 12), spacing: float = 0.25, u_label: str = '$U(km/s)$', v_label: str = '$V(km/s)$', w_label: str = '$W(km/s)$', u_limits: Tuple[float, float] = (-150, 150), v_limits: Tuple[float, float] = (-150, 150), w_limits: Tuple[float, float] = (-150, 150)) -> None: x_coordinates, y_coordinates, z_coordinates = to_cartesian_from_equatorial( stars) highest_coordinates = np.maximum.reduce([np.abs(x_coordinates), np.abs(y_coordinates), np.abs(z_coordinates)]) uv_cloud_stars = stars[(highest_coordinates == z_coordinates)] uw_cloud_stars = stars[(highest_coordinates == y_coordinates)] vw_cloud_stars = stars[(highest_coordinates == x_coordinates)] figure, (uv_subplot, uw_subplot, vw_subplot) = plt.subplots(nrows=3, figsize=figure_size) draw_subplot(subplot=uv_subplot, xlabel=u_label, ylabel=v_label, xlim=u_limits, ylim=v_limits, x=uv_cloud_stars['u_velocity'], y=uv_cloud_stars['v_velocity'], x_avg=AVERAGE_POPULATION_VELOCITY_U, y_avg=AVERAGE_POPULATION_VELOCITY_V, x_std=STD_POPULATION_U, y_std=STD_POPULATION_V) draw_subplot(subplot=uw_subplot, xlabel=u_label, ylabel=w_label, xlim=u_limits, ylim=w_limits, x=uw_cloud_stars['u_velocity'], y=uw_cloud_stars['w_velocity'], x_avg=AVERAGE_POPULATION_VELOCITY_U, y_avg=AVERAGE_POPULATION_VELOCITY_W, x_std=STD_POPULATION_U, y_std=STD_POPULATION_W) draw_subplot(subplot=vw_subplot, xlabel=v_label, ylabel=w_label, xlim=v_limits,
ylim=w_limits, x=vw_cloud_stars['v_velocity'], y=vw_cloud_stars['w_velocity'], x_avg=AVERAGE_POPULATION_VELOCITY_V, y_avg=AVERAGE_POPULATION_VELOCITY_W, x_std=STD_POPULATION_V, y_std=STD_POPULATION_W)
figure.subplots_adjust(hspace=spacing) plt.savefig(filename) def draw_subplot(*, subplot: Axes, xlabel: str, ylabel: str, xlim: Tuple[float, float], ylim: Tuple[float, float], x: List[float], y: List[float], cloud_color: str = 'k', point_size: float = 0.5, x_avg: float, y_avg: float, x_std: float, y_std: float, ratio: float = 10 / 13) -> None: subplot.set(xlabel=xlabel, ylabel=ylabel, xlim=xlim, ylim=ylim) subplot.scatter(x=x, y=y, color=cloud_color, s=point_size) plot_ellipses(subplot=subplot, x_avg=x_avg, y_avg=y_avg, x_std=x_std, y_std=y_std) subplot.minorticks_on() subplot.xaxis.set_ticks_position('both') subplot.yaxis.set_ticks_position('both') subplot.set_aspect(ratio / subplot.get_data_ratio()) def plot_ellipses(subplot: Axes, x_avg: float, y_avg: float, x_std: float, y_std: float, ellipse_color: str = 'b') -> None: std_ellipse = Ellipse(xy=(x_avg, y_avg), width=x_std * 2, height=y_std * 2, fill=False, edgecolor=ellipse_color, linestyle='dashed') double_std_ellipse = Ellipse(xy=(x_avg, y_avg), width=x_std * 4, height=y_std * 4, fill=False, edgecolor=ellipse_color) subplot.add_artist(std_ellipse) subplot.add_artist(double_std_ellipse)
pisskidney/leetcode
medium/16.py
Python
mit
1,070
0
#!/usr/bin/python from typing import List, Optional """ 16. 3Sum Closest https://leetcode.com/problems/3sum-closest/ """ def bsearch(nums, left, right, res, i, j, target): while left <= right: middle = (left + righ
t) // 2
candidate = nums[i] + nums[j] + nums[middle] if res is None or abs(candidate - target) < abs(res - target): res = candidate if candidate == target: return res elif candidate > target: right = middle - 1 else: left = middle + 1 return res class Solution: def threeSumClosest(self, nums: List[int], target: int) -> Optional[int]: res = None nums = sorted(nums) for i in range(len(nums)): for j in range(i + 1, len(nums)): res = bsearch(nums, j + 1, len(nums) - 1, res, i, j, target) return res def main(): sol = Solution() print(sol.threeSumClosest([-111, -111, 3, 6, 7, 16, 17, 18, 19], 13)) return 0 if __name__ == '__main__': raise SystemExit(main())
pwollstadt/IDTxl
test/generate_test_data.py
Python
gpl-3.0
8,187
0.000733
"""Generate test data for IDTxl network comparison unit and system tests. Generate test data for IDTxl network comparison unit and system tests. Simulate discrete and continous data from three correlated Gaussian data sets. Perform network inference using bivariate/multivariate mutual information (MI)/transfer entropy (TE) analysis. Results are saved used for unit and system testing of network comparison (systemtest_network_comparison.py). A coupling is simulated as a lagged, linear correlation between three Gaussian variables and looks like this: 1 -> 2 -> 3 with a delay of 1 sample for each coupling """ import pickle import numpy as np from idtxl.multivariate_te import MultivariateTE from idtxl.bivariate_te import BivariateTE from idtxl.multivariate_mi import MultivariateMI from idtxl.bivariate_mi import BivariateMI from idtxl.estimators_jidt import JidtDiscreteCMI from idtxl.data import Data # path = os.path.join(os.path.dirname(__file__) + '/data/') path = 'data/' def analyse_mute_te_data(): # Generate example data: the following was ran once to generate example # data, which is now in the data sub-folder of the test-folder. data = Data() data.generate_mute_data(100, 5) # analysis settings settings = { 'cmi_estimator': 'JidtKraskovCMI', 'n_perm_max_stat': 50, 'n_perm_min_stat': 50, 'n_perm_omnibus': 200, 'n_perm_max_seq': 50, 'max_lag_target': 5, 'max_lag_sources': 5, 'min_lag_sources': 1, 'permute_in_time': True } # network inference for individual data sets nw_0 = MultivariateTE() res_0 = nw_0.analyse_network( settings, data, targets=[0, 1], sources='all') pickle.dump(res_0, open(path + 'mute_results_0.p', 'wb')) res_1 = nw_0.analyse_network( settings, data, targets=[1, 2], sources='all') pickle.dump(res_1, open(path + 'mute_results_1.p', 'wb')) res_2 = nw_0.analyse_network( settings, data, targets=[0, 2], sources='all') pickle.dump(res_2, open(path + 'mute_results_2.p', 'wb')) res_3 = nw_0.analyse_network( settings, data, targets=[0, 1, 2], sources='all') pickle.dump(res_3, open(path + 'mute_results_3.p', 'wb')) res_4 = nw_0.analyse_network( settings, data, targets=[1, 2], sources='all') pickle.dump(res_4, open(path + 'mute_results_4.p', 'wb')) res_5 = nw_0.analyse_network(settings, data) pickle.dump(res_5, open(path + 'mute_results_full.p', 'wb')) def generate_discrete_data(n_replications=1): """Generate Gaussian test data: 1 -> 2 -> 3, delay 1.""" d = generate_gauss_data(n_replications=n_replications, discrete=True) data = Data(d, dim_order='psr', normalise=False) return data def generate_continuous_data(n_replications=1): """Generate Gaussian test data: 1 -> 2 -> 3, delay 1.""" d = generate_gauss_data(n_replications=n_replications, discrete=False) data = Data(d, dim_order='psr', normalise=True) return data def generate_gauss_data(n_replications=1, discrete=False): settings = {'discretise_method': 'equal', 'n_discrete_bins': 5} est = JidtDiscreteCMI(settings) covariance_1 = 0.4 covariance_2 = 0.3 n = 10000 delay = 1 if discrete: d = np.zeros((3, n - 2*delay, n_replications), dtype=int) else: d = np.zeros((3, n - 2*delay, n_replications)) for r in range(n_replications): proc_1 = np.random.normal(0, 1, size=n) proc_2 = (covariance_1 * proc_1 + (1 - covariance_1) * np.random.normal(0, 1, size=n)) proc_3 = (covariance_2 * proc_2 + (1 - covariance_2) * np.random.normal(0, 1, size=n)) proc_1 = proc_1[(2*delay):] proc_2 = proc_2[delay:-delay] proc_3 = proc_3[:-(2*delay)] if discrete: # discretise data proc_1_dis, proc_2_dis = est._discretise_vars( var1=proc_1, var2=proc_2) proc_1_dis, proc_3_dis = est._discretise_vars( var1=proc_1, var2=proc_3) d[0, :, r] = proc_1_dis d[1, :, r] = proc_2_dis d[2, :, r] = proc_3_dis else: d[0, :, r] = proc_1 d[1, :, r] = proc_2 d[2, :, r] = proc_3 return d def analyse_discrete_data(): """Run network inference on discrete data.""" data = generate_discrete_data() settings = { 'cmi_estimator': 'JidtDiscreteCMI', 'discretise_method': 'none', 'n_discrete_bins': 5, # alphabet size of the variables analysed 'min_lag_sources': 1, 'max_lag_sources': 3, 'max_lag_target': 1} nw = MultivariateTE() res = nw.analyse_network(settings=settings, data=data) pickle.dump(res, open('{0}discrete_results_mte_{1}.p'.format( path, settings['cmi_estimator']), 'wb')) nw = BivariateTE() res = nw.analyse_network(settings=settings, data=data) pickle.dump(res, open('{0}discrete_results_bte_{1}.p'.format( path, settings['cmi_estimator']), 'wb')) nw = MultivariateMI() res = nw.analyse_network(settings=settings, data=data) pickle.dump(res, open('{0}discrete_results_mmi_{1}.p'.format( path, settings['cmi_estimator']), 'wb')) nw = BivariateMI() res = nw.analyse_network(settings=settings, data=data) pickle.dump(res, open('{0}discrete_results_bmi_{1}.p'.format( path, settings['cmi_estimator']), 'wb')) def analyse_continuous_data(): """Run network inference on continuous data.""" data = generate_continuous_data() settings = { 'min_lag_sources': 1, 'max_lag_sources': 3, 'max_lag_target': 1} nw = MultivariateTE() for estimator in ['JidtGaussianCMI', 'JidtKraskovCMI']: settings['cmi_estimator'] = estimator res = nw.analyse_network(settings=settings, data=data) pickle.dump(res, open('{0}continuous_results_mte_{1}.p'.format( path, estimator), 'wb')) nw = BivariateTE() for estimator in ['JidtGaussianCMI', 'JidtKraskovCMI']: settings['cmi_estimator'] = estimator res = nw.analyse_network(settings=settings, data=data) pickle.dump(res, open('{0}continuous_results_bte_{1}.p'.format( path, estimator), 'wb')) nw = MultivariateMI() for estimator in ['JidtGaussianCMI', 'JidtKraskovCMI']: settings['cmi_estimator'] = estimator res = nw.analyse_network(settings=settings, data=data) pickle.dump(res, open('{0}continuous_results_mmi_{1}.p'.format( path, estimator), 'wb')) nw = BivariateMI() for estimator in ['JidtGaussianCMI', 'JidtKraskovCMI']: settings['cmi_estimator'] = estimator res = nw.analyse_network(settings=settings, data=data) pickle.dump(res, open('{0}continuous_results_bmi_{1}.p'.format( path, estimator), 'wb')) def assert_results(): for algo in ['mmi', 'mte', 'bmi', 'bte']: # Test continuous data: for estimator in ['JidtGaussianCMI', 'JidtKraskovCMI']: res = pickle.load(open( 'data/continuous_results_{0}_{1}.p'.format( algo, estimator), 'rb')) print('\nInference algorithm: {0} (estimator: {1})'.format( algo, estimator)) _print_result(res) # Test discrete data: estimator = 'JidtDiscreteCMI' res = pickle.load(open( 'data/discrete_results_{0}_{1}.p'.format( algo, estimator), 'rb')) print('\nInference algorithm: {0} (estimator: {1})'.format( algo, estimator)) _print_result(res) def _print_result
