answer
stringlengths
17
10.2M
package net.hearthstats; import java.awt.image.BufferedImage; import java.util.Observable; public class HearthstoneAnalyzer extends Observable { private boolean _coin; private BufferedImage _image; private String _mode; private String _opponentClass; private String _result; private String _screen; private String _yourClass; private int _deckSlot; private boolean _isNewArena = false; public HearthstoneAnalyzer() { } public void analyze(BufferedImage image) { _image = image; if(getScreen() != "Main Menu" && getScreen() != "Playing") { _testForMainMenuScreen(); } if(getScreen() != "Play") { _testForPlayScreen(); } if(getScreen() != "Arena") { _testForArenaModeScreen(); } if(getScreen() == "Play" || getScreen() == "Arena") { _testForFindingOpponent(); if (getScreen() == "Play") { if(getMode() != "Casual") _testForCasualMode(); if(getMode() != "Ranked") _testForRankedMode(); _testForDeckSlot(); } } if(getScreen() == "Finding Opponent") { _testForMatchStartScreen(); } if(getScreen() == "Match Start") { if(getYourClass() == null) _testForYourClass(); if(getOpponentClass() == null) _testForOpponentClass(); if(!getCoin()) _testForCoin(); _testForPlayingScreen(); } if(getScreen() == "Result") { _testForArenaEnd(); } if(getScreen() == "Playing") { _testForVictory(); _testForDefeat(); } if(getScreen() == "Arena" && !isNewArena()) { _testForNewArenaRun(); } _image.flush(); } public boolean getCoin() { return _coin; } public int getDeckSlot() { return _deckSlot; } public String getMode() { return _mode; } public String getOpponentClass() { return _opponentClass; } public String getResult() { return _result; } public String getScreen() { return _screen; } public String getYourClass() { return _yourClass; } public boolean isNewArena() { return _isNewArena; } private void _notifyObserversOfChangeTo(String property) { setChanged(); notifyObservers(property); } public void setIsNewArena(boolean isNew) { _isNewArena = isNew; _notifyObserversOfChangeTo("newArena"); } private void _setDeckSlot(int deckSlot) { _deckSlot = deckSlot; _notifyObserversOfChangeTo("deckSlot"); } private void _setCoin(boolean coin) { _coin = coin; _notifyObserversOfChangeTo("coin"); } private void _setMode(String screen) { _mode = screen; _notifyObserversOfChangeTo("mode"); } private void _setOpponentClass(String opponentClass) { _opponentClass = opponentClass; _notifyObserversOfChangeTo("opponentClass"); } private void _setResult(String result) { _result = result; _notifyObserversOfChangeTo("result"); } private void _setScreen(String screen) { _screen = screen; _notifyObserversOfChangeTo("screen"); } private void _setYourClass(String yourClass) { _yourClass = yourClass; _notifyObserversOfChangeTo("yourClass"); } private void _testForArenaEnd() { int[][] tests = { { 315, 387, 239, 32, 39 }, { 399, 404, 237, 41, 33 }, { 448, 408, 223, 8, 16 } }; if((new PixelGroupTest(_image, tests)).passed()) { _screen = "Arena"; _notifyObserversOfChangeTo("arenaEnd"); } } private void _testForArenaModeScreen() { int[][] tests = { { 807, 707, 95, 84, 111 }, { 324, 665, 77, 114, 169 }, { 120, 685, 255, 215, 115 }, { 697, 504, 78, 62, 56 } }; if((new PixelGroupTest(_image, tests)).passed()) { _setScreen("Arena"); _setMode("Arena"); } } private void _testForCasualMode() { int[][] tests = { { 833, 94, 100, 22, 16 }, // ranked off { 698, 128, 200, 255, 255 } // casual blue }; if((new PixelGroupTest(_image, tests)).passed()) _setMode("Casual"); } private void _testForCoin() { int[][] tests = { { 869, 389, 155, 250, 103 } // fourth card right edge }; if((new PixelGroupTest(_image, tests)).passed()) _setCoin(true); } private void _testForDeckSlot() { if(getDeckSlot() != 1) { int[][] slotOnePixels = { { 163, 178, 33, 129, 242}, { 183, 178, 33, 129, 242} }; if((new PixelGroupTest(_image, slotOnePixels)).passedOr()) _setDeckSlot(1); } if(getDeckSlot() != 2) { int[][] slotTwoPixels = { { 348, 178, 36, 144, 247 }, { 368, 178, 36, 144, 247 } }; if((new PixelGroupTest(_image, slotTwoPixels)).passedOr()) _setDeckSlot(2); } if(getDeckSlot() != 3) { int[][] slotTwoPixels = { { 506, 178, 36, 144, 247 }, { 526, 178, 36, 144, 247 } }; if((new PixelGroupTest(_image, slotTwoPixels)).passedOr()) _setDeckSlot(3); } if(getDeckSlot() != 4) { int[][] slotOnePixels = { { 163, 339, 33, 129, 242}, { 183, 339, 33, 129, 242} }; if((new PixelGroupTest(_image, slotOnePixels)).passedOr()) _setDeckSlot(4); } if(getDeckSlot() != 5) { int[][] slotTwoPixels = { { 348, 339, 36, 144, 247 }, { 368, 339, 36, 144, 247 } }; if((new PixelGroupTest(_image, slotTwoPixels)).passedOr()) _setDeckSlot(5); } if(getDeckSlot() != 6) { int[][] slotTwoPixels = { { 506, 339, 36, 144, 247 }, { 526, 339, 36, 144, 247 } }; if((new PixelGroupTest(_image, slotTwoPixels)).passedOr()) _setDeckSlot(6); } if(getDeckSlot() != 7) { int[][] slotOnePixels = { { 163, 497, 33, 129, 242}, { 183, 497, 33, 129, 242} }; if((new PixelGroupTest(_image, slotOnePixels)).passedOr()) _setDeckSlot(7); } if(getDeckSlot() != 8) { int[][] slotTwoPixels = { { 348, 497, 36, 144, 247 }, { 368, 497, 36, 144, 247 } }; if((new PixelGroupTest(_image, slotTwoPixels)).passedOr()) _setDeckSlot(8); } if(getDeckSlot() != 9) { int[][] slotTwoPixels = { { 506, 497, 36, 144, 247 }, { 526, 497, 36, 144, 247 } }; if((new PixelGroupTest(_image, slotTwoPixels)).passedOr()) _setDeckSlot(9); } } private void _testForDefeat() { int[][] tests = { { 745, 219, 164, 162, 155 }, { 344, 383, 134, 153, 239 }, { 696, 357, 201, 197, 188 } }; PixelGroupTest pxTest = new PixelGroupTest(_image, tests); int[][] testsTwo = { { 347, 382, 129, 148, 236 }, { 275, 345, 137, 138, 134 }, { 537, 155, 235, 226, 67 } }; PixelGroupTest pxTestTwo = new PixelGroupTest(_image, testsTwo); int[][] testsThree = { { 347, 382, 129, 148, 236 }, { 275, 345, 137, 138, 134 }, { 537, 155, 235, 226, 67 } }; PixelGroupTest pxTestThree = new PixelGroupTest(_image, testsThree); if (pxTest.passed() || pxTestTwo.passed() || pxTestThree.passed()) { _setScreen("Result"); _setResult("Defeat"); } } private void _testForClass(String className, int[][] pixelTests, boolean isYours) { if((new PixelGroupTest(_image, pixelTests)).passed()) { if(isYours) _setYourClass(className); else _setOpponentClass(className); } } private void _testForFindingOpponent() { int[][] tests = { { 401, 143, 180, 122, 145 }, // title bar { 765, 583, 121, 72, 100 } // bottom bar }; PixelGroupTest pxTest = new PixelGroupTest(_image, tests); int[][] arenaTests = { { 393, 145, 205, 166, 135 }, // title bar { 819, 235, 109, 87, 79 }, { 839, 585, 139, 113, 77 } }; PixelGroupTest arenaPxTest = new PixelGroupTest(_image, arenaTests); if (pxTest.passed() || arenaPxTest.passed()) { _coin = false; _yourClass = null; _opponentClass = null; _setScreen("Finding Opponent"); } } private void _testForMainMenuScreen() { int[][] tests = { { 338, 453, 159, 96, 42 }, // box top { 211, 658, 228, 211, 116 }, // quest button exclamation mark { 513, 148, 36, 23, 24 } // dark vertical line in top center }; if((new PixelGroupTest(_image, tests)).passed()) _setScreen("Main Menu"); } private void _testForMatchStartScreen() { int[][] tests = { { 403, 487, 201, 173, 94 }, // title bar { 946, 149, 203, 174, 96 } // bottom bar }; if ((new PixelGroupTest(_image, tests)).passed()) { _setScreen("Match Start"); } } private void _testForNewArenaRun() { int[][] tests = { { 298, 170, 255, 239, 148 }, // key //{ 492, 204, 128, 79, 47 }, // key stem { 382, 294, 255, 255, 255 }, // zero { 393, 281, 255, 255, 255 }, // zero { 321, 399, 209, 179, 127 }, // no red x }; if ((new PixelGroupTest(_image, tests)).passed()) { setIsNewArena(true); } } private void _testForOpponentClass() { // Druid Test int[][] druidTests = { { 743, 118, 205, 255, 242 }, { 882, 141, 231, 255, 252 }, { 766, 215, 203, 160, 198 } }; _testForClass("Druid", druidTests, false); // Hunter Test int[][] hunterTests = { { 825, 66, 173, 178, 183 }, { 818, 175, 141, 37, 0 }, { 739, 309, 216, 214, 211 } }; _testForClass("Hunter", hunterTests, false); // Mage Test int[][] mageTests = { { 790, 68, 88, 23, 99 }, { 788, 312, 215, 188, 177 }, { 820, 247, 53, 64, 82 } }; _testForClass("Mage", mageTests, false); // Paladin Test int[][] paladinTests = { { 895, 213, 255, 247, 147 }, { 816, 301, 125, 237, 255 }, { 767, 82, 133, 107, 168 } }; _testForClass("Paladin", paladinTests, false); // Priest Test int[][] priestTests = { { 724, 189, 255, 236, 101 }, { 796, 243, 58, 72, 138 }, { 882, 148, 27, 20, 38 } }; _testForClass("Priest", priestTests, false); // Rogue Test int[][] rogueTests = { { 889, 254, 132, 196, 72 }, { 790, 273, 88, 21, 34 }, { 841, 73, 100, 109, 183 } }; _testForClass("Rogue", rogueTests, false); // Shaman Test int[][] shamanTests = { { 748, 94, 5, 50, 100 }, { 887, 169, 234, 50, 32 }, { 733, 206, 186, 255, 255 } }; _testForClass("Shaman", shamanTests, false); // Warlock Test int[][] warlockTests = { { 711, 203, 127, 142, 36 }, { 832, 264, 240, 244, 252 }, { 832, 65, 98, 129, 0 } }; _testForClass("Warlock", warlockTests, false); // Warrior Test int[][] warriorTests = { { 795, 64, 37, 4, 0 }, { 780, 83, 167, 23, 4 }, { 809, 92, 255, 247, 227 } }; _testForClass("Warrior", warriorTests, false); } private void _testForPlayingScreen() { // check for normal play boards int[][] tests = { { 336, 203, 231, 198, 124 }, { 763, 440, 234, 198, 124 } }; PixelGroupTest normalPxTest = new PixelGroupTest(_image, tests); // check for lighter orc board int[][] orcBoardTests = { { 906, 283, 222, 158, 94 }, { 120, 468, 195, 134, 78 } }; PixelGroupTest orcPxTest = new PixelGroupTest(_image, orcBoardTests); if (normalPxTest.passed() || orcPxTest.passed()) _setScreen("Playing"); } private void _testForPlayScreen() { int[][] tests = { { 543, 130, 121, 32, 22 }, // play mode red background { 254, 33, 197, 173, 132 }, // mode title light brown background { 956, 553, 24, 8, 8 }, { 489, 688, 68, 65, 63 } }; if((new PixelGroupTest(_image, tests)).passed()) _setScreen("Play"); } private void _testForRankedMode() { int[][] tests = { { 833, 88, 220, 255, 255 }, // ranked blue { 698, 120, 56, 16, 8 } // casual off }; if((new PixelGroupTest(_image, tests)).passed()) _setMode("Ranked"); } private void _testForVictory() { int[][] tests = { { 334, 504, 88, 101, 192 }, { 683, 510, 74, 88, 173 }, { 549, 162, 255, 224, 119 } }; PixelGroupTest pxTest = new PixelGroupTest(_image, tests); int[][] testsTwo = { { 347, 469, 85, 102, 203 }, { 737, 339, 63, 76, 148 }, { 774, 214, 253, 243, 185 } }; PixelGroupTest pxTestTwo = new PixelGroupTest(_image, testsTwo); int[][] testsThree = { { 370, 528, 66, 81, 165 }, { 690, 553, 63, 76, 162 }, { 761, 228, 249, 234, 163 } }; PixelGroupTest pxTestThree = new PixelGroupTest(_image, testsThree); if(pxTest.passed() || pxTestTwo.passed() || pxTestThree.passed()) { _setScreen("Result"); _setResult("Victory"); } } private void _testForYourClass() { // Druid Test int[][] druidTests = { { 225, 480, 210, 255, 246 }, { 348, 510, 234, 255, 251 }, { 237, 607, 193, 155, 195 } }; _testForClass("Druid", druidTests, true); // Hunter Test int[][] hunterTests = { { 289, 438, 173, 161, 147 }, { 366, 554, 250, 200, 81 }, { 210, 675, 209, 209, 211 } }; _testForClass("Hunter", hunterTests, true); // Mage Test int[][] mageTests = { { 259, 439, 96, 31, 102 }, { 294, 677, 219, 210, 193 }, { 216, 591, 0, 0, 56 } }; _testForClass("Mage", mageTests, true); // Paladin Test int[][] paladinTests = { { 249, 447, 133, 105, 165 }, { 304, 671, 74, 146, 234 }, { 368, 581, 244, 238, 141 } }; _testForClass("Paladin", paladinTests, true); // Priest Test int[][] priestTests = { { 229, 491, 180, 178, 166 }, { 256, 602, 82, 104, 204 }, { 350, 611, 22, 23, 27 } }; _testForClass("Priest", priestTests, true); // Rogue Test int[][] rogueTests = { { 309, 446, 91, 107, 175 }, { 291, 468, 187, 37, 25 }, { 362, 623, 122, 186, 67 } }; _testForClass("Rogue", rogueTests, true); // Shaman Test int[][] shamanTests = { { 223, 458, 4, 46, 93 }, { 360, 533, 213, 32, 6 }, { 207, 578, 177, 245, 249 } }; _testForClass("Shaman", shamanTests, true); // Warlock Test int[][] warlockTests = { { 301, 435, 104, 138, 8 }, { 265, 493, 221, 51, 32 }, { 294, 680, 60, 75, 182 } }; _testForClass("Warlock", warlockTests, true); } }
package nl.hsac.fitnesse.fixture.slim.web; import fitnesse.slim.fixtureInteraction.FixtureInteraction; import nl.hsac.fitnesse.fixture.slim.SlimFixture; import nl.hsac.fitnesse.fixture.slim.SlimFixtureException; import nl.hsac.fitnesse.fixture.slim.StopTestException; import nl.hsac.fitnesse.fixture.slim.web.annotation.TimeoutPolicy; import nl.hsac.fitnesse.fixture.slim.web.annotation.WaitUntil; import nl.hsac.fitnesse.fixture.util.BinaryHttpResponse; import nl.hsac.fitnesse.fixture.util.FileUtil; import nl.hsac.fitnesse.fixture.util.HttpResponse; import nl.hsac.fitnesse.fixture.util.ReflectionHelper; import nl.hsac.fitnesse.fixture.util.selenium.ListItemBy; import nl.hsac.fitnesse.fixture.util.selenium.PageSourceSaver; import nl.hsac.fitnesse.fixture.util.selenium.SeleniumHelper; import nl.hsac.fitnesse.fixture.util.selenium.by.ContainerBy; import nl.hsac.fitnesse.fixture.util.selenium.by.GridBy; import nl.hsac.fitnesse.fixture.util.selenium.by.OptionBy; import nl.hsac.fitnesse.fixture.util.selenium.by.TextBy; import nl.hsac.fitnesse.fixture.util.selenium.by.XPathBy; import nl.hsac.fitnesse.slim.interaction.ExceptionHelper; import org.apache.commons.io.FilenameUtils; import org.apache.commons.lang3.StringUtils; import org.apache.commons.lang3.exception.ExceptionUtils; import org.apache.commons.text.StringEscapeUtils; import org.openqa.selenium.Alert; import org.openqa.selenium.By; import org.openqa.selenium.Cookie; import org.openqa.selenium.Dimension; import org.openqa.selenium.Keys; import org.openqa.selenium.SearchContext; import org.openqa.selenium.TimeoutException; import org.openqa.selenium.UnhandledAlertException; import org.openqa.selenium.WebDriver; import org.openqa.selenium.WebDriverException; import org.openqa.selenium.WebElement; import org.openqa.selenium.support.ui.ExpectedCondition; import org.openqa.selenium.support.ui.Select; import org.openqa.selenium.support.ui.WebDriverWait; import java.io.File; import java.lang.reflect.Method; import java.util.ArrayList; import java.util.List; import java.util.function.Function; import java.util.function.Supplier; public class BrowserTest extends SlimFixture { private SeleniumHelper seleniumHelper = getEnvironment().getSeleniumHelper(); private ReflectionHelper reflectionHelper = getEnvironment().getReflectionHelper(); private NgBrowserTest ngBrowserTest; private boolean implicitWaitForAngular = false; private boolean implicitFindInFrames = true; private int secondsBeforeTimeout; private int secondsBeforePageLoadTimeout; private int waitAfterScroll = 150; private String screenshotBase = new File(filesDir, "screenshots").getPath() + "/"; private String screenshotHeight = "200"; private String downloadBase = new File(filesDir, "downloads").getPath() + "/"; private String pageSourceBase = new File(filesDir, "pagesources").getPath() + "/"; @Override protected void beforeInvoke(Method method, Object[] arguments) { super.beforeInvoke(method, arguments); waitForAngularIfNeeded(method); } @Override protected Object invoke(final FixtureInteraction interaction, final Method method, final Object[] arguments) throws Throwable { Object result; WaitUntil waitUntil = reflectionHelper.getAnnotation(WaitUntil.class, method); if (waitUntil == null) { result = superInvoke(interaction, method, arguments); } else { result = invokedWrappedInWaitUntil(waitUntil, interaction, method, arguments); } return result; } protected Object invokedWrappedInWaitUntil(WaitUntil waitUntil, final FixtureInteraction interaction, final Method method, final Object[] arguments) { ExpectedCondition<Object> condition = new ExpectedCondition<Object>() { @Override public Object apply(WebDriver webDriver) { try { return superInvoke(interaction, method, arguments); } catch (Throwable e) { Throwable realEx = ExceptionHelper.stripReflectionException(e); if (realEx instanceof RuntimeException) { throw (RuntimeException) realEx; } else if (realEx instanceof Error) { throw (Error) realEx; } else { throw new RuntimeException(realEx); } } } }; condition = wrapConditionForFramesIfNeeded(condition); Object result; switch (waitUntil.value()) { case STOP_TEST: result = waitUntilOrStop(condition); break; case RETURN_NULL: result = waitUntilOrNull(condition); break; case RETURN_FALSE: result = waitUntilOrNull(condition) != null; break; case THROW: default: result = waitUntil(condition); break; } return result; } protected Object superInvoke(FixtureInteraction interaction, Method method, Object[] arguments) throws Throwable { return super.invoke(interaction, method, arguments); } /** * Determines whether the current method might require waiting for angular given the currently open site, * and ensure it does if needed. * @param method */ protected void waitForAngularIfNeeded(Method method) { if (isImplicitWaitForAngularEnabled()) { try { if (ngBrowserTest == null) { ngBrowserTest = new NgBrowserTest(); } if (ngBrowserTest.requiresWaitForAngular(method) && currentSiteUsesAngular()) { try { ngBrowserTest.waitForAngularRequestsToFinish(); } catch (Exception e) { // if something goes wrong, just use normal behavior: continue to invoke() System.err.print("Found Angular, but encountered an error while waiting for it to be ready. "); e.printStackTrace(); } } } catch (UnhandledAlertException e) { System.err.println("Cannot determine whether Angular is present while alert is active."); } catch (Exception e) { // if something goes wrong, just use normal behavior: continue to invoke() System.err.print("Error while determining whether Angular is present. "); e.printStackTrace(); } } } protected boolean currentSiteUsesAngular() { Object windowHasAngular = getSeleniumHelper().executeJavascript("return window.angular?1:0;"); return Long.valueOf(1).equals(windowHasAngular); } @Override protected Throwable handleException(Method method, Object[] arguments, Throwable t) { Throwable result; if (t instanceof UnhandledAlertException) { UnhandledAlertException e = (UnhandledAlertException) t; String alertText = e.getAlertText(); if (alertText == null) { alertText = alertText(); } String msgBase = "Unhandled alert: alert must be confirmed or dismissed before test can continue. Alert text: " + alertText; String msg = getSlimFixtureExceptionMessage("alertException", msgBase, e); result = new StopTestException(false, msg, t); } else if (t instanceof SlimFixtureException) { result = super.handleException(method, arguments, t); } else { String msg = getSlimFixtureExceptionMessage("exception", null, t); result = new SlimFixtureException(false, msg, t); } return result; } public BrowserTest() { secondsBeforeTimeout(seleniumHelper.getDefaultTimeoutSeconds()); ensureActiveTabIsNotClosed(); } public BrowserTest(int secondsBeforeTimeout) { secondsBeforeTimeout(secondsBeforeTimeout); ensureActiveTabIsNotClosed(); } public boolean open(String address) { final String url = getUrl(address); try { getNavigation().to(url); } catch (TimeoutException e) { handleTimeoutException(e); } finally { switchToDefaultContent(); } waitUntil(new ExpectedCondition<Boolean>() { @Override public Boolean apply(WebDriver webDriver) { String readyState = getSeleniumHelper().executeJavascript("return document.readyState").toString(); // IE 7 is reported to return "loaded" boolean done = "complete".equalsIgnoreCase(readyState) || "loaded".equalsIgnoreCase(readyState); if (!done) { System.err.printf("Open of %s returned while document.readyState was %s", url, readyState); System.err.println(); } return done; } }); return true; } public String location() { return driver().getCurrentUrl(); } public boolean back() { getNavigation().back(); switchToDefaultContent(); // firefox sometimes prevents immediate back, if previous page was reached via POST waitMilliseconds(500); WebElement element = findElement(By.id("errorTryAgain")); if (element != null) { element.click(); // don't use confirmAlert as this may be overridden in subclass and to get rid of the // firefox pop-up we need the basic behavior getSeleniumHelper().getAlert().accept(); } return true; } public boolean forward() { getNavigation().forward(); switchToDefaultContent(); return true; } public boolean refresh() { getNavigation().refresh(); switchToDefaultContent(); return true; } private WebDriver.Navigation getNavigation() { return getSeleniumHelper().navigate(); } @WaitUntil(TimeoutPolicy.RETURN_NULL) public String alertText() { Alert alert = getAlert(); String text = null; if (alert != null) { text = alert.getText(); } return text; } @WaitUntil public boolean confirmAlert() { Alert alert = getAlert(); boolean result = false; if (alert != null) { alert.accept(); onAlertHandled(true); result = true; } return result; } @WaitUntil public boolean dismissAlert() { Alert alert = getAlert(); boolean result = false; if (alert != null) { alert.dismiss(); onAlertHandled(false); result = true; } return result; } /** * Called when an alert is either dismissed or accepted. * @param accepted true if the alert was accepted, false if dismissed. */ protected void onAlertHandled(boolean accepted) { // if we were looking in nested frames, we could not go back to original frame // because of the alert. Ensure we do so now the alert is handled. getSeleniumHelper().resetFrameDepthOnAlertError(); } protected Alert getAlert() { return getSeleniumHelper().getAlert(); } public boolean openInNewTab(String url) { String cleanUrl = getUrl(url); final int tabCount = tabCount(); getSeleniumHelper().executeJavascript("window.open('%s', '_blank')", cleanUrl); // ensure new window is open waitUntil(new ExpectedCondition<Boolean>() { @Override public Boolean apply(WebDriver webDriver) { return tabCount() > tabCount; } }); return switchToNextTab(); } @WaitUntil public boolean switchToNextTab() { boolean result = false; List<String> tabs = getTabHandles(); if (tabs.size() > 1) { int currentTab = getCurrentTabIndex(tabs); int nextTab = currentTab + 1; if (nextTab == tabs.size()) { nextTab = 0; } goToTab(tabs, nextTab); result = true; } return result; } @WaitUntil public boolean switchToPreviousTab() { boolean result = false; List<String> tabs = getTabHandles(); if (tabs.size() > 1) { int currentTab = getCurrentTabIndex(tabs); int nextTab = currentTab - 1; if (nextTab < 0) { nextTab = tabs.size() - 1; } goToTab(tabs, nextTab); result = true; } return result; } public boolean closeTab() { boolean result = false; List<String> tabs = getTabHandles(); int currentTab = getCurrentTabIndex(tabs); int tabToGoTo = -1; if (currentTab > 0) { tabToGoTo = currentTab - 1; } else { if (tabs.size() > 1) { tabToGoTo = 1; } } if (tabToGoTo > -1) { WebDriver driver = driver(); driver.close(); goToTab(tabs, tabToGoTo); result = true; } return result; } public void ensureOnlyOneTab() { ensureActiveTabIsNotClosed(); int tabCount = tabCount(); for (int i = 1; i < tabCount; i++) { closeTab(); } } public boolean ensureActiveTabIsNotClosed() { boolean result = false; List<String> tabHandles = getTabHandles(); int currentTab = getCurrentTabIndex(tabHandles); if (currentTab < 0) { result = true; goToTab(tabHandles, 0); } return result; } public int tabCount() { return getTabHandles().size(); } public int currentTabIndex() { return getCurrentTabIndex(getTabHandles()) + 1; } protected int getCurrentTabIndex(List<String> tabHandles) { return getSeleniumHelper().getCurrentTabIndex(tabHandles); } protected void goToTab(List<String> tabHandles, int indexToGoTo) { getSeleniumHelper().goToTab(tabHandles, indexToGoTo); } protected List<String> getTabHandles() { return getSeleniumHelper().getTabHandles(); } /** * Activates main/top-level iframe (i.e. makes it the current frame). */ public void switchToDefaultContent() { getSeleniumHelper().switchToDefaultContent(); clearSearchContext(); } /** * Activates specified child frame of current iframe. * @param technicalSelector selector to find iframe. * @return true if iframe was found. */ public boolean switchToFrame(String technicalSelector) { boolean result = false; WebElement iframe = getElement(technicalSelector); if (iframe != null) { getSeleniumHelper().switchToFrame(iframe); result = true; } return result; } /** * Activates parent frame of current iframe. * Does nothing if when current frame is the main/top-level one. */ public void