(res): res.adjacency_matrix.print_matrix() tp = 0
fp = 0 if res.adjacency_matrix._edge_matrix[0, 1] == True: tp += 1 if res.adjacency_matrix._edge_matrix[1, 2] == True: tp += 1 if res.adjacency_matrix._edge_matrix[0, 2] == True: fp += 1 fn = 2 - tp print('TP: {0}, FP: {1}, FN: {2}'.format(tp, fp, fn)) if __name__ == '__main__': analyse_discrete_data() analyse_mute_te_data() analyse_continuous_data() assert_res
rusiv/BSScript
bsscript/bsscriptSblm/Spinner.py
Python
mit
784
0.034392
import sublime from . import SblmCmmnFnctns class Spinner: SYMBOLS_ROW = u'←↑→↓' SYMBOLS_BOX = u'⠋⠙⠹⠸⠼⠴⠦⠧⠇⠏' def __init__(self, symbols, view, startStr, endStr): self.symbols = symbols self.length = len(symbols) self.position = 0 self.stopFlag = False self.view = view self.startStr = startStr self.endStr = endStr def __next__(self): self.position = self
.position + 1 return self.startStr + self.symbols[self.position % self.length] + self.endStr def start(self): if not self.stopFlag: self.view.set_status(SblmCmmnFnctns.SUBLIME_STATUS_SPINNER, self.__next__()) sublime.set_timeout(lambda: self.start(), 300) def stop(self): self.view.erase_status(SblmCmmnFnctns.SUBLIM
E_STATUS_SPINNER) self.stopFlag = True
uliss/quneiform
tests/py/lpod/rst2odt.py
Python
gpl-3.0
22,265
0.00265
#!/usr/bin/env python # -*- coding: UTF-8 -*- # # Copyright (c) 2009 Ars Aperta, Itaapy, Pierlis, Talend. # # Authors: David Versmisse <[email protected]> # # This file is part of Lpod (see: http://lpod-project.org). # Lpod is free software; you can redistribute it and/or modify it under # the terms of either: # # a) the GNU General Public License as published by the Free Software # Foundation, either version 3 of the License, or (at your option) # any later version. # Lpod is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # You should have received a copy of the GNU General Public License # along with Lpod. If not, see <http://www.gnu.org/licenses/>. # # b) the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # http://www.apache.org/licenses/LICENSE-2.0 # # Import from the Standard Library from sys import stdout # Import from docutils from docutils import nodes from docutils.core import publish_doctree # I
mport from imaging from PIL import Image # Import from lpod from document import odf_new_document_from_type from frame import odf_create_image
_frame, odf_create_text_frame from heading import odf_create_heading from link import odf_create_link from list import odf_create_list, odf_create_list_item from note import odf_create_note from paragraph import odf_create_paragraph, odf_create_line_break from paragraph import odf_create_undividable_space from span import odf_create_span from scriptutils import printwarn from style import odf_create_style from table import odf_create_cell, odf_create_table, odf_create_row from table import odf_create_column, odf_create_header_rows from toc import odf_create_toc DPI = 72 def convert_text(node, context): context["top"].append(node.astext()) def convert_section(node, context): # Inc the heading level context["heading-level"] += 1 # Reset the top to body context["top"] = context["body"] # Convert for child in node: convert_node(child, context) # Restore the heading level context["heading-level"] -= 1 def convert_title(node, context): level = context["heading-level"] if level == 0: # The document did not start with a section level = 1 heading = odf_create_heading(level, node.astext(), style='Heading_20_%s' % level) context["body"].append(heading) def convert_paragraph(node, context): # Search for a default style style = context['styles'].get('paragraph') paragraph = odf_create_paragraph(style=style) context["top"].append(paragraph) # Save the current top old_top = context["top"] # Convert context["top"] = paragraph for child in node: convert_node(child, context) # And restore the top context["top"] = old_top def convert_list(node, context, list_type): # Reuse template styles if list_type == "enumerated": style_name = "Numbering_20_1" else: style_name = "List_20_1" odf_list = odf_create_list(style=style_name) context["top"].append(odf_list) # Save the current top old_top = context["top"] for item in node: if item.tagname != "list_item": printwarn("node not supported: %s" % item.tagname) continue # Create a new item odf_item = odf_create_list_item() odf_list.append(odf_item) # A new top context["top"] = odf_item for child in item: convert_node(child, context) # And restore the top context["top"] = old_top def convert_list_enumerated(node, context): return convert_list(node, context, "enumerated") def convert_list_bullet(node, context): return convert_list(node, context, "bullet") def convert_topic(node, context): # Reset the top to body context["top"] = context["body"] # Yet an other TOC ? if context["skip_toc"]: return if context["toc"] is not None: printwarn("a TOC is already inserted") return title = node.next_node(condition=nodes.title).astext() toc = odf_create_toc(title=title) context["body"].append(toc) context["toc"] = toc def convert_footnote(node, context): # XXX ids is a list ?? refid = node.get("ids")[0] # Find the footnote footnotes = context["footnotes"] if refid not in footnotes: printwarn('unknown footnote "%s"' % refid) return footnote_body = footnotes[refid].get_element("text:note-body") # Save the current top old_top = context["top"] # Fill the note context["top"] = footnote_body for child in node: # We skip the label (already added) if child.tagname == "label": continue convert_node(child, context) # And restore the top context["top"] = old_top def convert_footnote_reference(node, context): refid = node.get("refid") citation = node.astext() footnote = odf_create_note(note_id=refid, citation=citation) context["top"].append(footnote) context["footnotes"][refid] = footnote def _convert_style_like(node, context, style_name): # Create the span span = odf_create_span(style=style_name) context["top"].append(span) # Save the current top old_top = context["top"] # Convert context["top"] = span for child in node: convert_node(child, context) # And restore the top context["top"] = old_top def _get_emphasis_style(context): styles = context['styles'] emphasis_style = styles.get('emphasis') if emphasis_style is not None: return emphasis_style emphasis_style = odf_create_style("text", italic=True) context['doc'].insert_style(emphasis_style, automatic=True) styles['emphasis'] = emphasis_style return emphasis_style def convert_emphasis(node, context): emphasis_style = _get_emphasis_style(context).get_style_name() # Convert _convert_style_like(node, context, emphasis_style) def _get_strong_style(context): styles = context['styles'] strong_style = styles.get('strong') if strong_style is not None: return strong_style strong_style = odf_create_style("text", bold=True) context['doc'].insert_style(strong_style, automatic=True) styles['strong'] = strong_style return strong_style def convert_strong(node, context): strong_style = _get_strong_style(context).get_style_name() # Convert _convert_style_like(node, context, strong_style) def convert_literal(node, context): # Convert _convert_style_like(node, context, "Example") def convert_literal_block(node, context): paragraph = odf_create_paragraph(style="Preformatted_20_Text") context["top"].append(paragraph) # Convert for child in node: # Only text if child.tagname != "#text": printwarn('node "%s" not supported in literal block' % ( child.tagname)) continue text = child.astext() tmp = [] spaces = 0 for c in text: if c == '\n': if tmp: tmp = u"".join(tmp) paragraph.append(tmp) tmp = [] spaces = 0 paragraph.append(odf_create_line_break()) elif c == '\r': continue elif c == ' ': spaces += 1 elif c == '\t': # Tab = 4 spaces spaces += 4 else: if spaces >= 2: if tmp: tmp = u"".join(tmp) paragraph.append(tmp) tmp = [] paragraph.append( odf_create_undividable_space(spaces)) spaces = 0 elif spaces == 1:
lk-geimfari/elizabeth
mimesis/data/int/address.py
Python
mit
20,986
0
"""Provides all the generic data related to the address.""" COUNTRY_CODES = { "a2": [ "AD", "AE", "AF", "AG", "AI", "AL", "AM", "AN", "AO", "AQ", "AR", "AS", "AT", "AU", "AW", "AX", "AZ", "BA", "BB", "BD", "BE", "BF", "BG", "BH", "BI", "BJ", "BL", "BM", "BN", "BO", "BR", "BS", "BT", "BV", "BW", "BY", "BZ", "CA", "CC", "CD", "CF", "CG", "CH", "CI", "CK", "CL", "CM", "CN", "CO", "CR", "CU", "CV", "CX", "CY", "CZ", "DE", "DJ", "DK", "DM", "DO", "DZ", "EC", "EE", "EG", "EH", "ER", "ES", "ET", "FI", "FJ", "FK", "FM", "FO", "FR", "GA", "GB", "GD", "GE", "GF", "GG", "GH", "GI", "GL", "GM", "GN", "GP", "GQ", "GR", "GS", "GT", "GU", "GW", "GY", "HK", "HM", "HN", "HR", "HT", "HU", "ID", "IE", "IL", "IM", "IN", "IO", "IQ", "IR", "IS", "IT", "JE", "JM", "JO", "JP", "KE", "KG", "KH", "KI", "KM", "KN", "KP", "KR", "KW", "KY", "KZ", "LA", "LB", "LC", "LI", "LK", "LR", "LS", "LT", "LU", "LV", "LY", "MA", "MC", "MD", "ME", "MF", "MG", "MH", "MK", "ML", "MM", "MN", "MO", "MP", "MQ", "MR", "MS", "MT", "MU", "MV", "MW", "MX", "MY", "MZ", "NA", "NC", "NE", "NF", "NG", "NI", "NL", "NO", "NP", "NR", "NU", "NZ", "OM", "PA", "PE", "PF", "PG", "PH", "PK", "PL", "PM", "PN", "PR", "PS", "PT", "PW", "PY", "QA", "RE", "RO", "RS", "RU", "RW", "SA", "SB", "SC", "SD", "SE", "SG", "SH", "SI", "SJ", "SK", "SL", "SM", "SN", "SO", "SR", "SS", "ST", "SV", "SY", "SZ", "TC", "TD", "TF", "TG", "TH", "TJ", "TK", "TL", "TM", "TN", "TO", "TR", "TT", "TV", "TW", "TZ", "UA", "UG", "UM", "US", "UY", "UZ", "VA", "VC", "VE", "VG", "VI", "VN", "VU", "WF", "WS", "YE", "YT", "ZA", "ZM", "ZW", ], "a3": [ "AND", "ARE", "AFG", "ATG", "AIA", "ALB", "ARM", "ANT", "AGO", "ATA", "ARG", "ASM", "AUT", "AUS", "ABW", "ALA", "AZE", "BIH", "BRB", "BGD", "BEL", "BFA", "BGR", "BHR", "BDI", "BEN", "BLM", "BMU", "BRN", "BOL", "BRA", "BHS", "BTN", "BVT", "BWA", "BLR", "BLZ", "CAN", "CCK", "COD", "CAF", "COG", "CHE", "CIV", "COK", "CHL", "CMR", "CHN", "COL", "CRI", "CUB", "CPV", "CXR", "CYP", "CZE", "DEU", "DJI", "DNK", "DMA", "DOM", "DZA", "ECU", "EST", "EGY", "ESH", "ERI", "ESP", "ETH", "FIN", "FJI", "FLK", "FSM", "FRO", "FRA", "GAB", "GBR", "GRD", "GEO", "GUF", "GGY", "GHA", "GIB", "GRL", "GMB", "GIN", "GLP", "GNQ", "GRC", "SGS", "GTM", "GUM", "GNB", "GUY", "HKG", "HMD", "HND", "HRV", "HTI", "HUN", "IDN", "IRL", "ISR", "IMN", "IND", "IOT", "IRQ", "IRN", "ISL", "ITA", "JEY", "JAM", "JOR", "JPN", "KEN", "KGZ", "KHM", "KIR", "COM", "KNA", "PRK", "KOR", "KWT", "CYM", "KAZ", "LAO", "LBN", "LCA", "LIE", "LKA", "LBR", "LSO", "LTU", "LUX", "LVA", "LBY", "MAR", "MCO", "MDA", "MNE", "MAF", "MDG", "MHL", "MKD", "MLI", "MMR", "MNG", "MAC", "MNP", "MTQ", "MRT", "MSR", "MLT", "MUS", "MDV", "MWI", "MEX", "MYS", "MOZ", "NAM", "NCL", "NER", "NFK", "NGA", "NIC", "NLD", "NOR", "NPL", "NRU", "NIU", "NZL", "OMN", "PAN", "PER", "PYF", "PNG", "PHL", "PAK", "POL", "SPM", "PCN", "PRI", "PSE", "PRT", "PLW", "PRY", "QAT", "REU", "ROU", "SRB", "RUS", "RWA", "SAU", "SLB", "SYC", "SDN", "SWE", "SGP", "SHN", "SVN", "SJM", "SVK", "SLE", "SMR", "SEN", "SOM", "SUR", "SSD", "STP", "SLV", "SYR", "SWZ", "TCA", "TCD", "ATF", "TGO", "THA", "TJK", "TKL", "TLS", "TKM", "TUN", "TON", "TUR", "TTO", "TUV", "TWN", "TZA", "UKR", "UGA", "UMI", "USA", "URY", "UZB", "VAT", "VCT", "VEN", "VGB", "VIR", "VNM", "VUT", "WLF", "WSM", "YEM", "MYT", "ZAF", "ZMB", "ZWE", ], "fifa": [ "AFG", "AIA", "ALB", "ALG", "AND", "ANG", "ARG", "ARM", "ARU", "ARU", "ASA", "ATG", "AUT", "AZE", "BAH", "BAN",
"BDI", "BEL", "BEN", "BER", "BFA", "BHR", "BHU", "BIH", "BLR", "BLZ", "BOE", "BOL", "BOT", "BRA", "BRB", "BRU", "BUL", "CAM", "CAN", "CAY", "CGO", "CHA", "CHI", "CHN", "CIV", "CMR", "COD", "COK", "COL", "COM", "CPV", "CRC", "CRO", "CTA"
, "CUB", "CUW", "CYP", "CZE", "DEN", "DJI", "DMA", "DOM", "ECU",
a358003542/python-guide-book
codes/ch12/asyncio_get_poetry2.py
Python
gpl-2.0
1,899
0
#!/usr/bin/env python3 # -*- coding: utf-8 -*- import datetime import argparse import asyncio def parse_args(): usage = """usage: %prog [options] [hostname]:port ... python3 select_get_poetry3.py port1 port2 port3 ... """ parser = argparse.ArgumentParser(usage) parser.add_argument('port', nargs='+') args = vars(parser.parse_args()) addresses = args['port'] if not addresses: print(parser.format_help()) parser.exit() def parse_address(addr): if ':' not in addr: host = '127.0.0.1' port = addr else: host, port = addr.split(':', 1) if not port.isdigit(): parser.error('Ports must be integers.') return host, int(port) return map(parse_address, addresses) class PoetryClientProtocol(asyncio.Protocol): def __init__(self, infile): self.infile = infile def connection_made(self, transport): print(transport.get_extra_info('peername')) self.transport = tra
nsport self.transport.write(b'poems') def data_received(self, data): if data: print(data) print('writing to {}'.format(self.infile.name)) self.infile.write(data) self.tr
ansport.write(b'poems') def eof_received(self): print('end of writing') self.infile.close() def main(): addresses = parse_args() eventloop = asyncio.get_event_loop() for address in addresses: host, port = address filename = str(port) + '.txt' infile = open(filename, 'wb') coro = eventloop.create_connection( lambda: PoetryClientProtocol(infile), host, port) t, p = eventloop.run_until_complete(coro) print(t, p) try: eventloop.run_forever() finally: eventloop.close() if __name__ == '__main__': main()
samcoveney/GP_emu_UQSA
gp_emu_uqsa/design_inputs/__init__.py
Python
gpl-3.0
29
0
from
.design_inputs import *
dhermes/project-euler
python/complete/no121.py
Python
apache-2.0
2,079
0.000481
#!/usr/bin/env python # A bag contains one red disc and one blue disc. In a game of chance a player # takes a disc at random and its colour is noted. After each turn the disc is # returned to the bag, an extra red disc is added, and another disc is # taken at random. # The player... wins if they have taken more blue discs than red discs a # the end of the game. # ------------------------------------------------------------------------ # P_n = prob(disc n is blue) = 1/(n + 1) # For n discs, let C_1-C_2-...-C_n be the colors drawn, let i_1,...,i_k be the # indices j such that disk i_j was drawn red. The probability of this event # is (i_1 * ... * i_k)/factorial(n + 1) # We can enumeratively define n_{j,k} to be the aggregate numerator # of all possible draws with j blues drawn out of k draws # # The initial conditions are n_{0,1} = 1, n_{1,1} = 1 # The recurrence is defined by the fact that the n_{j + 1,k + 1} is # can only have the (k + 1)'st element be blue or red, hence # n_{j + 1,k + 1} = numer(blue)*n_{j,k} + numer(red)*n_{j + 1,k} # = n_{j,k} + (k + 1)*n_{j + 1,k} # except for the cases j = k, where n_{j,k} = numer(all blue) = 1 # except for the cases j = 0, where n_{0,k} = k! from math import factorial from python.decorators import euler_timer def iterative_numerator(n): numerators = {} for k in range(1, n + 1): for j in range(k + 1): if j == 0: numerators[(j, k)] = factorial(k) elif j == k: numerators[(j, k)] = 1 else: numerators[(j, k)] = (numerators[(j - 1, k - 1)] + k * numerators[(j, k - 1)]) min_blue = (n / 2) + 1 count = 0 for blue in range(
min_blue, n + 1): count += numerators[(blue, n)] return count def max_payout(n): # Integer division precludes floor operation return factorial(n + 1) / iterative_numerator(n) def main(verbose=False): return max_pay
out(15) if __name__ == '__main__': print euler_timer(121)(main)(verbose=True)
CompassionCH/compassion-modules
message_center_compassion/tests/test_onramp_controller.py
Python
agpl-3.0
2,068
0.000484
############################################################################## # # Copyright (C) 2018 Compassion CH (http://www.compassion.ch) # Releasing children from poverty in Jesus' name # @author: Nicolas Bornand # # The licence is in the file __manifest__.py # ############################################################################## from mock import patch from .onramp_base_test import TestOnramp mock_oauth = ( "odoo.addons.message_center_compassion.models.ir_http.IrHTTP._oauth_validation" ) class TestOnRampController(TestOnramp): def setUp(self): super().setUp() def test_no_token(self): """ Check we have an access denie
d if token is not provided """ del self.opener.headers["Authorization"] response = self._send_post({"nothing": "nothing"}) self.assertEqual(response.status_code, 401) error = response.json() self.assertEqual(error["ErrorMethod"], "ValidateToken") def test_bad_token(self): """ Check we have an acc
ess denied if token is not valid """ self.opener.headers["Authorization"] = "Bearer notrealtoken" response = self._send_post({"nothing": "nothing"}) self.assertEqual(response.status_code, 401) @patch(mock_oauth) def test_wrong_client_id(self, oauth_patch): """ Check that if we get a token with unrecognized client_id, access is denied. """ oauth_patch.return_value = "wrong_user" response = self._send_post({"nothing": "nothing"}) self.assertEqual(response.status_code, 401) @patch(mock_oauth) def test_good_client_id(self, oauth_patch): """ Check that if we connect with admin as client_id, access is granted. """ oauth_patch.return_value = "admin" response = self._send_post({"nothing": "nothing"}) json_result = response.json() self.assertEqual(response.status_code, 200) self.assertEqual( json_result["Message"], "Unknown message type - not processed." )
CNS-OIST/STEPS_Example
publication_models/API_2/Chen_FNeuroinf_2014/AD/AD_single.py
Python
gpl-2.0
2,125
0.004706
######################################################################## # # # Anomalous Diffusion # # # ######################################################################## import steps.interface ######################################################################## # Create Model from steps.model import * from steps.geom import * from steps.rng import * from steps.sim import * from steps.saving import * from steps.visual import * import time mdl = Model() r = ReactionManager() with mdl: X = Species.Create() vsys = VolumeSystem.Create() with vsys: dif_X = Diffusion.Create(X, 2e-09) ######################################################################## # Create Gemoetry tetmesh = TetMesh.LoadAbaqus('2_20_0.7.inp', scale=1e-06, ebs=None, shadow_mesh="2_20_0.7_conf") ######################################################################## # Create Random number generator rng = RNG('mt19937', 512, int(time.time()%4294967295)) ######################################################################## # Initialize simulation sim = Simulation('Tetexact', mdl, tetmesh, rng) sim.injection.X.Count = 2000 ######################################################################## # Visualization rs = ResultSelector(sim) # Create control sc = SimControl(end_time = 1.0, upd_interval = 0.00001) with sc: with SimDisplay('Show Spine Species'): # Static mesh element ElementDisplay(rs.dend, color=[0, 0, 1, 0.2]) # Dynamic element ElementDisplay(rs.LIST('dend'
, 'shaft').X, color=[1.0, 0.0, 0.