switchToParentFrame() { getSeleniumHelper().switchToParentFrame(); } public String pageTitle() { return getSeleniumHelper().getPageTitle(); } /** * @return current page's content type. */ public String pageContentType() { String result = null; Object ct = getSeleniumHelper().executeJavascript("return document.contentType;"); if (ct != null) { result = ct.toString(); } return result; } /** * Replaces content at place by value. * @param value value to set. * @param place element to set value on. * @return true, if element was found. */ @WaitUntil public boolean enterAs(String value, String place) { return enterAsIn(value, place, null); } /** * Replaces content at place by value. * @param value value to set. * @param place element to set value on. * @param container element containing place. * @return true, if element was found. */ @WaitUntil public boolean enterAsIn(String value, String place, String container) { return enter(value, place, container, true); } /** * Adds content to place. * @param value value to add. * @param place element to add value to. * @return true, if element was found. */ @WaitUntil public boolean enterFor(String value, String place) { return enterForIn(value, place, null); } /** * Adds content to place. * @param value value to add. * @param place element to add value to. * @param container element containing place. * @return true, if element was found. */ @WaitUntil public boolean enterForIn(String value, String place, String container) { return enter(value, place, container, false); } protected boolean enter(String value, String place, boolean shouldClear) { return enter(value, place, null, shouldClear); } protected boolean enter(String value, String place, String container, boolean shouldClear) { WebElement element = getElementToSendValue(place, container); return enter(element, value, shouldClear); } protected boolean enter(WebElement element, String value, boolean shouldClear) { boolean result = element != null && isInteractable(element); if (result) { if (isSelect(element)) { result = clickSelectOption(element, value); } else { if (shouldClear) { clear(element); } sendValue(element, value); } } return result; } @WaitUntil public boolean enterDateAs(String date, String place) { WebElement element = getElementToSendValue(place); boolean result = element != null && isInteractable(element); if (result) { getSeleniumHelper().fillDateInput(element, date); } return result; } protected WebElement getElementToSendValue(String place) { return getElementToSendValue(place, null); } protected WebElement getElementToSendValue(String place, String container) { return getElement(place, container); } /** * Simulates pressing the 'Tab' key. * @return true, if an element was active the key could be sent to. */ public boolean pressTab() { return sendKeysToActiveElement(Keys.TAB); } /** * Simulates pressing the 'Enter' key. * @return true, if an element was active the key could be sent to. */ public boolean pressEnter() { return sendKeysToActiveElement(Keys.ENTER); } /** * Simulates pressing the 'Esc' key. * @return true, if an element was active the key could be sent to. */ public boolean pressEsc() { return sendKeysToActiveElement(Keys.ESCAPE); } /** * Simulates typing a text to the current active element. * @param text text to type. * @return true, if an element was active the text could be sent to. */ public boolean type(String text) { String value = cleanupValue(text); return sendKeysToActiveElement(value); } public boolean press(String key) { CharSequence s; String[] parts = key.split("\\s*\\+\\s*"); if (parts.length > 1 && !"".equals(parts[0]) && !"".equals(parts[1])) { CharSequence[] sequence = new CharSequence[parts.length]; for (int i = 0; i < parts.length; i++) { sequence[i] = parseKey(parts[i]); } s = Keys.chord(sequence); } else { s = parseKey(key); } return sendKeysToActiveElement(s); } protected CharSequence parseKey(String key) { CharSequence s; try { s = Keys.valueOf(key.toUpperCase()); } catch (IllegalArgumentException e) { s = key; } return s; } /** * Simulates pressing keys. * @param keys keys to press. * @return true, if an element was active the keys could be sent to. */ protected boolean sendKeysToActiveElement(CharSequence keys) { boolean result = false; WebElement element = getSeleniumHelper().getActiveElement(); if (element != null) { element.sendKeys(keys); result = true; } return result; } /** * Sends Fitnesse cell content to element. * @param element element to call sendKeys() on. * @param value cell content. */ protected void sendValue(WebElement element, String value) { if (StringUtils.isNotEmpty(value)) { String keys = cleanupValue(value); element.sendKeys(keys); } } @WaitUntil public boolean selectAs(String value, String place) { return selectFor(value, place); } @WaitUntil public boolean selectFor(String value, String place) { WebElement element = getElementToSelectFor(place); return clickSelectOption(element, value); } @WaitUntil public boolean selectForIn(String value, String place, String container) { return doInContainer(container, () -> selectFor(value, place)); } @WaitUntil public boolean enterForHidden(final String value, final String idOrName) { return getSeleniumHelper().setHiddenInputValue(idOrName, value); } protected WebElement getElementToSelectFor(String selectPlace) { return getElement(selectPlace); } protected boolean clickSelectOption(WebElement element, String optionValue) { boolean result = false; if (element != null) { if (isSelect(element)) { optionValue = cleanupValue(optionValue); By optionBy = new OptionBy(optionValue); WebElement option = optionBy.findElement(element); if (option != null) { result = clickElement(option); } } } return result; } @WaitUntil public boolean click(final String place) { return clickImp(place, null); } @WaitUntil(TimeoutPolicy.RETURN_FALSE) public boolean clickIfAvailable(String place) { return clickIfAvailableIn(place, null); } @WaitUntil(TimeoutPolicy.RETURN_FALSE) public boolean clickIfAvailableIn(String place, String container) { return clickImp(place, container); } @WaitUntil public boolean clickIn(String place, String container) { return clickImp(place, container); } protected boolean clickImp(String place, String container) { boolean result = false; place = cleanupValue(place); try { WebElement element = getElementToClick(place, container); result = clickElement(element); } catch (WebDriverException e) { // if other element hides the element (in Chrome) an exception is thrown String msg = e.getMessage(); if (msg == null || !msg.contains("Other element would receive the click")) { throw e; } } return result; } @WaitUntil public boolean doubleClick(String place) { return doubleClickIn(place, null); } @WaitUntil public boolean doubleClickIn(String place, String container) { WebElement element = getElementToClick(place, container); return doubleClick(element); } protected boolean doubleClick(WebElement element) { boolean result = false; if (element != null) { scrollIfNotOnScreen(element); if (isInteractable(element)) { getSeleniumHelper().doubleClick(element); result = true; } } return result; } @WaitUntil public boolean rightClick(String place) { return rightClickIn(place, null); } @WaitUntil public boolean rightClickIn(String place, String container) { WebElement element = getElementToClick(place, container); return rightClick(element); } protected boolean rightClick(WebElement element) { boolean result = false; if (element != null) { scrollIfNotOnScreen(element); if (isInteractable(element)) { getSeleniumHelper().rightClick(element); result = true; } } return result; } @WaitUntil public boolean dragAndDropTo(String source, String destination) { WebElement sourceElement = getElementToClick(source); WebElement destinationElement = getElementToClick(destination); return dragAndDropTo(sourceElement, destinationElement); } protected boolean dragAndDropTo(WebElement sourceElement, WebElement destinationElement) { boolean result = false; if ((sourceElement != null) && (destinationElement != null)) { scrollIfNotOnScreen(sourceElement); if (isInteractable(sourceElement) && destinationElement.isDisplayed()) { getSeleniumHelper().dragAndDrop(sourceElement, destinationElement); result = true; } } return result; } protected WebElement getElementToClick(String place) { return getSeleniumHelper().getElementToClick(place); } protected WebElement getElementToClick(String place, String container) { return doInContainer(container, () -> getElementToClick(place)); } protected <T> T doInContainer(String container, Supplier<T> action) { T result = null; if (container == null) { result = action.get(); } else { WebElement containerElement = getContainerElement(container); if (containerElement != null) { result = doInContainer(containerElement, action); } } return result; } protected <T> T doInContainer(WebElement container, Supplier<T> action) { return getSeleniumHelper().doInContext(container, action); } @WaitUntil public boolean setSearchContextTo(String container) { boolean result = false; WebElement containerElement = getContainerElement(container); if (containerElement != null) { setSearchContextTo(containerElement); result = true; } return result; } protected void setSearchContextTo(SearchContext containerElement) { getSeleniumHelper().setCurrentContext(containerElement); } public void clearSearchContext() { getSeleniumHelper().setCurrentContext(null); } protected WebElement getContainerElement(String container) { return findByTechnicalSelectorOr(container, this::getContainerImpl); } protected WebElement getContainerImpl(String container) { return findElement(ContainerBy.heuristic(container)); } protected boolean clickElement(WebElement element) { boolean result = false; if (element != null) { scrollIfNotOnScreen(element); if (isInteractable(element)) { element.click(); result = true; } } return result; } protected boolean isInteractable(WebElement element) { return getSeleniumHelper().isInteractable(element); } @WaitUntil(TimeoutPolicy.STOP_TEST) public boolean waitForPage(String pageName) { return pageTitle().equals(pageName); } public boolean waitForTagWithText(String tagName, String expectedText) { return waitForElementWithText(By.tagName(tagName), expectedText); } public boolean waitForClassWithText(String cssClassName, String expectedText) { return waitForElementWithText(By.className(cssClassName), expectedText); } protected boolean waitForElementWithText(final By by, String expectedText) { final String textToLookFor = cleanExpectedValue(expectedText); return waitUntilOrStop(new ExpectedCondition<Boolean>() { @Override public Boolean apply(WebDriver webDriver) { boolean ok = false; List<WebElement> elements = webDriver.findElements(by); if (elements != null) { for (WebElement element : elements) { // we don't want stale elements to make single // element false, but instead we stop processing // current list and do a new findElements ok = hasText(element, textToLookFor); if (ok) { // no need to continue to check other elements break; } } } return ok; } }); } protected String cleanExpectedValue(String expectedText) { return cleanupValue(expectedText); } protected boolean hasText(WebElement element, String textToLookFor) { boolean ok; String actual = getElementText(element); if (textToLookFor == null) { ok = actual == null; } else { if (StringUtils.isEmpty(actual)) { String value = element.getAttribute("value"); if (!StringUtils.isEmpty(value)) { actual = value; } } if (actual != null) { actual = actual.trim(); } ok = textToLookFor.equals(actual); } return ok; } @WaitUntil(TimeoutPolicy.STOP_TEST) public boolean waitForClass(String cssClassName) { boolean ok = false; WebElement element = findElement(By.className(cssClassName)); if (element != null) { ok = true; } return ok; } @WaitUntil(TimeoutPolicy.STOP_TEST) public boolean waitForVisible(String place) { return waitForVisibleIn(place, null); } @WaitUntil(TimeoutPolicy.STOP_TEST) public boolean waitForVisibleIn(String place, String container) { Boolean result = Boolean.FALSE; WebElement element = getElementToCheckVisibility(place, container); if (element != null) { scrollIfNotOnScreen(element); result = element.isDisplayed(); } return result; } /** * @deprecated use #waitForVisible(xpath=) instead */ @Deprecated public boolean waitForXPathVisible(String xPath) { By by = By.xpath(xPath); return waitForVisible(by); } @Deprecated protected boolean waitForVisible(final By by) { return waitUntilOrStop(new ExpectedCondition<Boolean>() { @Override public Boolean apply(WebDriver webDriver) { Boolean result = Boolean.FALSE; WebElement element = findElement(by); if (element != null) { scrollIfNotOnScreen(element); result = element.isDisplayed(); } return result; } }); } @WaitUntil(TimeoutPolicy.RETURN_NULL) public String valueOf(String place) { return valueFor(place); } @WaitUntil(TimeoutPolicy.RETURN_NULL) public String valueFor(String place) { return valueForIn(place, null); } @WaitUntil(TimeoutPolicy.RETURN_NULL) public String valueOfIn(String place, String container) { return valueForIn(place, container); } @WaitUntil(TimeoutPolicy.RETURN_NULL) public String valueForIn(String place, String container) { WebElement element = getElementToRetrieveValue(place, container); return valueFor(element); } @WaitUntil(TimeoutPolicy.RETURN_NULL) public String normalizedValueOf(String place) { return normalizedValueFor(place); } @WaitUntil(TimeoutPolicy.RETURN_NULL) public String normalizedValueFor(String place) { return normalizedValueForIn(place, null); } @WaitUntil(TimeoutPolicy.RETURN_NULL) public String normalizedValueOfIn(String place, String container) { return normalizedValueForIn(place, container); } @WaitUntil(TimeoutPolicy.RETURN_NULL) public String normalizedValueForIn(String place, String container) { String value = valueForIn(place, container); return XPathBy.getNormalizedText(value); } @WaitUntil(TimeoutPolicy.RETURN_NULL) public String tooltipFor(String place) { return tooltipForIn(place, null); } @WaitUntil(TimeoutPolicy.RETURN_NULL) public String tooltipForIn(String place, String container) { return valueOfAttributeOnIn("title", place, container); } @WaitUntil public String targetOfLink(String place) { WebElement linkElement = getSeleniumHelper().getLink(place); return getLinkTarget(linkElement); } protected String getLinkTarget(WebElement linkElement) { String target = null; if (linkElement != null) { target = linkElement.getAttribute("href"); } return target; } @WaitUntil(TimeoutPolicy.RETURN_NULL) public String valueOfAttributeOn(String attribute, String place) { return valueOfAttributeOnIn(attribute, place, null); } @WaitUntil(TimeoutPolicy.RETURN_NULL) public String valueOfAttributeOnIn(String attribute, String place, String container) { String result = null; WebElement element = getElementToRetrieveValue(place, container); if (element != null) { result = element.getAttribute(attribute); } return result; } protected WebElement getElementToRetrieveValue(String place, String container) { return getElement(place, container); } protected String valueFor(By by) { WebElement element = getSeleniumHelper().findElement(by); return valueFor(element); } protected String valueFor(WebElement element) { String result = null; if (element != null) { if (isSelect(element)) { Select s = new Select(element); List<WebElement> options = s.getAllSelectedOptions(); if (options.size() > 0) { result = getElementText(options.get(0)); } } else { String elementType = element.getAttribute("type"); if ("checkbox".equals(elementType) || "radio".equals(elementType)) { result = String.valueOf(element.isSelected()); } else if ("li".equalsIgnoreCase(element.getTagName())) { result = getElementText(element); } else { result = element.getAttribute("value"); if (result == null) { result = getElementText(element); } } } } return result; } private boolean isSelect(WebElement element) { return "select".equalsIgnoreCase(element.getTagName()); } @WaitUntil(TimeoutPolicy.RETURN_NULL) public ArrayList<String> valuesOf(String place) { return valuesFor(place); } @WaitUntil(TimeoutPolicy.RETURN_NULL) public ArrayList<String> valuesOfIn(String place, String container) { return valuesForIn(place, container); } @WaitUntil(TimeoutPolicy.RETURN_NULL) public ArrayList<String> valuesFor(String place) { return valuesForIn(place, null); } @WaitUntil(TimeoutPolicy.RETURN_NULL) public ArrayList<String> valuesForIn(String place, String container) { ArrayList<String> values = null; WebElement element = getElementToRetrieveValue(place, container); if (element != null) { values = new ArrayList<String>(); String tagName = element.getTagName(); if ("ul".equalsIgnoreCase(tagName) || "ol".equalsIgnoreCase(tagName)) { List<WebElement> items = element.findElements(By.tagName("li")); for (WebElement item : items) { if (item.isDisplayed()) { values.add(getElementText(item)); } } } else if (isSelect(element)) { Select s = new Select(element); List<WebElement> options = s.getAllSelectedOptions(); for (WebElement item : options) { values.add(getElementText(item)); } } else { values.add(valueFor(element)); } } return values; } @WaitUntil(TimeoutPolicy.RETURN_NULL) public Integer numberFor(String place) { Integer number = null; WebElement element = findElement(ListItemBy.numbered(place)); if (element != null) { scrollIfNotOnScreen(element); number = getSeleniumHelper().getNumberFor(element); } return number; } @WaitUntil(TimeoutPolicy.RETURN_NULL) public Integer numberForIn(String place, String container) { return doInContainer(container, () -> numberFor(place)); } public ArrayList<String> availableOptionsFor(String place) { ArrayList<String> result = null; WebElement element = getElementToSelectFor(place); if (element != null) { scrollIfNotOnScreen(element); result = getSeleniumHelper().getAvailableOptions(element); } return result; } @WaitUntil public boolean clear(String place) { return clearIn(place, null); } @WaitUntil public boolean clearIn(String place, String container) { boolean result = false; WebElement element = getElementToClear(place, container); if (element != null) { clear(element); result = true; } return result; } protected void clear(WebElement element) { element.clear(); } protected WebElement getElementToClear(String place, String container) { return getElementToSendValue(place, container); } @WaitUntil public boolean enterAsInRowWhereIs(String value, String requestedColumnName, String selectOnColumn, String selectOnValue) { By cellBy = GridBy.columnInRowWhereIs(requestedColumnName, selectOnColumn, selectOnValue); WebElement element = findElement(cellBy); return enter(element, value, true); } @WaitUntil(TimeoutPolicy.RETURN_NULL) public String valueOfColumnNumberInRowNumber(int columnIndex, int rowIndex) { By by = GridBy.coordinates(columnIndex, rowIndex); return valueFor(by); } @WaitUntil(TimeoutPolicy.RETURN_NULL) public String valueOfInRowNumber(String requestedColumnName, int rowIndex) { By by = GridBy.columnInRow(requestedColumnName, rowIndex); return valueFor(by); } @WaitUntil(TimeoutPolicy.RETURN_NULL) public String valueOfInRowWhereIs(String requestedColumnName, String selectOnColumn, String selectOnValue) { By by = GridBy.columnInRowWhereIs(requestedColumnName, selectOnColumn, selectOnValue); return valueFor(by); } @WaitUntil(TimeoutPolicy.RETURN_FALSE) public boolean rowExistsWhereIs(String selectOnColumn, String selectOnValue) { return findElement(GridBy.rowWhereIs(selectOnColumn, selectOnValue)) != null; } @WaitUntil public boolean clickInRowNumber(String place, int rowIndex) { By rowBy = GridBy.rowNumber(rowIndex); return clickInRow(rowBy, place); } @WaitUntil public boolean clickInRowWhereIs(String place, String selectOnColumn, String selectOnValue) { By rowBy = GridBy.rowWhereIs(selectOnColumn, selectOnValue); return clickInRow(rowBy, place); } protected boolean clickInRow(By rowBy, String place) { boolean result = false; WebElement row = findElement(rowBy); if (row != null) { result = doInContainer(row, () -> click(place)); } return result; } /** * Downloads the target of a link in a grid's row. * @param place which link to download. * @param rowNumber (1-based) row number to retrieve link from. * @return downloaded file if any, null otherwise. */ @WaitUntil public String downloadFromRowNumber(String place, int rowNumber) { return downloadFromRow(GridBy.linkInRow(place, rowNumber)); } /** * Downloads the target of a link in a grid, finding the row based on one of the other columns' value. * @param place which link to download. * @param selectOnColumn column header of cell whose value must be selectOnValue. * @param selectOnValue value to be present in selectOnColumn to find correct row. * @return downloaded file if any, null otherwise. */ @WaitUntil public String downloadFromRowWhereIs(String place, String selectOnColumn, String selectOnValue) { return downloadFromRow(GridBy.linkInRowWhereIs(place, selectOnColumn, selectOnValue)); } protected String downloadFromRow(By linkBy) { String result = null; WebElement element = findElement(linkBy); if (element != null) { result = downloadLinkTarget(element); } return result; } protected WebElement getElement(String place) { return getSeleniumHelper().getElement(place); } protected WebElement getElement(String place, String container) { return doInContainer(container, () -> getElement(place)); } /** * @deprecated use #click(xpath=) instead. */ @WaitUntil @Deprecated public boolean clickByXPath(String xPath) { WebElement element = findByXPath(xPath); return clickElement(element); } /** * @deprecated use #valueOf(xpath=) instead. */ @WaitUntil(TimeoutPolicy.RETURN_NULL) @Deprecated public String textByXPath(String xPath) { return getTextByXPath(xPath); } protected String getTextByXPath(String xpathPattern, String... params) { WebElement element = findByXPath(xpathPattern, params); return getElementText(element); } /** * @deprecated use #valueOf(css=.) instead. */ @WaitUntil(TimeoutPolicy.RETURN_NULL) @Deprecated public String textByClassName(String className) { return getTextByClassName(className); } protected String getTextByClassName(String className) { WebElement element = findByClassName(className); return getElementText(element); } protected WebElement findByClassName(String className) { By by = By.className(className); return findElement(by); } protected WebElement findByXPath(String xpathPattern, String... params) { return getSeleniumHelper().findByXPath(xpathPattern, params); } protected WebElement findByCss(String cssPattern, String... params) { By by = getSeleniumHelper().byCss(cssPattern, params); return findElement(by); } protected WebElement findByJavascript(String script, Object... parameters) { By by = getSeleniumHelper().byJavascript(script, parameters); return findElement(by); } protected List<WebElement> findAllByXPath(String xpathPattern, String... params) { By by = getSeleniumHelper().byXpath(xpathPattern, params); return findElements(by); } protected List<WebElement> findAllByCss(String cssPattern, String... params) { By by = getSeleniumHelper().byCss(cssPattern, params); return findElements(by); } protected List<WebElement> findAllByJavascript(String script, Object... parameters) { By by = getSeleniumHelper().byJavascript(script, parameters); return findElements(by); } protected List<WebElement> findElements(By by) { return driver().findElements(by); } public void waitMilliSecondAfterScroll(int msToWait) { waitAfterScroll = msToWait; } protected int getWaitAfterScroll() { return waitAfterScroll; } protected String getElementText(WebElement element) { String result = null; if (element != null) { scrollIfNotOnScreen(element); result = getSeleniumHelper().getText(element); } return result; } /** * Scrolls browser window so top of place becomes visible. * @param place element to scroll to. */ @WaitUntil public boolean scrollTo(String place) { return scrollToIn(place, null); } /** * Scrolls browser window so top of place becomes visible. * @param place element to scroll to. * @param container parent of place. */ @WaitUntil public boolean scrollToIn(String place, String container) { boolean result = false; WebElement element = getElementToScrollTo(place, container); if (element != null) { scrollTo(element); result = true; } return result; } protected WebElement getElementToScrollTo(String place, String container) { return getElementToCheckVisibility(place, container); } /** * Scrolls browser window so top of element becomes visible. * @param element element