0, 1.0], spec_size=0.1) with SimDisplay('Hide Spine Species'): ElementDisplay(rs.dend, color=[0, 0, 1, 0.2]) ElementDisplay(rs.shaft.X, color=[1.0, 0.0, 0.0, 1.0], spec_size=0.1) with PlotDisplay('Plots'): SpatialPlot(rs.TETS(tetmesh.shaft.tets).X.Count, axis=[0, 0, 1], nbins=100) # Enter visualization loop sc.run()
Poom1997/GMan
sendMessageForm.py
Python
mit
2,434
0.012736
from PySide.QtCore import * from PySide.QtGui import * from PySide.QtUiTools import * import plugin.databaseConnect as database from datetime import datetime class sendMessageUI(QMainWindow): def __init__(self, id = None, bulk = None, parent = None): QMainWindow.__init__(self,None) self.setMinimumSize(626,380) self.setWindowTitle("Message") self.parent = parent self.id = id self.bulk = bulk self.UIinit() def UIinit(self): loader = QUiLoader() form = loader.load("resources/UI/sendMessage.ui",None) self.setCentralWidget(form) #QPushButton self.send_button = form.findChild(QPushButton,"sendButton") self.close_button = form.findChild(QPushButton,"closeButton") #LineEdit self.to_user = form.findChild(QLineEdit,"to") self.message = form.findChild(QTextEdit,"message") #Connect self.send_button.clicked.connect(self.sendMes) self.close_button.clicked.connect(self.closeWindow) if(self.id != None): self.to_user.setText(self.id) def closeWindow(self): self.close() ##Create message and send it to other user## def sendMes(self): db = database.databaseMessage() toUser = self.to_user.text() message = self.message.toPlainText() time = datetime.now() if(self.bulk == None): data = self.parent.getCurrentUser() fromUser = data.getID() if(db.sendMessage(toUser, fromUser, message, time)): db.disconnect()
self.parent.showOK("Message Sent", "The message has been sent to the user!") self.closeWindow() else: self.parent.showERROR("UserID Not Found", "The UserID you entered does not exists.") else: data = self.parent.parent.getCurrentUser() fromUser = data.getID() val = 0 for
id in self.bulk: val = db.sendMessage(id, fromUser, message, time) if (val): db.disconnect() self.parent.parentshowOK("All Message Sent to user.", "The message has been sent to all user!") self.closeWindow() else: self.parent.parent.showERROR("ERROR!", "Some Messages are not delivered.")
wiltonlazary/arangodb
3rdParty/iresearch/external/text/scripts/generate_unicode_break_tests.py
Python
apache-2.0
22,214
0.002206
#!/usr/bin/env python # -*- coding: utf-8 -*- # Copyright (C) 2020 T. Zachary Laine # # Distributed under the Boost Software License, Version 1.0. (See # accompanying file LICENSE_1_0.txt or copy at # http://www.boost.org/LICENSE_1_0.txt) prop_lookup_test_form = decls = '''\ // Copyright (C) 2020 T. Zachary Laine // // Distributed under the Boost Software License, Version 1.0. (See // accompanying file LICENSE_1_0.txt or copy at // http://www.boost.org/LICENSE_1_0.txt) // Warning! This file is autogenerated. #include <boost/text/{0}_break.hpp> #include <gtest/gtest.h> TEST({0}, prop_lookups_{2}) {{{1} }} ''' prop_lookup_perf_test_form = decls = '''\ // Copyright (C) 2020 T. Zachary Laine // // Distributed under the Boost Software License, Version 1.0. (See // accompanying file LICENSE_1_0.txt or copy at // http://www.boost.org/LICENSE_1_0.txt) // Warning! This file is autogenerated. #include <boost/text/{0}_break.hpp> #include <benchmark/benchmark.h> #include <iostream> void BM_{0}_prop(benchmark::State & state) {{ while (state.KeepRunning()) {{ {1} }} std::cout << "Divide result by {2} to get mean time.\\n"; }} BENCHMARK(BM_{0}_prop); BENCHMARK_MAIN() ''' break_test_form = decls = '''\ // Copyright (C) 2020 T. Zachary Laine // // Distributed under the Boost Software License, Version 1.0. (See // accompanying file LICENSE_1_0.txt or copy at // http://www.boost.org/LICENSE_1_0.txt) // Warning! This file is autogenerated. #include <boost/text/{0}_break.hpp> #include <gtest/gtest.h> #include <algorithm> TEST({0}, breaks_{2}) {{{1} }} ''' grapheme_iterator_test_form = decls = '''\ // Copyright (C) 2020 T. Zachary Laine // // Distributed under the Boost Software License, Version 1.0. (See // accompanying file LICENSE_1_0.txt or copy at // http://www.boost.org/LICENSE_1_0.txt) // Warning! This file is autogenerated. #include <boost/text/grapheme_iterator.hpp> #include <boost/text/transcode_iterator.hpp> #include <gtest/gtest.h> #include <algorithm> {0} ''' bidi_test_file_form = decls = '''\ // Copyright (C) 2020 T. Zachary Laine // // Distributed under the Boost Software License, Version 1.0. (See // accompanying file LICENSE_1_0.txt or copy at // http://www.boost.org/LICENSE_1_0.txt) // Warning! This file is autogenerated. #include <boost/text/bidirectional.hpp> #include "bidi_tests.hpp" #include <gtest/gtest.h> #include <algorithm> std::vector<int> expected_levels; std::vector<int> expected_reordered_indices; TEST(bidi, bidi_{1:03}_000) {{ {0} }} ''' bidi_test_form = ''' {{ // {0} ('{5}') (line {3}) std::vector<uint32_t> const cps = {{ {1} }}; std::vector<int> const levels = bidi_levels(cps.begin(), cps.end(), {4}); int i = 0; for (int l : expected_levels) {{ if (0 <= l) {{ EXPECT_EQ(levels[i], l) << "i=" << i; ++i; }} }} EXPECT_EQ((int)levels.size(), i); std::vector<int> const reordered = bidi_reordered_indices(cps.begin(), cps.end(), {4}); i = 0; for (int idx : expected_reordered_indices) {{ // Skip FSI, LRI, RLI, and PDI. if (cps[idx] < 0x2066 || 0x2069 < cps[idx]) {{ EXPECT_EQ(reordered[i], (int)cps[idx]) << std::hex << " 0x" << reordered[i] << " 0x" << cps[idx] << std::dec << " i=" << i; }} ++i; }} std::vector<int> reordered_2; for (auto subrange : boost::text::bidirectional_subranges(cps, {4})) {{ for (auto cp : subrange) {{ reordered_2.push_back(cp); }} }} i = 0; for (int idx : expected_reordered_indices) {{ if (cps[idx] < 0x2066 || 0x2069 < cps[idx]) {{ EXPECT_EQ(reordered_2[i], (int)cps[idx]) << std::hex << " 0x" << reordered_2[i] << " 0x" << cps[idx] << std::dec << " i=" << i; }} ++i; }} EXPECT_EQ(i, (int)reordered_2.size()); }} ''' bidi_character_test_file_form = decls = '''\ // Copyright (C) 2020 T. Zachary Laine // // Distributed under the Boost Software License, Version 1.0. (See // accompanying file LICENSE_1_0.txt or copy at // http://www.boost.org/LICENSE_1_0.txt) // Warning! This file is autogenerated. #include <boost/text/bidirectional.hpp> #include "bidi_test
s.hpp" #include <gtest/gtest.h> #include <algorithm> TEST(bidi_character, bidi_character_{1:03}_000) {{ {0} }} ''' bidi_character_test_form = ''' {{ // line {4} std::vector<uint32_t> cons
t cps = {{ {0} }}; std::vector<int> const expected_levels = {{ {2} }}; std::vector<int> const levels = bidi_levels(cps.begin(), cps.end(), {1}); int i = 0; for (int l : expected_levels) {{ if (0 <= l) {{ EXPECT_EQ(levels[i], l) << "i=" << i; ++i; }} }} EXPECT_EQ((int)levels.size(), i); std::vector<uint32_t> const expected_reordered_indices = {{ {3} }}; std::vector<int> const reordered = bidi_reordered_indices(cps.begin(), cps.end(), {1}); i = 0; for (int idx : expected_reordered_indices) {{ EXPECT_EQ(reordered[i], (int)cps[idx]) << std::hex << " 0x" << reordered[i] << " 0x" << cps[idx] << std::dec << " i=" << i; ++i; }} }} ''' def extract_cps_and_breaks(filename, batch_size = 50): current_batch = [] retval = [] lines = open(filename, 'r').readlines() num_lines = 0 for line in lines: if num_lines == batch_size: retval.append(current_batch) current_batch = [] num_lines = 0 line = line[:-1] if not line.startswith('#') and len(line) != 0: comment_start = line.find('#') comment = '' if comment_start != -1: comment = line[comment_start + 1:].strip() line = line[:comment_start] fields = line.split(' ')[1:-1] cps = [] active_break = True for i in range(len(fields)): f = fields[i] if f[0] in '0123456789ABCDEF': cps.append((f, active_break)) else: active_break = f == '÷' current_batch.append((cps, line, comment)) num_lines += 1 if len(current_batch): retval.append(current_batch) return retval def generate_prop_lookup_tests(cps_and_breaks, prop_, prop_names): for i in range(len(cps_and_breaks)): prop_lookup_tests = '' chunk = cps_and_breaks[i] for elem in chunk: (cps, line, comment) = elem comment_fields = comment.split(' ') j = 0 for f in comment_fields: if f.startswith('(') and f.endswith(')'): prop_lookup_tests += \ '\n EXPECT_EQ(boost::text::{0}_prop(0x{1}), {2});'.format( prop_, cps[j][0], prop_names[f[1:-1]] ) j += 1 cpp_file = open('{}_prop_lookup_{:02}.cpp'.format(prop_, i), 'w') cpp_file.write(prop_lookup_test_form.format(prop_, prop_lookup_tests, i)) def generate_prop_lookup_perf_tests(cps_and_breaks, prop_): prop_lookup_perf_tests = '' lines = 0 for i in range(len(cps_and_breaks)): chunk = cps_and_breaks[i] for elem in chunk: (cps, line, comment) = elem comment_fields = comment.split(' ') j = 0 for f in comment_fields: if f.startswith('(') and f.endswith(')'): prop_lookup_perf_tests += \ ' benchmark::DoNotOptimize(boost::text::{0}_prop(0x{1}));\n'.format(
linzhaolover/myansible
openstackfile/getgpulocked.py
Python
apache-2.0
696
0.027299
#!/usr/bin/env python path="/var/lib/gpu/gpu_locked.txt" import os,sys import ast import socket def getHost(): return socket.gethostname() def getlocked(): hostname=getHost() #print path fp=open(path, "r") info=fp.read() #print info d=ast.literal_eval(info) #print len(d) print "%s,nvidia0,%d" % (hostname, (9999 - d['nvidia0']['available_count'])) print "
%s,nvidia1,%d" % (hostname, (9999 - d['nvidia1']['available_count'])) print "%s,nvidia2,%d" % (hostname, (9999 - d['nvidia2']['available_count'])) print "%s,nvidia3,%d" % (hostname, (9999 - d['nvidia3']['available_count'])) fp.cl
ose() if __name__ == "__main__": getlocked()
AnsonShie/system_monitor
messages_monitor.py
Python
apache-2.0
2,645
0.003403
#!/usr/bin/python __author__ = 'anson' import optparse import re import sys from utils.utils_cmd import execute_sys_cmd from lib_monitor.monitor_default_format import nagios_state_to_id class messages_check(): def __init__(self, rex, config, type): self.rex = rex self.config = config self.type = type def run(self): result, infos = execute_sys_cmd('/usr/local/nagios/libexec/check_logfiles -f ' + self.config) v_protocol = None exit_state = 3 if len(infos) > 0: state = infos[0].split()[0] if state not in nagios_state_to_id.keys(): print infos sys.exit(exit_state) exit_state = nagios_state_to_id[state] if nagios_state_to_id[state] > 0: m_protocol = re.search(r'\(\d+ errors in ([^ ]+)\)', infos[0]) v_protocol = m_protocol.group(1) if m_protocol else None else: sys.exit(exit_state) if v_protocol is not None: rex_dict = [] with open(self.rex, buffering=
2000000) as rex_all: for rex_split in rex_all: rex_dict.append(rex_split) with open('/tmp/' + v_protocol, buffering=2000000) as file_to_check: for pa
rt in file_to_check: for rex_rule in rex_dict: m_iface = re.search(rex_rule, part) v_dev = m_iface.group(1) if m_iface else 'none' print v_dev sys.exit(exit_state) def main(): """ messages_monitor.py unit test example python messages_monitor.py """ parser = optparse.OptionParser( usage="%prog [options] [--parameter]", description="To monitor system log file." ) parser.add_option("--config", dest="config", help="Config file for error extraction", type="string", default="/usr/local/nagios/libexec/check_log.log" ) parser.add_option("--type", dest="type", help="Event type", type="string", default="disk" ) parser.add_option("--rex", dest="rex", help="Regular Expression", type="string", default="/usr/local/nagios/libexec/rule.conf" ) (options, args) = parser.parse_args() check = messages_check(options.rex, options.config, options.type) check.run() if __name__ == '__main__': main()
C2SM-RCM/testsuite
tools/comp_table.py
Python
mit
5,041
0.026384
#!/usr/bin/env python2 """ COSMO TECHNICAL TESTSUITE General purpose script to compare two files containing tables Only lines with given table pattern are considered """ # built-in modules import os, sys, string # information __author__ = "Xavier Lapillonne" __maintainer__ = "[email protected]" def cmp_table(file1,file2,colpattern,minval,threshold,verbose=1,maxcompline=-1): # General purpose script to compare two files containing tables # Only lines with given table column pattern. Column to be compared are marked with c # column to discard with x #init ncomp=0 nerror=0 lerror=False epsilon=1e-16 #used to avoid division by zero in case minval is zero # check file existence if not(os.path.exists(file1)): print('File %s does not exist' %(file1)) return -1 elif not(os.path.exists(file2)): print('File %s does not exist' %(file2)) print('File '+file2+' does not exist') return -1 # convert input colpattern=[x=='c' for x in list(colpattern)] threshold=float(threshold) minval=float(minval) # open file data1=open(file1).readlines() data2=open(file2).readlines() # get max record nd1=len(data1) nd2=len(data2) # check that files are not empty if nd1==0: print('file %s is empty!' %(file1)) return -1 if nd2==0: print('file %s is empty!' %(file2)) return -1 if nd1!=nd2 and verb
ose>1: print('Warning: %s and %s have different size, comparing commun set only \n' %(file1,file2)) ncdata=min(nd1,nd2) if (maxcompline>0): ncdata=min(ncdata,maxcomp
line) # Iterates through the lines for il in range(ncdata): l1=data1[il].split() l2=data2[il].split() l1match=matchColPattern(l1,colpattern) l2match=matchColPattern(l2,colpattern) # compare values if both lines are compatible if l1match and l2match: for ic in range(len(colpattern)): if colpattern[ic]: v1=float(l1[ic]) v2=float(l2[ic]) val_abs_max=max(abs(v1),abs(v2)) if val_abs_max > minval: ncomp+=1 diff=abs(v1-v2)/(val_abs_max+epsilon) if diff>threshold: nerror+=1 # Print error if verbose>1: print('Error %2.2e above %2.2e thresold at line %i, col %i' %(diff,threshold,il+1,ic+1)) print('> %s' %(file1)) print(data1[il]) print('< %s' %(file2)) print(data2[il]) #save line for first error if not lerror: differ=diff linerr=il+1 colerr=ic+1 linerr1=data1[il] linerr2=data2[il] lerror=True if ncomp==0: print('Warning :no line to compare') nerror=-2 if lerror and verbose>0: print('Compared values: %i, errors above threshold: %i ; %i %% ' %(ncomp,nerror,nerror*100./ncomp)) if verbose==1: print('First error %2.2e above %2.2e thresold at line %i, col %i' %(differ,threshold,linerr,colerr)) print('> %s' %(file1)) print(linerr1) print('< %s' %(file2)) print(linerr2) return nerror #---------------------------------------------------------------------------- # Local functions def matchColPattern(line,colpattern): if len(line)!=len(colpattern): return False try: for i in range(len(colpattern)): if colpattern[i]: f=float(line[i]) except ValueError: return False return True #----------------------------------- #execute as a script if __name__ == "__main__": if len(sys.argv)==6: cmp_table(sys.argv[1],sys.argv[2],sys.argv[3],sys.argv[4], \ sys.argv[5]) elif len(sys.argv)==7: cmp_table(sys.argv[1],sys.argv[2],sys.argv[3],sys.argv[4], \ sys.argv[5],sys.argv[6]) elif len(sys.argv)==8: cmp_table(sys.argv[1],sys.argv[2],sys.argv[3],sys.argv[4], \ sys.argv[5],sys.argv[6],sys.argv[7]) else: print('''USAGE : ./comp_table file1 file2 colpattern minval threshold [verbose maxcompline] General purpose script to compare two files containing tables Only lines with given table column pattern. Column to be compared must be numbers are marked with c column to discard with x colpattern c for compare or x for ignore, ex: xccx discard first and last column of a 4 column table ''')
neilLasrado/erpnext
erpnext/accounts/doctype/sales_invoice/pos.py
Python
gpl-3.0
21,154
0.02496
# Copyright (c) 2015, Frappe Technologies Pvt. Ltd. and Contributors # License: GNU General Public License v3. See license.txt from __future__ import unicode_literals import json import frappe from erpnext.accounts.party import get_party_account_currency from erpnext.controllers.accounts_controller import get_taxes_and_charges from erpnext.setup.utils import get_exchange_rate from erpnext.stock.get_item_details import get_pos_profile from frappe import _ from frappe.core.doctype.communication.email import make from frappe.utils import nowdate, cint from six import string_types, iteritems @frappe.whitelist() def get_pos_data(): doc = frappe.new_doc('Sales Invoice') doc.is_pos = 1 pos_profile = get_pos_profile(doc.company) or {} if not pos_profile: frappe.throw(_("POS Profile is required to use Point-of-Sale")) if not doc.company: doc.company = pos_profile.get('company') doc.update_stock = pos_profile.get('update_stock') if pos_profile.get('name'): pos_profile = frappe.get_doc('POS Profile', pos_profile.get('name')) pos_profile.validate() company_data = get_company_data(doc.company) update_pos_profile_data(doc, pos_profile, company_data) update_multi_mode_option(doc, pos_profile) default_print_format = pos_profile.get('print_format') or "Point of Sale" print_template = frappe.db.get_value('Print Format', default_print_format, 'html') items_list = get_items_list(pos_profile, doc.company) customers = ge
t_custo
mers_list(pos_profile) doc.plc_conversion_rate = update_plc_conversion_rate(doc, pos_profile) return { 'doc': doc, 'default_customer': pos_profile.get('customer'), 'items': items_list, 'item_groups': get_item_groups(pos_profile), 'customers': customers, 'address': get_customers_address(customers), 'contacts': get_contacts(customers), 'serial_no_data': get_serial_no_data(pos_profile, doc.company), 'batch_no_data': get_batch_no_data(), 'barcode_data': get_barcode_data(items_list), 'tax_data': get_item_tax_data(), 'price_list_data': get_price_list_data(doc.selling_price_list, doc.plc_conversion_rate), 'customer_wise_price_list': get_customer_wise_price_list(), 'bin_data': get_bin_data(pos_profile), 'pricing_rules': get_pricing_rule_data(doc), 'print_template': print_template, 'pos_profile': pos_profile, 'meta': get_meta() } def update_plc_conversion_rate(doc, pos_profile): conversion_rate = 1.0 price_list_currency = frappe.get_cached_value("Price List", doc.selling_price_list, "currency") if pos_profile.get("currency") != price_list_currency: conversion_rate = get_exchange_rate(price_list_currency, pos_profile.get("currency"), nowdate(), args="for_selling") or 1.0 return conversion_rate def get_meta(): doctype_meta = { 'customer': frappe.get_meta('Customer'), 'invoice': frappe.get_meta('Sales Invoice') } for row in frappe.get_all('DocField', fields=['fieldname', 'options'], filters={'parent': 'Sales Invoice', 'fieldtype': 'Table'}): doctype_meta[row.fieldname] = frappe.get_meta(row.options) return doctype_meta def get_company_data(company): return frappe.get_all('Company', fields=["*"], filters={'name': company})[0] def update_pos_profile_data(doc, pos_profile, company_data): doc.campaign = pos_profile.get('campaign') if pos_profile and not pos_profile.get('country'): pos_profile.country = company_data.country doc.write_off_account = pos_profile.get('write_off_account') or \ company_data.write_off_account doc.change_amount_account = pos_profile.get('change_amount_account') or \ company_data.default_cash_account doc.taxes_and_charges = pos_profile.get('taxes_and_charges') if doc.taxes_and_charges: update_tax_table(doc) doc.currency = pos_profile.get('currency') or company_data.default_currency doc.conversion_rate = 1.0 if doc.currency != company_data.default_currency: doc.conversion_rate = get_exchange_rate(doc.currency, company_data.default_currency, doc.posting_date, args="for_selling") doc.selling_price_list = pos_profile.get('selling_price_list') or \ frappe.db.get_value('Selling Settings', None, 'selling_price_list') doc.naming_series = pos_profile.get('naming_series') or 'SINV-' doc.letter_head = pos_profile.get('letter_head') or company_data.default_letter_head doc.ignore_pricing_rule = pos_profile.get('ignore_pricing_rule') or 0 doc.apply_discount_on = pos_profile.get('apply_discount_on') or 'Grand Total' doc.customer_group = pos_profile.get('customer_group') or get_root('Customer Group') doc.territory = pos_profile.get('territory') or get_root('Territory') doc.terms = frappe.db.get_value('Terms and Conditions', pos_profile.get('tc_name'), 'terms') or doc.terms or '' doc.offline_pos_name = '' def get_root(table): root = frappe.db.sql(""" select name from `tab%(table)s` having min(lft)""" % {'table': table}, as_dict=1) return root[0].name def update_multi_mode_option(doc, pos_profile): from frappe.model import default_fields if not pos_profile or not pos_profile.get('payments'): for payment in get_mode_of_payment(doc): payments = doc.append('payments', {}) payments.mode_of_payment = payment.parent payments.account = payment.default_account payments.type = payment.type return for payment_mode in pos_profile.payments: payment_mode = payment_mode.as_dict() for fieldname in default_fields: if fieldname in payment_mode: del payment_mode[fieldname] doc.append('payments', payment_mode) def get_mode_of_payment(doc): return frappe.db.sql(""" select mpa.default_account, mpa.parent, mp.type as type from `tabMode of Payment Account` mpa,`tabMode of Payment` mp where mpa.parent = mp.name and mpa.company = %(company)s and mp.enabled = 1""", {'company': doc.company}, as_dict=1) def update_tax_table(doc): taxes = get_taxes_and_charges('Sales Taxes and Charges Template', doc.taxes_and_charges) for tax in taxes: doc.append('taxes', tax) def get_items_list(pos_profile, company): cond = "" args_list = [] if pos_profile.get('item_groups'): # Get items based on the item groups defined in the POS profile for d in pos_profile.get('item_groups'): args_list.extend([d.name for d in get_child_nodes('Item Group', d.item_group)]) if args_list: cond = "and i.item_group in (%s)" % (', '.join(['%s'] * len(args_list))) return frappe.db.sql(""" select i.name, i.item_code, i.item_name, i.description, i.item_group, i.has_batch_no, i.has_serial_no, i.is_stock_item, i.brand, i.stock_uom, i.image, id.expense_account, id.selling_cost_center, id.default_warehouse, i.sales_uom, c.conversion_factor, it.item_tax_template, it.valid_from from `tabItem` i left join `tabItem Default` id on id.parent = i.name and id.company = %s left join `tabItem Tax` it on it.parent = i.name left join `tabUOM Conversion Detail` c on i.name = c.parent and i.sales_uom = c.uom where i.disabled = 0 and i.has_variants = 0 and i.is_sales_item = 1 {cond} group by i.item_code """.format(cond=cond), tuple([company] + args_list), as_dict=1) def get_item_groups(pos_profile): item_group_dict = {} item_groups = frappe.db.sql("""Select name, lft, rgt from `tabItem Group` order by lft""", as_dict=1) for data in item_groups: item_group_dict[data.name] = [data.lft, data.rgt] return item_group_dict def get_customers_list(pos_profile={}): cond = "1=1" customer_groups = [] if pos_profile.get('customer_groups'): # Get customers based on the customer groups defined in the POS profile for d in pos_profile.get('customer_groups'): customer_groups.extend([d.get('name') for d in get_child_nodes('Customer Group', d.get('customer_group'))]) cond = "customer_group in (%s)" % (', '.join(['%s'] * len(customer_groups))) return frappe.db.sql(""" select name, customer_name, customer_group, territory, customer_pos_id from tabCustomer where disabled = 0 and {cond}""".format(cond=cond), tuple(customer_groups), as_dict=1) or {} def get_customers_address(customers): customer_address = {} if isinstance(customers, string_types): customers = [frappe._dict({'name': customers})] for data in customers: address = frappe.db.sql(