to scroll to. */ protected void scrollTo(WebElement element) { getSeleniumHelper().scrollTo(element); waitAfterScroll(waitAfterScroll); } /** * Wait after the scroll if needed * @param msToWait amount of ms to wait after the scroll */ protected void waitAfterScroll(int msToWait) { if (msToWait > 0) { waitMilliseconds(msToWait); } } /** * Scrolls browser window if element is not currently visible so top of element becomes visible. * @param element element to scroll to. */ protected void scrollIfNotOnScreen(WebElement element) { if (!element.isDisplayed() || !isElementOnScreen(element)) { scrollTo(element); } } /** * Determines whether element is enabled (i.e. can be clicked). * @param place element to check. * @return true if element is enabled. */ @WaitUntil(TimeoutPolicy.RETURN_FALSE) public boolean isEnabled(String place) { return isEnabledIn(place, null); } /** * Determines whether element is enabled (i.e. can be clicked). * @param place element to check. * @param container parent of place. * @return true if element is enabled. */ @WaitUntil(TimeoutPolicy.RETURN_FALSE) public boolean isEnabledIn(String place, String container) { boolean result = false; WebElement element = getElementToCheckVisibility(place, container); if (element != null) { if ("label".equalsIgnoreCase(element.getTagName())) { // for labels we want to know whether their target is enabled, not the label itself WebElement labelTarget = getSeleniumHelper().getLabelledElement(element); if (labelTarget != null) { element = labelTarget; } } result = element.isEnabled(); } return result; } /** * Determines whether element can be see in browser's window. * @param place element to check. * @return true if element is displayed and in viewport. */ @WaitUntil(TimeoutPolicy.RETURN_FALSE) public boolean isVisible(String place) { return isVisibleIn(place, null); } /** * Determines whether element can be see in browser's window. * @param place element to check. * @param container parent of place. * @return true if element is displayed and in viewport. */ @WaitUntil(TimeoutPolicy.RETURN_FALSE) public boolean isVisibleIn(String place, String container) { return isVisibleImpl(place, container, true); } /** * Determines whether element is somewhere in browser's window. * @param place element to check. * @return true if element is displayed. */ @WaitUntil(TimeoutPolicy.RETURN_FALSE) public boolean isVisibleOnPage(String place) { return isVisibleOnPageIn(place, null); } /** * Determines whether element is somewhere in browser's window. * @param place element to check. * @param container parent of place. * @return true if element is displayed. */ @WaitUntil(TimeoutPolicy.RETURN_FALSE) public boolean isVisibleOnPageIn(String place, String container) { return isVisibleImpl(place, container, false); } protected boolean isVisibleImpl(String place, String container, boolean checkOnScreen) { WebElement element = getElementToCheckVisibility(place, container); return getSeleniumHelper().checkVisible(element, checkOnScreen); } public int numberOfTimesIsVisible(String text) { return numberOfTimesIsVisibleInImpl(text, true); } public int numberOfTimesIsVisibleOnPage(String text) { return numberOfTimesIsVisibleInImpl(text, false); } public int numberOfTimesIsVisibleIn(String text, String container) { return doInContainer(container, () -> numberOfTimesIsVisible(text)); } public int numberOfTimesIsVisibleOnPageIn(String text, String container) { return doInContainer(container, () -> numberOfTimesIsVisibleOnPage(text)); } protected int numberOfTimesIsVisibleInImpl(String text, boolean checkOnScreen) { return getSeleniumHelper().countVisibleOccurrences(text, checkOnScreen); } protected WebElement getElementToCheckVisibility(String place) { WebElement result = findElement(TextBy.partial(place)); if (result == null || !result.isDisplayed()) { result = getElementToClick(place); } return result; } protected WebElement getElementToCheckVisibility(String place, String container) { return doInContainer(container, () -> findByTechnicalSelectorOr(place, this::getElementToCheckVisibility)); } /** * Checks whether element is in browser's viewport. * @param element element to check * @return true if element is in browser's viewport. */ protected boolean isElementOnScreen(WebElement element) { Boolean onScreen = getSeleniumHelper().isElementOnScreen(element); return onScreen == null || onScreen.booleanValue(); } @WaitUntil public boolean hoverOver(String place) { return hoverOverIn(place, null); } @WaitUntil public boolean hoverOverIn(String place, String container) { WebElement element = getElementToClick(place, container); return hoverOver(element); } protected boolean hoverOver(WebElement element) { boolean result = false; if (element != null) { scrollIfNotOnScreen(element); if (element.isDisplayed()) { getSeleniumHelper().hoverOver(element); result = true; } } return result; } /** * @param timeout number of seconds before waitUntil() and waitForJavascriptCallback() throw TimeOutException. */ public void secondsBeforeTimeout(int timeout) { secondsBeforeTimeout = timeout; secondsBeforePageLoadTimeout(timeout); int timeoutInMs = timeout * 1000; getSeleniumHelper().setScriptWait(timeoutInMs); } /** * @return number of seconds waitUntil() will wait at most. */ public int secondsBeforeTimeout() { return secondsBeforeTimeout; } /** * @param timeout number of seconds before waiting for a new page to load will throw a TimeOutException. */ public void secondsBeforePageLoadTimeout(int timeout) { secondsBeforePageLoadTimeout = timeout; int timeoutInMs = timeout * 1000; getSeleniumHelper().setPageLoadWait(timeoutInMs); } /** * @return number of seconds Selenium will wait at most for a request to load a page. */ public int secondsBeforePageLoadTimeout() { return secondsBeforePageLoadTimeout; } /** * Clears HTML5's localStorage (for the domain of the current open page in the browser). */ public void clearLocalStorage() { getSeleniumHelper().executeJavascript("localStorage.clear();"); } /** * Deletes all cookies(for the domain of the current open page in the browser). */ public void deleteAllCookies() { getSeleniumHelper().deleteAllCookies(); } /** * @param directory sets base directory where screenshots will be stored. */ public void screenshotBaseDirectory(String directory) { if (directory.equals("") || directory.endsWith("/") || directory.endsWith("\\")) { screenshotBase = directory; } else { screenshotBase = directory + "/"; } } /** * @param height height to use to display screenshot images */ public void screenshotShowHeight(String height) { screenshotHeight = height; } /** * @return (escaped) HTML content of current page. */ public String pageSource() { String result = null; String html = getSeleniumHelper().getHtml(); if (html != null) { result = "<pre>" + StringEscapeUtils.escapeHtml4(html) + "</pre>"; } return result; } /** * Saves current page's source to the wiki'f files section and returns a link to the * created file. * @return hyperlink to the file containing the page source. */ public String savePageSource() { String fileName = getSeleniumHelper().getResourceNameFromLocation(); return savePageSource(fileName, fileName + ".html"); } protected String savePageSource(String fileName, String linkText) { PageSourceSaver saver = getSeleniumHelper().getPageSourceSaver(pageSourceBase); // make href to file String url = saver.savePageSource(fileName); return String.format("<a href=\"%s\">%s</a>", url, linkText); } /** * Takes screenshot from current page * @param basename filename (below screenshot base directory). * @return location of screenshot. */ public String takeScreenshot(String basename) { try { String screenshotFile = createScreenshot(basename); if (screenshotFile == null) { throw new SlimFixtureException(false, "Unable to take screenshot: does the webdriver support it?"); } else { screenshotFile = getScreenshotLink(screenshotFile); } return screenshotFile; } catch (UnhandledAlertException e) { // standard behavior will stop test, this breaks storyboard that will attempt to take screenshot // after triggering alert, but before the alert can be handled. // so we output a message but no exception. We rely on a next line to actually handle alert // (which may mean either really handle or stop test). return String.format( "<div><strong>Unable to take screenshot</strong>, alert is active. Alert text:<br/>" + "'<span>%s</span>'</div>", StringEscapeUtils.escapeHtml4(alertText())); } } private String getScreenshotLink(String screenshotFile) { String wikiUrl = getWikiUrl(screenshotFile); if (wikiUrl != null) { // make href to screenshot if ("".equals(screenshotHeight)) { wikiUrl = String.format("<a href=\"%s\">%s</a>", wikiUrl, screenshotFile); } else { wikiUrl = String.format("<a href=\"%1$s\"><img src=\"%1$s\" title=\"%2$s\" height=\"%3$s\"/></a>", wikiUrl, screenshotFile, screenshotHeight); } screenshotFile = wikiUrl; } return screenshotFile; } private String createScreenshot(String basename) { String name = getScreenshotBasename(basename); return getSeleniumHelper().takeScreenshot(name); } private String createScreenshot(String basename, Throwable t) { String screenshotFile; byte[] screenshotInException = getSeleniumHelper().findScreenshot(t); if (screenshotInException == null || screenshotInException.length == 0) { screenshotFile = createScreenshot(basename); } else { String name = getScreenshotBasename(basename); screenshotFile = getSeleniumHelper().writeScreenshot(name, screenshotInException); } return screenshotFile; } private String getScreenshotBasename(String basename) { return screenshotBase + basename; } /** * Waits until the condition evaluates to a value that is neither null nor * false. Because of this contract, the return type must not be Void. * @param <T> the return type of the method, which must not be Void * @param condition condition to evaluate to determine whether waiting can be stopped. * @throws SlimFixtureException if condition was not met before secondsBeforeTimeout. * @return result of condition. */ protected <T> T waitUntil(ExpectedCondition<T> condition) { try { return waitUntilImpl(condition); } catch (TimeoutException e) { String message = getTimeoutMessage(e); return lastAttemptBeforeThrow(condition, new SlimFixtureException(false, message, e)); } } /** * Waits until the condition evaluates to a value that is neither null nor * false. If that does not occur the whole test is stopped. * Because of this contract, the return type must not be Void. * @param <T> the return type of the method, which must not be Void * @param condition condition to evaluate to determine whether waiting can be stopped. * @throws TimeoutStopTestException if condition was not met before secondsBeforeTimeout. * @return result of condition. */ protected <T> T waitUntilOrStop(ExpectedCondition<T> condition) { try { return waitUntilImpl(condition); } catch (TimeoutException e) { try { return handleTimeoutException(e); } catch (TimeoutStopTestException tste) { return lastAttemptBeforeThrow(condition, tste); } } } /** * Tries the condition one last time before throwing an exception. * This to prevent exception messages in the wiki that show no problem, which could happen if the browser's * window content has changed between last (failing) try at condition and generation of the exception. * @param <T> the return type of the method, which must not be Void * @param condition condition that caused exception. * @param e exception that will be thrown if condition does not return a result. * @return last attempt results, if not null. * @throws SlimFixtureException throws e if last attempt returns null. */ protected <T> T lastAttemptBeforeThrow(ExpectedCondition<T> condition, SlimFixtureException e) { T lastAttemptResult = null; try { // last attempt to ensure condition has not been met // this to prevent messages that show no problem lastAttemptResult = condition.apply(getSeleniumHelper().driver()); } catch (Throwable t) { // ignore } if (lastAttemptResult != null) { return lastAttemptResult; } throw e; } /** * Waits until the condition evaluates to a value that is neither null nor * false. If that does not occur null is returned. * Because of this contract, the return type must not be