JetChars/vim
vim/bundle/python-mode/pymode/autopep8.py
Python
apache-2.0
120,700
0.000033
#!/usr/bin/env python # Copyright (C) 2010-2011 Hideo Hattori # Copyright (C) 2011-2013 Hideo Hattori, Steven Myint # Copyright (C) 2013-2015 Hideo Hattori, Steven Myint, Bill Wendling # # Permission is hereby granted, free of charge, to any person obtaining # a copy of this software and associated documentation files (the # "Software"), to deal in the Software without restriction, including # without limitation the rights to use, copy, modify, merge, publish, # distribute, sublicense, and/or sell copies of the Software, and to # permit persons to whom the Software is furnished to do so, subject to # the following conditions: # # The above copyright notice and this permission notice shall be # included in all copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, # EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF # MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND # NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS # BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN # ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN # CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE # SOFTWARE. """Automatically formats Python code to conform to the PEP 8 style guide. Fixes that only need be done once can be added by adding a function of the form "fix_<code>(source)" to this module. They should return the fixed source code. These fixes are picked up by apply_global_fixes(). Fixes that depend on pep8 should be added as methods to FixPEP8. See the class documentation for more information. """ from __future__ import absolute_import from __future__ import division from __future__ import print_function from __future__ import unicode_literals import codecs import collections import copy import difflib import fnmatch import inspect import io import keyword import locale import os import re import signal import sys import textwrap import token import tokenize import pep8 try: unicode except NameError: unicode = str __version__ = '1.2.1a0' CR = '\r' LF = '\n' CRLF = '\r\n' PYTHON_SHEBANG_REGEX = re.compile(r'^#!.*\bpython[23]?\b\s*$') # For generating line shortening candidates. SHORTEN_OPERATOR_GROUPS = frozenset([ frozenset([',']), frozenset(['%']), frozenset([',', '(', '[', '{']), frozenset(['%', '(', '[', '{']), frozenset([',', '(', '[', '{', '%', '+', '-', '*', '/', '//']), frozenset(['%', '+', '-', '*', '/', '//']), ]) DEFAULT_IGNORE = 'E24' DEFAULT_INDENT_SIZE = 4 # W602 is handled separately due to the need to avoid "with_traceback". CODE_TO_2TO3 = { 'E231': ['ws_comma'], 'E721': ['idioms'], 'W601': ['has_key'], 'W603': ['ne'], 'W604': ['repr'], 'W690': ['apply', 'except', 'exitfunc', 'numliterals', 'operator', 'paren', 'reduce', 'renames', 'standarderror', 'sys_exc', 'throw', 'tuple_params', 'xreadlines']} if sys.platform == 'win32': # pragma: no cover DEFAULT_CONFIG = os.path.expanduser(r'~\.pep8') else: DEFAULT_CONFIG = os.path.join(os.getenv('XDG_CONFIG_HOME') or os.path.expanduser('~/.config'), 'pep8') PROJECT_CONFIG = ('setup.cfg', 'tox.ini', '.pep8') def open_with_encoding(filename, encoding=None, mode='r'): """Return opened file with a specific encoding.""" if not encoding: encoding = detect_encoding(filename) return io
.op
en(filename, mode=mode, encoding=encoding, newline='') # Preserve line endings def detect_encoding(filename): """Return file encoding.""" try: with open(filename, 'rb') as input_file: from lib2to3.pgen2 import tokenize as lib2to3_tokenize encoding = lib2to3_tokenize.detect_encoding(input_file.readline)[0] # Check for correctness of encoding with open_with_encoding(filename, encoding) as test_file: test_file.read() return encoding except (LookupError, SyntaxError, UnicodeDecodeError): return 'latin-1' def readlines_from_file(filename): """Return contents of file.""" with open_with_encoding(filename) as input_file: return input_file.readlines() def extended_blank_lines(logical_line, blank_lines, blank_before, indent_level, previous_logical): """Check for missing blank lines after class declaration.""" if previous_logical.startswith('class '): if logical_line.startswith(('def ', 'class ', '@')): if indent_level and not blank_lines and not blank_before: yield (0, 'E309 expected 1 blank line after class declaration') elif previous_logical.startswith('def '): if blank_lines and pep8.DOCSTRING_REGEX.match(logical_line): yield (0, 'E303 too many blank lines ({0})'.format(blank_lines)) elif pep8.DOCSTRING_REGEX.match(previous_logical): # Missing blank line between class docstring and method declaration. if ( indent_level and not blank_lines and not blank_before and logical_line.startswith(('def ')) and '(self' in logical_line ): yield (0, 'E301 expected 1 blank line, found 0') pep8.register_check(extended_blank_lines) def continued_indentation(logical_line, tokens, indent_level, indent_char, noqa): """Override pep8's function to provide indentation information.""" first_row = tokens[0][2][0] nrows = 1 + tokens[-1][2][0] - first_row if noqa or nrows == 1: return # indent_next tells us whether the next block is indented. Assuming # that it is indented by 4 spaces, then we should not allow 4-space # indents on the final continuation line. In turn, some other # indents are allowed to have an extra 4 spaces. indent_next = logical_line.endswith(':') row = depth = 0 valid_hangs = ( (DEFAULT_INDENT_SIZE,) if indent_char != '\t' else (DEFAULT_INDENT_SIZE, 2 * DEFAULT_INDENT_SIZE) ) # Remember how many brackets were opened on each line. parens = [0] * nrows # Relative indents of physical lines. rel_indent = [0] * nrows # For each depth, collect a list of opening rows. open_rows = [[0]] # For each depth, memorize the hanging indentation. hangs = [None] # Visual indents. indent_chances = {} last_indent = tokens[0][2] indent = [last_indent[1]] last_token_multiline = None line = None last_line = '' last_line_begins_with_multiline = False for token_type, text, start, end, line in tokens: newline = row < start[0] - first_row if newline: row = start[0] - first_row newline = (not last_token_multiline and token_type not in (tokenize.NL, tokenize.NEWLINE)) last_line_begins_with_multiline = last_token_multiline if newline: # This is the beginning of a continuation line. last_indent = start # Record the initial indent. rel_indent[row] = pep8.expand_indent(line) - indent_level # Identify closing bracket. close_bracket = (token_type == tokenize.OP and text in ']})') # Is the indent relative to an opening bracket line? for open_row in reversed(open_rows[depth]): hang = rel_indent[row] - rel_indent[open_row] hanging_indent = hang in valid_hangs if hanging_indent: break if hangs[depth]: hanging_indent = (hang == hangs[depth]) visual_indent = (not close_bracket and hang > 0 and indent_chances.get(start[1])) if close_bracket and indent[depth]: # Closing bracket for v
e-gob/plataforma-kioscos-autoatencion
scripts/ansible-play/.venv/lib/python2.7/site-packages/ansible/modules/cloud/amazon/rds.py
Python
bsd-3-clause
56,122
0.002441
#!/usr/bin/python # This file is part of Ansible # # Ansible is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Ansible is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Ansible. If not, see <http://www.gnu.org/licenses/>. ANSIBLE_METADATA = {'metadata_version': '1.1', 'status': ['stableinterface'], 'supported_by': 'community'} DOCUMENTATION = ''' --- module: rds version_added: "1.3" short_description: create, delete, or modify an Amazon rds instance description: - Creates, deletes, or modifies rds instances. When creating an instance it can be either a new instance or a read-only replica of an existing instance. This module has a dependency on python-boto >= 2.5. The 'promote' command requires boto >= 2.18.0. Certain features such as tags rely on boto.rds2 (boto >= 2.26.0) options: command: description: - Specifies the action to take. The 'reboot' option is available starting at version 2.0 required: true choices: [ 'create', 'replicate', 'delete', 'facts', 'modify' , 'promote', 'snapshot', 'reboot', 'restore' ] instance_name: description: - Database instance identifier. Required except when using command=facts or command=delete on just a snapshot required: false default: null source_instance: description: - Name of the database to replicate. Used only when command=replicate. required: false default: null db_engine: description: - The type of database. Used only when command=create. - mariadb was added in version 2.2 required: false default: null choices: ['mariadb', 'MySQL', 'oracle-se1', 'oracle-se2', 'oracle-se', 'oracle-ee', 'sqlserver-ee', 'sqlserver-se', 'sqlserver-ex', 'sqlserver-web', 'postgres', 'aurora'] size: description: - Size in gigabytes of the initial storage for the DB instance. Used only when command=create or command=modify. required: false default: null instance_type: description: - The instance type of the database. Must be specified when command=create. Optional when command=replicate, command=modify or command=restore. If not specified then the replica inherits the same instance type as the source instance. required: false default: null username: description: - Master database username. Used only when command=create. required: false default: null password: description: - Password for the master database username. Used only when command=create or command=modify. required: false default: null region: description: - The AWS region to use. If not specified then the value of the EC2_REGION environment variable, if any, is used. required: true aliases: [ 'aws_region', 'ec2_region' ] db_name: description: - Name of a database to create within the instance. If not specified then no database is created. Used only when command=create. required: false default: null engine_version: description: - Version number of the database engine to use. Used only when command=create. If not specified then the current Amazon RDS default engine version is used required: false default: null parameter_group: description: - Name of the DB parameter group to associate with this instance. If omitted then the RDS default DBParameterGroup will be used. Used only when command=create or command=modify. required: false default: null license_model: description: - The license model for this DB instance. Used only when command=create or command=restore. required: false default: null choices: [ 'license-included', 'bring-your-own-license', 'general-public-license', 'postgresql-license' ] multi_zone: description: - Specifies if this is a Multi-availability-zone deployment. Can not be used in conjunction with zone parameter. Used only when command=create or command=modify. choices: [ "yes", "no" ] required: false default: null iops: description: - Specifies the number of IOPS for the instance. Used only when command=create or command=modify. Must be an integer greater than 1000. required: false default: null security_groups: description: - Comma separated list of one or more security groups. Used only when command=create or command=modify. required: false default: null vpc_security_groups: description: - Comma separated list of one or more vpc security group ids. Also requires `subnet` to be specified. Used only when command=create or command=modify. required: false default: null port: description: - Port number that the DB instance uses for connections. Used only when command=create or command=replicate. - Prior to 2.0 it always defaults to null and the API would use 3306, it had to be set to other DB default values when not using MySql. Starting at 2.0 it automatically defaults to what is expected for each C(db_engine). required: false default: 3306 for mysql, 1521 for Oracle, 1433 for SQL Server, 5432 for PostgreSQL. upgrade: description: - Indicates that minor version upgrades should be applied automatically. Used only when command=create or command=replicate. required: false default: no choices: [ "yes", "no" ] option_group: description: - The name of the option group to use. If not specified then the default option group is used. Used only when command=create. required: false default: null maint_window: description: - > Maintenance window in format of ddd:hh24:mi-ddd:hh24:mi. (Example: Mon:22:00-Mon:23:15) If not specified then a random maintenance window is assigned. Used only when command=create or command=modify. required: false default: null backup_window: description: - Backup window in format of hh24:mi-hh24:mi. If not specified then a random backup window is assigned. Used only when command=create or command=modify. required: false default: null backup_retention: description: - > Number of days backups are retained. Set to 0 to disable backups. Default is 1 day. Valid range: 0-35. Used only wh
en command=create or command=modify. required: false default: null zone: description: - availability zone in which to launch the instance. Used only when command=create, command=replicate or command=restore.
required: false default: null aliases: ['aws_zone', 'ec2_zone'] subnet: description: - VPC subnet group. If specified then a VPC instance is created. Used only when command=create. required: false default: null snapshot: description: - Name of snapshot to take. When command=delete, if no snapshot name is provided then no snapshot is taken. If used with command=delete with no instance_name, the snapshot is deleted. Used with command=facts, command=delete or command=snapshot. required: false default: null aws_secret_key: description: - AWS secret key. If not set then the value of the AWS_SECRET_KEY environment variable is used. required: false aliases: [ 'ec2_secret_key', 'secret_key' ] aws_access_key: description: - AWS access key. If not set then the value of the AWS_ACCESS_KEY environment variable is used. required: false default: null aliases: [ 'ec2_access_key', 'access_key' ] wait: description: - When command=create, replicate, modify or restore then wait for the database to enter the 'available' state. When command=delete wait for
sauloal/PiCastPy
sqlalchemy/orm/interfaces.py
Python
mit
28,330
0.000671
# orm/interfaces.py # Copyright (C) 2005-2013 the SQLAlchemy authors and contributors <see AUTHORS file> # # This module is part of SQLAlchemy and is released under # the MIT License: http://www.opensource.org/licenses/mit-license.php """ Contains various base classes used throughout the ORM. Defines the now deprecated ORM extension classes as well as ORM internals. Other than the deprecated extensions, this module and the classes within should be considered mostly private. """ from __future__ import absolute_import from .. import exc as sa_exc, util, inspect from ..sql import operators from collections import deque orm_util = util.importlater('sqlalchemy.orm', 'util') collections = util.importlater('sqlalchemy.orm', 'collections') __all__ = ( 'AttributeExtension', 'EXT_CONTINUE', 'EXT_STOP', 'ExtensionOption', 'InstrumentationManager', 'LoaderStrategy', 'MapperExtension', 'MapperOption', 'MapperProperty', 'PropComparator', 'PropertyOption', 'SessionExtension', 'StrategizedOption', 'StrategizedProperty', ) EXT_CONTINUE = util.symbol('EXT_CONTINUE') EXT_STOP = util.symbol('EXT_STOP') ONETOMANY = util.symbol('ONETOMANY') MANYTOONE = util.symbol('MANYTOONE') MANYTOMANY = util.symbol('MANYTOMANY') from .deprecated_interfaces import AttributeExtension, \ SessionExtension, \ MapperExtension NOT_EXTENSION = util.symbol('NOT_EXTENSION') """Symbol indicating an :class:`_InspectionAttr` that's not part of sqlalchemy.ext. Is assigned to the :attr:`._InspectionAttr.extension_type` attibute. """ class _InspectionAttr(object): """A base class applied to all ORM objects that can be returned by the :func:`.inspect` function. The attributes defined here allow the usage of simple boolean checks to test basic facts about the object returned. While the boolean checks here are basically the same as using the Python isinstance() function, the flags here can be used without the need to import all of these classes, and also such that the SQLAlchemy class system can change while leaving the flags here intact for forwards-compatibility. """ is_selectable = False """Return True if this object is an instance of :class:`.Selectable`.""" is_aliased_class = False """True if this object is an instance of :class:`.AliasedClass`.""" is_instance = False """True if this object is an instance of :class:`.InstanceState`.""" is_mapper = False """True if this object is an instance of :class:`.Mapper`.""" is_property = False """True if this object is an instance of :class:`.MapperProperty`.""" is_attribute = False """True if this object is a Python :term:`descriptor`. This can refer to one of many types. Usually a :class:`.QueryableAttribute` which handles attributes events on behalf of a :class:`.MapperProperty`. But can also be an extension type such as :class:`.AssociationProxy` or :class:`.hybrid_property`. The :attr:`._InspectionAttr.extension_type` will refer to a constant identifying the specific subtype. .. seealso:: :attr:`.Mapper.all_orm_descriptors` """ is_clause_element = False """True if this object is an instance of :class:`.ClauseElement`.""" extension_type = NOT_EXTENSION """The extension type, if any. Defaults to :data:`.interfaces.NOT_EXTENSION` .. versionadded:: 0.8.0 .. seealso:: :data:`.HYBRID_METHOD` :data:`.HYBRID_PROPERTY` :data:`.ASSOCIATION_PROXY` """ class _MappedAttribute(object): """Mixin for attributes which should be replaced by mapper-assigned attributes. """ class MapperProperty(_MappedAttribute, _InspectionAttr): """Manage the relationship of a ``Mapper`` to a single class attribute, as well as that attribute as it appears on individual instances of the class, including attribute instrumentation, attribute access, loading behavior, and dependency calculations. The most common occurrences of :class:`.MapperProperty` are the mapped :class:`.Column`, which is represented in a mapping as an instance of :class:`.ColumnProperty`, and a reference to another class produced by :func:`.relationship`, represented in the mapping as an instance of :class:`.RelationshipProperty`. """ cascade = frozenset() """The set of 'cascade' attribute names. This collection is checked before the 'cascade_iterator' method is called. """ is_property = True def setup(self, context, entity, path, adapter, **kwargs): """Called by Query for the purposes of constructing a SQL statement. Each MapperProperty associated with the target mapper processes the statement referenced by the query context, adding columns and/or criterion as appropriate. """ pass def create_row_processor(self, context, path, mapper, row, adapter): """Return a 3-tuple consisting of three row processing functions. """ return None, None, None def cascade_iterator(self, type_, state, visited_instances=None, halt_on=None): """Iterate through instances related to the given instance for a particular 'cascade', starting with this MapperProperty. Return an iterator3-tuples (instance, mapper, state). Note that the 'cascade' collection on this MapperProperty is checked first for the given type before cascade_iterator is called. See PropertyLoader for the related instance implementation. """ return iter(()) def set_parent(self, parent, init): self.parent = parent def instrument_class(self, mapper): # pragma: no-coverage raise NotImplementedError() @util.memoized_property def info(self): """Info dictionary associated with the object, allowing user-defined data to be associated with this :class:`.MapperProperty`. The dictionary is generated when first accessed. Alternatively, it can be specified as a constructor argument to the :func:`.column_property`, :func:`.relationship`, or :func:`.composite` functions. .. versionadded:: 0.8 Added support for .info to all :class:`.MapperProperty` subclasses. .. seealso:: :attr:`.QueryableAttribute.info` :attr:`.SchemaItem.info` """ return {} _configure_started = False _configure_finished = False def init(self): """Called after all mappers are created to assemble relationships between mappers and perform other post-mapper-creation initialization steps. """ self._configure_started = True self.do_init() self._configure_finished = True @property def class_attribute(self): """Return the class-bound descriptor corresponding to this MapperProperty.""" return getattr(self.parent.class_, self.key) def do_init(self): """Perform subclass-specific initialization post-mapper-creation steps. This is a template method called by the ``MapperProperty`` object's init() method. """ pass def post_instrument_class(self, mapper): """Perform instrumentation adjustments that need to occur after init() has completed. """ pass def is_primary(self): """Ret
urn True if this ``MapperProperty``'s mapper is the primary mapper for its class. This flag is used to indicate that the ``MapperProperty`` can define attribute instrumentation for the class at the class level (as opposed to the individual instance level). """ return not self.parent.non_primary def merge(self, session, source_state, source_dict, dest_state, dest_dict, load, _recursive): """Merge