Void. * @param <T> the return type of the method, which must not be Void * @param condition condition to evaluate to determine whether waiting can be stopped. * @return result of condition. */ protected <T> T waitUntilOrNull(ExpectedCondition<T> condition) { try { return waitUntilImpl(condition); } catch (TimeoutException e) { return null; } } protected <T> T waitUntilImpl(ExpectedCondition<T> condition) { return getSeleniumHelper().waitUntil(secondsBeforeTimeout(), condition); } protected <T> T handleTimeoutException(TimeoutException e) { String message = getTimeoutMessage(e); throw new TimeoutStopTestException(false, message, e); } private String getTimeoutMessage(TimeoutException e) { String messageBase = String.format("Timed-out waiting (after %ss)", secondsBeforeTimeout()); return getSlimFixtureExceptionMessage("timeouts", "timeout", messageBase, e); } protected void handleRequiredElementNotFound(String toFind) { handleRequiredElementNotFound(toFind, null); } protected void handleRequiredElementNotFound(String toFind, Throwable t) { String messageBase = String.format("Unable to find: %s", toFind); String message = getSlimFixtureExceptionMessage("notFound", toFind, messageBase, t); throw new SlimFixtureException(false, message, t); } protected String getSlimFixtureExceptionMessage(String screenshotFolder, String screenshotFile, String messageBase, Throwable t) { String screenshotBaseName = String.format("%s/%s/%s", screenshotFolder, getClass().getSimpleName(), screenshotFile); return getSlimFixtureExceptionMessage(screenshotBaseName, messageBase, t); } protected String getSlimFixtureExceptionMessage(String screenshotBaseName, String messageBase, Throwable t) { // take a screenshot of what was on screen String screenShotFile = null; try { screenShotFile = createScreenshot(screenshotBaseName, t); } catch (UnhandledAlertException e) { System.err.println("Unable to take screenshot while alert is present for exception: " + messageBase); } catch (Exception sse) { System.err.println("Unable to take screenshot for exception: " + messageBase); sse.printStackTrace(); } String message = messageBase; if (message == null) { if (t == null) { message = ""; } else { message = ExceptionUtils.getStackTrace(t); } } if (screenShotFile != null) { String label = "Page content"; try { String fileName; if (t != null) { fileName = t.getClass().getName(); } else if (screenshotBaseName != null) { fileName = screenshotBaseName; } else { fileName = "exception"; } label = savePageSource(fileName, label); } catch (UnhandledAlertException e) { System.err.println("Unable to capture page source while alert is present for exception: " + messageBase); } catch (Exception e) { System.err.println("Unable to capture page source for exception: " + messageBase); e.printStackTrace(); } String exceptionMsg = formatExceptionMsg(message); message = String.format("<div><div>%s.</div><div>%s:%s</div></div>", exceptionMsg, label, getScreenshotLink(screenShotFile)); } return message; } protected String formatExceptionMsg(String value) { return StringEscapeUtils.escapeHtml4(value); } private WebDriver driver() { return getSeleniumHelper().driver(); } private WebDriverWait waitDriver() { return getSeleniumHelper().waitDriver(); } /** * @return helper to use. */ protected final SeleniumHelper getSeleniumHelper() { return seleniumHelper; } /** * Sets SeleniumHelper to use, for testing purposes. * @param helper helper to use. */ protected void setSeleniumHelper(SeleniumHelper helper) { seleniumHelper = helper; } public int currentBrowserWidth() { return getWindowSize().getWidth(); } public int currentBrowserHeight() { return getWindowSize().getHeight(); } public void setBrowserWidth(int newWidth) { int currentHeight = currentBrowserHeight(); setBrowserSizeToBy(newWidth, currentHeight); } public void setBrowserHeight(int newHeight) { int currentWidth = currentBrowserWidth(); setBrowserSizeToBy(currentWidth, newHeight); } public void setBrowserSizeToBy(int newWidth, int newHeight) { getSeleniumHelper().setWindowSize(newWidth, newHeight); Dimension actualSize = getWindowSize(); if (actualSize.getHeight() != newHeight || actualSize.getWidth() != newWidth) { String message = String.format("Unable to change size to: %s x %s; size is: %s x %s", newWidth, newHeight, actualSize.getWidth(), actualSize.getHeight()); throw new SlimFixtureException(false, message); } } protected Dimension getWindowSize() { return getSeleniumHelper().getWindowSize(); } public void setBrowserSizeToMaximum() { getSeleniumHelper().setWindowSizeToMaximum(); } /** * Downloads the target of the supplied link. * @param place link to follow. * @return downloaded file if any, null otherwise. */ @WaitUntil public String download(String place) { WebElement element = getSeleniumHelper().getLink(place); return downloadLinkTarget(element); } /** * Downloads the target of the supplied link. * @param place link to follow. * @param container part of screen containing link. * @return downloaded file if any, null otherwise. */ @WaitUntil public String downloadIn(String place, String container) { return doInContainer(container, () -> download(place)); } protected WebElement findElement(By selector) { return getSeleniumHelper().findElement(selector); } public WebElement findByTechnicalSelectorOr(String place, Function<String, WebElement> supplierF) { return getSeleniumHelper().findByTechnicalSelectorOr(place, () -> supplierF.apply(place)); } /** * Downloads the target of the supplied link. * @param element link to follow. * @return downloaded file if any, null otherwise. */ protected String downloadLinkTarget(WebElement element) { String result; String href = getLinkTarget(element); if (href != null) { result = downloadContentFrom(href); } else { throw new SlimFixtureException(false, "Could not determine url to download from"); } return result; } /** * Downloads binary content from specified url (using the browser's cookies). * @param urlOrLink url to download from * @return link to downloaded file */ public String downloadContentFrom(String urlOrLink) { String result = null; if (urlOrLink != null) { String url = getUrl(urlOrLink); BinaryHttpResponse resp = new BinaryHttpResponse(); getUrlContent(url, resp); byte[] content = resp.getResponseContent(); if (content == null) { result = resp.getResponse(); } else { String fileName = resp.getFileName(); if (StringUtils.isEmpty(fileName)) { fileName = "download"; } String baseName = FilenameUtils.getBaseName(fileName); String ext = FilenameUtils.getExtension(fileName); String downloadedFile = FileUtil.saveToFile(getDownloadName(baseName), ext, content); String wikiUrl = getWikiUrl(downloadedFile); if (wikiUrl != null) { // make href to file result = String.format("<a href=\"%s\">%s</a>", wikiUrl, fileName); } else { result = downloadedFile; } } } return result; } /** * Selects a file using the first file upload control. * @param fileName file to upload * @return true, if a file input was found and file existed. */ @WaitUntil public boolean selectFile(String fileName) { return selectFileFor(fileName, "css=input[type='file']"); } /** * Selects a file using a file upload control. * @param fileName file to upload * @param place file input to select the file for * @return true, if place was a file input and file existed. */ @WaitUntil public boolean selectFileFor(String fileName, String place) { return selectFileForIn(fileName, place, null); } /** * Selects a file using a file upload control. * @param fileName file to upload * @param place file input to select the file for * @param container part of screen containing place * @return true, if place was a file input and file existed. */ @WaitUntil public boolean selectFileForIn(String fileName, String place, String container) { boolean result = false; if (fileName != null) { String fullPath = getFilePathFromWikiUrl(fileName); if (new File(fullPath).exists()) { WebElement element = getElementToSelectFile(place, container); if (element != null) { element.sendKeys(fullPath); result = true; } } else { throw new SlimFixtureException(false, "Unable to find file: " + fullPath); } } return result; } protected WebElement getElementToSelectFile(String place, String container) { WebElement result = null; WebElement element = getElement(place, container); if (element != null && "input".equalsIgnoreCase(element.getTagName()) && "file".equalsIgnoreCase(element.getAttribute("type"))) { result = element; } return result; } private String getDownloadName(String baseName) { return downloadBase + baseName; } /** * GETs content of specified URL, using the browsers cookies. * @param url url to retrieve content from * @param resp response to store content in */ protected void getUrlContent(String url, HttpResponse resp) { getEnvironment().addSeleniumCookies(resp); getEnvironment().doGet(url, resp); } /** * Gets the value of the cookie with the supplied name. * @param cookieName name of cookie to get value from. * @return cookie's value if any. */ public String cookieValue(String cookieName) { String result = null; Cookie cookie = getSeleniumHelper().getCookie(cookieName); if (cookie != null) { result = cookie.getValue(); } return result; } public boolean refreshUntilValueOfIs(String place, String expectedValue) { return repeatUntil(getRefreshUntilValueIs(place, expectedValue)); } public boolean refreshUntilValueOfIsNot(String place, String expectedValue) { return repeatUntilNot(getRefreshUntilValueIs(place, expectedValue)); } protected RepeatUntilValueIsCompletion getRefreshUntilValueIs(String place, String expectedValue) { return new RepeatUntilValueIsCompletion(place, expectedValue) { @Override public void repeat() { refresh(); } }; } public boolean clickUntilValueOfIs(String clickPlace, String checkPlace, String expectedValue) { return repeatUntil(getClickUntilValueIs(clickPlace, checkPlace, expectedValue)); } public boolean clickUntilValueOfIsNot(String clickPlace, String checkPlace, String expectedValue) { return repeatUntilNot(getClickUntilValueIs(clickPlace, checkPlace, expectedValue)); } protected RepeatUntilValueIsCompletion getClickUntilValueIs(String clickPlace, String checkPlace, String expectedValue) { String place = cleanupValue(clickPlace); return getClickUntilCompletion(place, checkPlace, expectedValue); } protected RepeatUntilValueIsCompletion getClickUntilCompletion(String place, String checkPlace, String expectedValue) { ExpectedCondition<Object> condition = wrapConditionForFramesIfNeeded(webDriver -> click(place)); return new RepeatUntilValueIsCompletion(checkPlace, expectedValue) { @Override public void repeat() { waitUntil(condition); } }; } protected <T> ExpectedCondition<T> wrapConditionForFramesIfNeeded(ExpectedCondition<T> condition) { if (implicitFindInFrames) { condition = getSeleniumHelper().conditionForAllFrames(condition); } return condition; } @Override protected boolean repeatUntil(RepeatCompletion repeat) { // During repeating we reduce the timeout used for finding elements, // but the page load timeout is kept as-is (which takes extra work because secondsBeforeTimeout(int) // also changes that. int previousTimeout = secondsBeforeTimeout(); int pageLoadTimeout = secondsBeforePageLoadTimeout(); try { int timeoutDuringRepeat = Math.max((Math.toIntExact(repeatInterval() / 1000)), 1); secondsBeforeTimeout(timeoutDuringRepeat); secondsBeforePageLoadTimeout(pageLoadTimeout); return super.repeatUntil(repeat); } finally { secondsBeforeTimeout(previousTimeout); secondsBeforePageLoadTimeout(pageLoadTimeout); } } protected abstract class RepeatUntilValueIsCompletion implements RepeatCompletion { private final String place; private final String expectedValue; protected RepeatUntilValueIsCompletion(String place, String expectedValue) { this.place = place; this.expectedValue = cleanExpectedValue(expectedValue); } @Override public boolean isFinished() { ExpectedCondition<Boolean> condition = wrapConditionForFramesIfNeeded(webDriver -> checkValueImpl()); Boolean valueFound = waitUntilOrNull(condition); return valueFound != null && valueFound; } protected boolean checkValueImpl() { boolean match; String actual = valueOf(place); if (expectedValue == null) { match = actual == null; } else { match = expectedValue.equals(actual); } return match; } } protected Object waitForJavascriptCallback(String statement, Object... parameters) { try { return getSeleniumHelper().waitForJavascriptCallback(statement, parameters); } catch (TimeoutException e) { return handleTimeoutException(e); } } public NgBrowserTest getNgBrowserTest() { return ngBrowserTest; } public void setNgBrowserTest(NgBrowserTest ngBrowserTest) { this.ngBrowserTest = ngBrowserTest; } public boolean isImplicitWaitForAngularEnabled() { return implicitWaitForAngular; } public void setImplicitWaitForAngularTo(boolean implicitWaitForAngular) { this.implicitWaitForAngular = implicitWaitForAngular; } public void setImplicitFindInFramesTo(boolean implicitFindInFrames) { this.implicitFindInFrames = implicitFindInFrames; } /** * Executes javascript in the browser. * @param script you want to execute * @return result from script */ public Object executeScript(String script) { String statement = cleanupValue(script); return getSeleniumHelper().executeJavascript(statement); } }
package org.appwork.utils.swing.table; import java.awt.Color; import java.awt.Component; import java.awt.Container; import java.awt.Cursor; import java.awt.Dimension; import java.awt.Graphics; import java.awt.Graphics2D; import java.awt.Point; import java.awt.Rectangle; import java.awt.Toolkit; import java.awt.event.ActionEvent; import java.awt.event.ActionListener; import java.awt.event.KeyEvent; import java.awt.event.MouseAdapter; import java.awt.event.MouseEvent; import java.beans.PropertyChangeEvent; import java.beans.PropertyChangeListener; import java.io.IOException; import java.net.URL; import java.util.ArrayList; import java.util.LinkedHashMap; import javax.swing.JButton; import javax.swing.JComponent; import javax.swing.JPopupMenu; import javax.swing.JScrollPane; import javax.swing.JTable; import javax.swing.JViewport; import javax.swing.KeyStroke; import javax.swing.ScrollPaneConstants; import javax.swing.event.ChangeEvent; import javax.swing.event.ListSelectionEvent; import javax.swing.event.ListSelectionListener; import javax.swing.event.TableColumnModelEvent; import javax.swing.event.TableColumnModelListener; import javax.swing.table.TableCellEditor; import javax.swing.table.TableCellRenderer; import javax.swing.table.TableColumn; import javax.swing.table.TableColumnModel; import org.appwork.app.gui.MigPanel; import org.appwork.storage.JSonStorage; import org.appwork.utils.Application; import org.appwork.utils.BinaryLogic; import org.appwork.utils.images.IconIO; import org.appwork.utils.logging.Log; import org.appwork.utils.swing.EDTHelper; public class ExtTable<E> extends JTable { private static final long serialVersionUID = 2822230056021924679L; /** * Column background color if column is NOT selected */ private final Color columnBackground; /** * Column background color if column is selected */ private final Color columnBackgroundSelected; /** * Column textcolor if column is NOT selected */ private final Color columnForeground; /** * Column textcolor if column is selected */ private final Color columnForegroundSelected; /** * The underlaying datamodel */ private final ExtTableModel<E> model; /** * TableID. Used to generate a key for saving internal data to database */ private final String tableID; final private ArrayList<ExtRowHighlighter> rowHighlighters; /** * true if search is enabled */ private boolean searchEnabled = false; private SearchDialog searchDialog; private final ExtTableEventSender eventSender; private JComponent columnButton = null; private boolean columnButtonVisible = true; private int verticalScrollPolicy; /** * @param downloadTableModel */ public ExtTable(final ExtTableModel<E> tableModel) { this(tableModel, tableModel.getModelID() + "-Table"); } /** * Create an Extended Table instance * * @param model * Databsemodel * @param database * Information storage interface. * @param id * Tableid used for storage */ public ExtTable(final ExtTableModel<E> model, final String id) { super(model); this.eventSender = new ExtTableEventSender(); this.tableID = id; this.rowHighlighters = new ArrayList<ExtRowHighlighter>(); this.model = model; // workaround this.setColumnModel(new ExtColumnModel(this.getColumnModel())); model.setTable(this); this.createColumns(); // get defaultbackground and Foregroundcolors Component c = super.getCellRenderer(0, 0).getTableCellRendererComponent(this, "", true, false, 0, 0); this.columnBackgroundSelected = c.getBackground(); this.columnForegroundSelected = c.getForeground(); c = super.getCellRenderer(0, 0).getTableCellRendererComponent(this, "", false, false, 0, 0); this.columnBackground = c.getBackground(); this.columnForeground = c.getForeground(); // Mouselistener for columnselection Menu and sort on click this.getTableHeader().addMouseListener(new MouseAdapter() { int columnPressed = 0; @Override public void mousePressed(final MouseEvent e) { // only if we are not in resize mode if (ExtTable.this.getTableHeader().getCursor().getType() == Cursor.getDefaultCursor().getType()) { if (e.getButton() == MouseEvent.BUTTON1) { this.columnPressed = ExtTable.this.columnAtPoint(e.getPoint()); } else if (e.getButton() == MouseEvent.BUTTON3) { final JPopupMenu ccm = ExtTable.this.columnControlMenu(ExtTable.this.getExtColumnAtPoint(e.getPoint())); ccm.show(ExtTable.this.getTableHeader(), e.getX(), e.getY()); if (ccm.getComponentCount() == 0) { Toolkit.getDefaultToolkit().beep(); } } } } @Override public void mouseReleased(final MouseEvent e) { if (ExtTable.this.getTableHeader().getCursor().getType() == Cursor.getDefaultCursor().getType()) { if (e.getButton() == MouseEvent.BUTTON1) { if (this.columnPressed != ExtTable.this.columnAtPoint(e.getPoint())) { return; } final int col = ExtTable.this.getExtColumnIndexByPoint(e.getPoint()); if (col == -1) { return; } if (ExtTable.this.getExtTableModel().getExtColumn(col).isSortable(null)) { ExtTable.this.getExtTableModel().getExtColumn(col).doSort(null); } } } } }); // mouselistener to display column header tooltips this.getTableHeader().addMouseMotionListener(new MouseAdapter() { @Override public void mouseMoved(final MouseEvent e) { final int col = ExtTable.this.getExtColumnIndexByPoint(e.getPoint()); if (col >= 0) { ExtTable.this.getTableHeader().setToolTipText(ExtTable.this.getExtTableModel().getExtColumn(col).getName()); } } }); this.getSelectionModel().addListSelectionListener(new ListSelectionListener() { @SuppressWarnings("unchecked") public void valueChanged(final ListSelectionEvent e) { ArrayList<E> sel = ExtTable.this.getExtTableModel().getSelectedObjects(); if (sel != null && sel.size() == 0) { sel = null; } ExtTable.this.onSelectionChanged(sel); ExtTable.this.eventSender.fireEvent(new ExtTableEvent<ArrayList<E>>(ExtTable.this, ExtTableEvent.Types.SELECTION_CHANGED, sel)); } }); this.getTableHeader().setReorderingAllowed(true); this.getTableHeader().setResizingAllowed(true); this.setAutoResizeMode(JTable.AUTO_RESIZE_SUBSEQUENT_COLUMNS); this.setAutoscrolls(true); this.getTableHeader().setPreferredSize(new Dimension(this.getColumnModel().getTotalColumnWidth(), 19)); // assures that the table is painted over the complete available high // This method is 1.6 only if (Application.getJavaVersion() >= 16000000) { this.setFillsViewportHeight(true); } this.getColumnModel().addColumnModelListener(new TableColumnModelListener() { public void columnAdded(final TableColumnModelEvent e) { } public void columnMarginChanged(final ChangeEvent e) { } public void columnMoved(final TableColumnModelEvent e) { if (e == null) { return; } if (e.getFromIndex() == e.getToIndex()) { return; } final TableColumnModel tcm = ExtTable.this.getColumnModel(); for (int i = 0; i < tcm.getColumnCount(); i++) { try { JSonStorage.getStorage("ExtTable_" + ExtTable.this.tableID).put("POS_COL_" + i, ExtTable.this.getExtTableModel().getExtColumn(tcm.getColumn(i).getModelIndex()).getID()); } catch (final Exception e1) { Log.exception(e1); } } } public void columnRemoved(final TableColumnModelEvent e) { } public void columnSelectionChanged(final ListSelectionEvent e) { } }); } /** * adds a row highlighter * * @param highlighter */ public void addRowHighlighter(final ExtRowHighlighter highlighter) { this.removeRowHighlighter(highlighter); this.rowHighlighters.add(highlighter); } /** * create Columnselection popupmenu. It contains all available columns and * let's the user select. The menu does not autoclose on click. * * @param extColumn * * @return */ protected JPopupMenu columnControlMenu(final ExtColumn<E> extColumn) { JPopupMenu popup; if (extColumn == null) { // controlbutton popup = new JPopupMenu(); for (int i = 0; i < this.getExtTableModel().getColumnCount(); i++) { this.getExtTableModel().getExtColumn(i).extendControlButtonMenu(popup); } } else { popup = extColumn.createHeaderPopup(); if (popup == null) { popup = new JPopupMenu(); } } for (int i = 0; i < this.getExtTableModel().getColumnCount(); ++i) { final int j = i; if (this.getExtTableModel().isHidable(i)) { final ExtCheckBoxMenuItem mi = new ExtCheckBoxMenuItem(this.getExtTableModel().getColumnName(i)); mi.setHideOnClick(false); // mis[i] = mi; mi.setSelected(this.getExtTableModel().isVisible(i)); mi.addActionListener(new ActionListener() { public void actionPerformed(final ActionEvent e) { ExtTable.this.getExtTableModel().setVisible(j, mi.isSelected()); ExtTable.this.createColumns(); ExtTable.this.revalidate(); ExtTable.this.repaint(); } }); popup.add(mi); } } return popup; } @Override protected void configureEnclosingScrollPane() { super.configureEnclosingScrollPane(); this.reconfigureColumnButton(); } /** * Creates the columns based on the model */ private void createColumns() { final TableColumnModel tcm = this.getColumnModel(); while (tcm.getColumnCount() > 0) { tcm.removeColumn(tcm.getColumn(0)); } final LinkedHashMap<String, TableColumn> columns = new LinkedHashMap<String, TableColumn>(); for (int i = 0; i < this.getModel().getColumnCount(); ++i) { final int j = i; final TableColumn tableColumn = new TableColumn(i); this.model.getExtColumn(j).setTableColumn(tableColumn); tableColumn.setHeaderRenderer(this.model.getExtColumn(j).getHeaderRenderer(this.getTableHeader()) != null ? this.model.getExtColumn(j).getHeaderRenderer(this.getTableHeader()) : new ExtTableHeaderRenderer(this.model.getExtColumn(j), this.getTableHeader())); // Save column width tableColumn.addPropertyChangeListener(new PropertyChangeListener() { public void propertyChange(final PropertyChangeEvent evt) { if (evt.getPropertyName().equals("width")) { try { JSonStorage.getStorage("ExtTable_" + ExtTable.this.tableID).put("WIDTH_COL_" + ExtTable.this.model.getExtColumn(j).getID(), (Integer) evt.getNewValue()); } catch (final Exception e) { Log.exception(e); } } } }); if (this.model.getExtColumn(j).getMaxWidth() >= 0) { tableColumn.setMaxWidth(this.model.getExtColumn(j).getMaxWidth()); } if (this.model.getExtColumn(j).getMinWidth() >= 0) { tableColumn.setMinWidth(this.model.getExtColumn(j).getMinWidth()); } // Set stored columnwidth int w = this.model.getExtColumn(j).getDefaultWidth(); try { w = JSonStorage.getStorage("ExtTable_" + this.tableID).get("WIDTH_COL_" + this.model.getExtColumn(j).getID(), w); } catch (final Exception e) { Log.exception(e); } finally { tableColumn.setPreferredWidth(w); } if (!this.model.isVisible(i)) { continue; } columns.put(this.model.getExtColumn(j).getID(), tableColumn); // addColumn(tableColumn); } // restore column position int index = 0; while (true) { if (columns.isEmpty()) { break; } if (index < this.getModel().getColumnCount()) { String id; try { id = JSonStorage.getStorage("ExtTable_" + this.tableID).get("POS_COL_" + index, ""); index++; if (id != null) { final TableColumn item = columns.remove(id); if (item != null) { this.addColumn(item); } } } catch (final Exception e) { Log.exception(e); } } else { for (final TableColumn ritem : columns.values()) { this.addColumn(ritem); } break; } } } private JComponent createDefaultColumnButton() { final MigPanel p = new MigPanel("ins 0 2 0 0", "[grow,fill]", "[grow,fill]"); final URL iconPath = ExtTable.class.getResource("columnButton.png"); final JButton button; if (iconPath != null) { button = new JButton(IconIO.getImageIcon(iconPath, 