the attribute represented by this ``MapperProperty`` from source to destination object"""
lahwaacz/tvnamer
tvnamer/renamer.py
Python
unlicense
4,157
0.001203
#!/usr/bin/env python import os import shutil import logging from unicode_helper import p __all__ = ["Renamer"] def log(): """Returns the logger for current file """ return logging.getLogger(__name__) def same_partition(f1, f2): """Returns True if both files or directories are on the same partition """ return os.stat(f1).st_dev == os.stat(f2).st_dev def delete_file(fpath): """On OS X: Trashes a path using the Finder, via OS X's Scripting Bridge. On other platforms: unlinks file. """ try: from AppKit import NSURL from ScriptingBridge import SBApplication except ImportError: p("Deleting %s" % fpath) log().debug("Deleting %r" % fpath) os.unlink(fpath) else: p("Trashing %s" % fpath) log().debug("Trashing %r" % fpath) targetfile = NSURL.fileURLWithPath_(fpath) finder = SBApplication.applicationWithBundleIdentifier_("com.apple.Finder") items = finder.items().objectAtLocation_(targetfile) items.delete() def rename_file(old, new): """Rename 'old' file to 'new'. Both files must be on the same partition. Preserves access and modification time. """ p("Renaming %s to %s" % (old, new)) log().debug("Renaming %r to %r" % (old, new)) stat = os.stat(old) os.rename(old, new) os.utime(new, (stat.st_atime, stat.st_mtime)) def copy_file(old, new): """Copy 'old' file to 'new'. """ p("Copying %s to %s" % (old, new)) log().debug("Copying %r to %r" % (old, new))
shutil.copyfile(old, new) shutil.copystat(old, new) def symlink_file(target, name): """Create symbolic
link named 'name' pointing to 'target'. """ p("Creating symlink %s to %s" % (name, target)) log().debug("Creating symlink %r to %r" % (name, target)) os.symlink(target, name) class Renamer(object): """Deals with renaming of files """ def __init__(self, filename): self.filename = os.path.abspath(filename) def rename(self, new_fullpath, force=False, always_copy=False, always_move=False, leave_symlink=False, create_dirs=True): """Moves the file to a new path. If it is on the same partition, it will be moved (unless always_copy is True) If it is on a different partition, it will be copied, and the original only deleted if always_move is True. If the target file already exists, it will raise OSError unless force is True. If it was moved, a symlink will be left behind with the original name pointing to the file's new destination if leave_symlink is True. """ new_dir = os.path.dirname(new_fullpath) if create_dirs: p("Creating directory %s" % new_dir) try: os.makedirs(new_dir) except OSError, e: if e.errno != 17: raise if os.path.exists(new_fullpath): # If the destination exists, raise exception unless force is True if not force: raise OSError("File %s already exists, not forcefully moving %s" % ( new_fullpath, self.filename)) if same_partition(self.filename, new_dir): if always_copy: # Same partition, but forced to copy copy_file(self.filename, new_fullpath) else: # Same partition, just rename the file to move it rename_file(self.filename, new_fullpath) # Leave a symlink behind if configured to do so if leave_symlink: symlink_file(new_fullpath, self.filename) else: # File is on different partition (different disc), copy it copy_file(self.filename, new_fullpath) if always_move: # Forced to move file, we just trash old file delete_file(self.filename) # Leave a symlink behind if configured to do so if leave_symlink: symlink_file(new_fullpath, self.filename) self.filename = new_fullpath
badbytes/pymeg
gui/gtk/data_editor.py
Python
gpl-3.0
30,723
0.01494
#!/usr/bin/python2 #!/usr/bin/env python # # Copyright 2010 dan collins <[email protected]> # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation; either version 2 of the License, or # (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with this program; if not, write to the Free Software # Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, # MA 02110-1301, USA. ''' Requires the following... srate,timeaxes,data,chanlabels, ''' import sys,os from gtk import gdk from numpy import * #fromstring, arange, int16, float, log10 from matplotlib import rcParams from meg import nearest from pylab import xticks,ion from matplotlib.backends.backend_gtkagg import FigureCanvasGTKAgg as \ FigureCanvas import matplotlib.cm as
cm from matplotlib.figure import Figure from matplotlib.lines import Line2D #from meg import megcontour_gtk from pdf2py import pdf, readwrite from gui.gtk
import contour as contour_gtk from gui.gtk import meg_assistant,event_process#,offset_correct try: import pygtk pygtk.require("2.0") except: pass try: import gtk import gtk.glade except: print("GTK Not Availible") sys.exit(1) class setup_gui: def __init__(self): self.builder = gtk.Builder() self.builder.add_from_file(os.path.splitext(__file__)[0]+".glade") self.window = self.builder.get_object("window") dic = { "on_toolbutton_refresh_clicked" : self.generate_testdata, "on_button1_clicked" : self.generate_testdata, "on_vboxMain_button_press_event" : self.button_press_event, "on_vboxMain_button_release_event" : self.button_release_event, "on_vboxMain_drag" : self.drag_begin, "on_vboxMain_motion_notify_event" : self.drag_begin, "on_toolbar_clear_clicked" : self.clear_selections, "on_toolbar_zoomin_clicked" : self.zoomin_time, "on_toolbar_zoomout_clicked" : self.zoomout_time, "on_go_back_clicked" : self.page_back, "on_go_forward_clicked" : self.page_forward, "on_toolbutton_setup_toggled" : self.preferences_open, "on_button_channel_apply_clicked" : self.channel_selection_apply, "set_channel_groups" : self.set_channel_groups, "showpopupmenu" : self.showpopupmenu, "on_toolbar_plot_clicked" : self.plot_contour, "on_plot_contour_activate" : self.plot_contour, "on_button_delete_selection_clicked" : self.event_selection_delete, "gtk_widget_hide" : self.hideinsteadofdelete, "on_button_display_apply_clicked": self.display_apply, "on_go_up_clicked" : self.page_up, "on_go_down_clicked" : self.page_down, "on_toolbutton_load_clicked" : self.load_data, "on_menu_offset_correct_clicked" : self.offset_correct, "on_button_epoch_clicked" : self.add_selections_to_event_process, "on_store_event_clicked" : self.store_event, "on_menu_save_noise_activate" : self.store_noise, "on_menu_save_event_activate" : self.store_event, "on_key_press_event" : self.key_press_event, } self.builder.connect_signals(dic) try: self.prefs = readwrite.readdata(os.getenv('HOME')+'/.pymeg.pym') except IOError: self.prefs = {}; readwrite.writedata(self.prefs, os.getenv('HOME')+'/.pymeg') try: self.line_r,self.line_g,self.line_b = self.prefs['LineColor'][0],self.prefs['LineColor'][1],self.prefs['LineColor'][2] self.back_r,self.back_g,self.back_b = self.prefs['BackColor'][0],self.prefs['BackColor'][1],self.prefs['BackColor'][2] except: self.line_r,self.line_g,self.line_b = 1.,1.,1. self.back_r,self.back_g,self.back_b = .9,.9,.9 self.color = (self.line_r,self.line_g,self.line_b) self.create_draw_frame('none') self.create_spec_frame('none') self.create_csd_frame('none') self.space = 0 #self.generate_testdata(None) self.preferences_open(None) def printtest(self,widget): print 'something' def store_noise(self,widget): print widget,'wid',widget.get_parent().get_name() self.callback(widget) def store_event(self,widget): print widget,'wid',widget.get_parent().get_name() self.callback(widget) def create_draw_frame(self,widget): self.fig = Figure(figsize=[100,100], dpi=40) self.canvas = FigureCanvas(self.fig) self.canvas.connect("scroll_event", self.scroll_event) self.canvas.connect("key-press-event", self.key_press_event) #self.canvas.connect('button_press_event', self.button_press_event) self.canvas.show() self.figure = self.canvas.figure self.axes = self.fig.add_axes([0.045, 0.05, 0.93, 0.925], \ axisbg=(self.back_r,self.back_g,self.back_b)) #axisbg='#FFFFCC') self.vb = self.builder.get_object("vbox3") self.vb.pack_start(self.canvas, gtk.TRUE, gtk.TRUE) self.vb.show() def create_spec_frame(self,widget): self.specfig = Figure(figsize=[10,10], dpi=40) self.specfig.text(0.25,0.5,'Middle Click Channel for Specgram',\ fontsize=20) self.speccanvas = FigureCanvas(self.specfig) self.speccanvas.show() self.specfigure = self.speccanvas.figure self.specaxes = self.specfig.add_axes([0.045, 0.05, 0.93, 0.925], \ axisbg=(self.back_r,self.back_g,self.back_b)) #self.specaxes.axis('off') self.vb2 = self.builder.get_object("vbox8") self.vb2.pack_end(self.speccanvas, gtk.TRUE, gtk.TRUE) self.vb2.show() def create_csd_frame(self,widget): self.csdfig = Figure(figsize=[10,10], dpi=40) self.csdfig.text(0.25,0.5,'Middle Click Channel for CSD',fontsize=20) self.csdcanvas = FigureCanvas(self.csdfig) self.csdcanvas.show() self.csdfigure = self.csdcanvas.figure self.csdaxes = self.csdfig.add_axes([0.045, 0.05, 0.93, 0.925], \ axisbg=(self.back_r,self.back_g,self.back_b)) #self.csdaxes.axis('off') self.vb3 = self.builder.get_object("vbox9") self.vb3.pack_end(self.csdcanvas, gtk.TRUE, gtk.TRUE) self.vb3.show() def data_loaded_setup(self): self.channel_tree(None) self.builder.get_object("spinbutton1").set_range(0,self.numchannels) self.builder.get_object("spinbutton1").set_value(self.numchannels) self.builder.get_object("spinbutton2").set_range(self.t[0],self.t[-1]) self.builder.get_object("spinbutton2").set_value(self.t[0]) self.builder.get_object("spinbutton3").set_range(self.t[0],self.t[-1]) #if self.t[-1] - self.t[0] > 1: #alot of time, save time in plotting and set low if len(self.t) > 1000: self.builder.get_object("spinbutton3").set_value(self.t[1000]) print '.....reducing time var' else: print '.....showing all time' self.builder.get_object("spinbutton3").set_value(self.t[-1]) #self.builder.get_object("spinbutton3").set_value(self.t[-1]) #self.builder.get_object("spinbutton5").set_value(self.scalefact) self.builder.get_object("entry1").set_text(str(self.space)) self.builder.get_object("entry2").set_text(str(self.scalefact)) def preferences_open(self,widget): self.win_prefs = self.builder.get_object("window_prefs") #try: self.prefs = readwrite.readdata(os.getenv('HOME')+'/.pymeg.pym') #except IOError: self.prefs = {}; readwrite.writedata(self.prefs,