12)); } else { button = new JButton("*"); } button.setBorderPainted(false); button.setContentAreaFilled(false); p.setBackground(null); p.setOpaque(false); button.addActionListener(new ActionListener() { public void actionPerformed(final ActionEvent event) { final JButton source = (JButton) event.getSource(); final int x = source.getLocation().x; final int y = source.getLocation().y; final JPopupMenu ccm = ExtTable.this.columnControlMenu(null); ccm.show(source, x, y); if (ccm.getComponentCount() == 0) { Toolkit.getDefaultToolkit().beep(); } } }); p.add(button, "width 12!,height 12!"); return p; } /* we do always create columsn ourself */ @Override public boolean getAutoCreateColumnsFromModel() { return false; } /** * converts the colum index to model and returns the column's cell editor */ @Override public TableCellEditor getCellEditor(final int row, final int column) { return this.model.getCelleditorByColumn(this.convertColumnIndexToModel(column)); } /** * COnverts ther colum index to the current model and returns the column's * cellrenderer */ @Override public TableCellRenderer getCellRenderer(final int row, final int column) { return this.model.getCellrendererByColumn(this.convertColumnIndexToModel(column)); } /** * @return the {@link ExtTable#columnBackground} * @see ExtTable#columnBackground */ public Color getColumnBackground() { return this.columnBackground; } /** * @return the {@link ExtTable#columnBackgroundSelected} * @see ExtTable#columnBackgroundSelected */ public Color getColumnBackgroundSelected() { return this.columnBackgroundSelected; } public JComponent getColumnButton() { if (this.columnButton == null) { this.columnButton = this.createDefaultColumnButton(); } return this.columnButton; } /** * @return the {@link ExtTable#columnForeground} * @see ExtTable#columnForeground */ public Color getColumnForeground() { return this.columnForeground; } /** * @return the {@link ExtTable#columnForegroundSelected} * @see ExtTable#columnForegroundSelected */ public Color getColumnForegroundSelected() { return this.columnForegroundSelected; } /** * @return the eventSender */ public ExtTableEventSender getEventSender() { return this.eventSender; } /** * Returns the real column index at this point * * @param point */ public ExtColumn<E> getExtColumnAtPoint(final Point point) { final int x = this.getExtColumnIndexByPoint(point); return this.getExtTableModel().getExtColumn(x); } /** * returns the real column at the given point. Method converts the column to * the moduels colum * * @param point * @return */ public int getExtColumnIndexByPoint(final Point point) { final int x = this.columnAtPoint(point); return this.convertColumnIndexToModel(x); } public ExtTableModel<E> getExtTableModel() { return this.model; } /** * Returns the original Celleditor given by the current LAF UI. Used to have * an reference to the LAF's default editor * * @param row * @param column * @return */ public TableCellEditor getLafCellEditor(final int row, final int column) { return super.getCellEditor(row, column); } /** * Returns the original Cellrenderer given bei the current LAF UI Used to * have an reference to the LAF's default renderer * * @param row * @param column * @return */ public TableCellRenderer getLafCellRenderer(final int row, final int column) { return super.getCellRenderer(row, column); } public Point getPointinCell(final Point x) { final int row = this.rowAtPoint(x); if (row == -1) { return null; } final Rectangle cellPosition = this.getCellRect(row, this.columnAtPoint(x), true); final Point p = new Point(); p.setLocation(x.getX() - cellPosition.getX(), x.getY() - cellPosition.getY()); return p; } /** * @return the rowHighlighters */ public ArrayList<ExtRowHighlighter> getRowHighlighters() { return this.rowHighlighters; } /** * @param point * @return */ public int getRowIndexByPoint(final Point point) { return this.rowAtPoint(point); } /** * @return the tableID */ public String getTableID() { return this.tableID; } public boolean isColumnButtonVisible() { return this.columnButtonVisible; } /** * @return the searchEnabled */ public boolean isSearchEnabled() { return this.searchEnabled; } protected JPopupMenu onContextMenu(final JPopupMenu popup, final E contextObject, final ArrayList<E> selection) { return null; } /** * This method will be called when a doubleclick is performed on the object * <code>obj</code> * * @param obj */ protected void onDoubleClick(final MouseEvent e, final E obj) { } protected void onSelectionChanged(final ArrayList<E> selected) { } /** * @param selectedObjects * @param evt * @return */ protected boolean onShortcutCopy(final ArrayList<E> selectedObjects, final KeyEvent evt) { return false; } /** * @param selectedObjects * @param evt * @return */ protected boolean onShortcutCut(final ArrayList<E> selectedObjects, final KeyEvent evt) { return false; } /** * @param selectedObjects * @param evt * @param direct * TODO * @return */ protected boolean onShortcutDelete(final ArrayList<E> selectedObjects, final KeyEvent evt, final boolean direct) { return false; } /** * @param selectedObjects * @param evt * @return */ protected boolean onShortcutPaste(final ArrayList<E> selectedObjects, final KeyEvent evt) { return false; } /** * @param selectedObjects * @param evt * @return */ protected boolean onShortcutSearch(final ArrayList<E> selectedObjects, final KeyEvent evt) { if (this.isSearchEnabled() && this.hasFocus()) { this.startSearch(); return true; } return false; } /** * @param e * @param obj */ protected void onSingleClick(final MouseEvent e, final E obj) { } @Override public void paintComponent(final Graphics g) { super.paintComponent(g); /* * highlighter TODO: this might get slow for many rows TODO: change * order? highlighting columns "overpaint" the text */ if (this.getRowCount() == 0) { return; } final Rectangle visibleRect = this.getVisibleRect(); Rectangle first, last; // get current width; first = this.getCellRect(0, 0, true); last = this.getCellRect(0, this.getColumnCount() - 1, true); final int width = last.x + last.width - first.x; for (final ExtRowHighlighter rh : this.rowHighlighters) { for (int i = 0; i < this.getRowCount(); i++) { first = this.getCellRect(i, 0, true); // skip if the row is not in visible rec if (first.y + first.height < visibleRect.y) { continue; } if (first.y > visibleRect.y + visibleRect.height) { continue; } if (rh.doHighlight(this, i)) { rh.paint((Graphics2D) g, 0, first.y, width, first.height - 1); } } } } /** * Key selection */ @SuppressWarnings("unchecked") @Override protected boolean processKeyBinding(final KeyStroke stroke, final KeyEvent evt, final int condition, final boolean pressed) { if (!pressed) { return super.processKeyBinding(stroke, evt, condition, pressed); } switch (evt.getKeyCode()) { case KeyEvent.VK_ESCAPE: this.clearSelection(); return true; case KeyEvent.VK_X: if (evt.isControlDown() || evt.isMetaDown()) { ExtTable.this.eventSender.fireEvent(new ExtTableEvent<ArrayList<E>>(ExtTable.this, ExtTableEvent.Types.SHORTCUT_CUT, this.getExtTableModel().getSelectedObjects())); return this.onShortcutCut(this.getExtTableModel().getSelectedObjects(), evt); } break; case KeyEvent.VK_V: if (evt.isControlDown() || evt.isMetaDown()) { ExtTable.this.eventSender.fireEvent(new ExtTableEvent<ArrayList<E>>(ExtTable.this, ExtTableEvent.Types.SHORTCUT_PASTE, this.getExtTableModel().getSelectedObjects())); return this.onShortcutPaste(this.getExtTableModel().getSelectedObjects(), evt); } break; case KeyEvent.VK_C: if (evt.isControlDown() || evt.isMetaDown()) { ExtTable.this.eventSender.fireEvent(new ExtTableEvent<ArrayList<E>>(ExtTable.this, ExtTableEvent.Types.SHORTCUT_COPY, this.getExtTableModel().getSelectedObjects())); return this.onShortcutCopy(this.getExtTableModel().getSelectedObjects(), evt); } break; case KeyEvent.VK_DELETE: if (!evt.isAltDown()) { /* no ctrl+alt+del */ ExtTable.this.eventSender.fireEvent(new ExtTableEvent<Object>(ExtTable.this, ExtTableEvent.Types.SHORTCUT_DELETE, this.getExtTableModel().getSelectedObjects(), BinaryLogic.containsSome(evt.getModifiers(), ActionEvent.SHIFT_MASK))); return this.onShortcutDelete(this.getExtTableModel().getSelectedObjects(), evt, BinaryLogic.containsSome(evt.getModifiers(), ActionEvent.SHIFT_MASK)); } break; case KeyEvent.VK_BACK_SPACE: if ((evt.isControlDown() || evt.isMetaDown()) && !evt.isAltDown()) { /* no ctrl+alt+backspace = unix desktop restart */ ExtTable.this.eventSender.fireEvent(new ExtTableEvent<Object>(ExtTable.this, ExtTableEvent.Types.SHORTCUT_DELETE, this.getExtTableModel().getSelectedObjects(), false)); return this.onShortcutDelete(this.getExtTableModel().getSelectedObjects(), evt, false); } break; case KeyEvent.VK_F: if (evt.isControlDown() || evt.isMetaDown()) { ExtTable.this.eventSender.fireEvent(new ExtTableEvent<ArrayList<E>>(ExtTable.this, ExtTableEvent.Types.SHORTCUT_SEARCH, this.getExtTableModel().getSelectedObjects())); return this.onShortcutSearch(this.getExtTableModel().getSelectedObjects(), evt); } break; case KeyEvent.VK_UP: if (this.getSelectedRow() == 0 && !evt.isShiftDown()) { if (this.getCellEditor() != null) { this.getCellEditor().stopCellEditing(); } this.changeSelection(this.getRowCount() - 1, 0, false, false); return true; } break; case KeyEvent.VK_DOWN: if (this.getSelectedRow() == this.getRowCount() - 1 && !evt.isShiftDown()) { if (this.getCellEditor() != null) { this.getCellEditor().stopCellEditing(); } this.changeSelection(0, 0, false, false); return true; } break; case KeyEvent.VK_A: if (evt.isControlDown() || evt.isMetaDown()) { if (this.getCellEditor() != null) { this.getCellEditor().stopCellEditing(); } this.getSelectionModel().setSelectionInterval(0, this.getRowCount() - 1); return true; } break; case KeyEvent.VK_HOME: if (evt.isControlDown() || evt.isMetaDown() || evt.isShiftDown()) { if (this.getCellEditor() != null) { this.getCellEditor().stopCellEditing(); } if (this.getSelectedRow() != -1 && this.getRowCount() != 0) { this.getSelectionModel().setSelectionInterval(0, this.getSelectedRows()[this.getSelectedRows().length - 1]); /* to avoid selection by super.processKeyBinding */ return true; } } else { if (this.getCellEditor() != null) { this.getCellEditor().stopCellEditing(); } this.getSelectionModel().setSelectionInterval(0, 0); } break; case KeyEvent.VK_END: if (evt.isControlDown() || evt.isMetaDown() || evt.isShiftDown()) { if (this.getCellEditor() != null) { this.getCellEditor().stopCellEditing(); } if (this.getSelectedRow() != -1 && this.getRowCount() != 0) { this.getSelectionModel().setSelectionInterval(this.getSelectedRow(), this.getRowCount() - 1); /* to avoid selection by super.processKeyBinding */ return true; } } else { if (this.getCellEditor() != null) { this.getCellEditor().stopCellEditing(); } if (this.getRowCount() != 0) { this.getSelectionModel().setSelectionInterval(this.getRowCount() - 1, this.getRowCount() - 1); } } break; } return super.processKeyBinding(stroke, evt, condition, pressed); } @SuppressWarnings("unchecked") @Override protected void processMouseEvent(final MouseEvent e) { super.processMouseEvent(e); if (e.getID() == MouseEvent.MOUSE_RELEASED) { if (e.isPopupTrigger() || e.getButton() == MouseEvent.BUTTON3) { final int row = this.rowAtPoint(e.getPoint()); final E obj = this.getExtTableModel().getObjectbyRow(row); // System.out.println(row); if (obj == null || row == -1) { /* no object under mouse, lets clear the selection */ this.clearSelection(); final JPopupMenu popup = this.onContextMenu(new JPopupMenu(), null, null); this.eventSender.fireEvent(new ExtTableEvent<JPopupMenu>(this, ExtTableEvent.Types.CONTEXTMENU, popup)); if (popup != null && popup.getComponentCount() > 0) { popup.show(ExtTable.this, e.getPoint().x, e.getPoint().y); } return; } else { /* check if we need to select object */ if (!this.isRowSelected(row)) { this.clearSelection(); this.addRowSelectionInterval(row, row); } final ArrayList<E> selected = this.getExtTableModel().getSelectedObjects(); final JPopupMenu popup = this.onContextMenu(new JPopupMenu(), obj, selected); if (popup != null && popup.getComponentCount() > 0) { popup.show(ExtTable.this, e.getPoint().x, e.getPoint().y); } } } else if (e.getButton() == MouseEvent.BUTTON1 && e.getClickCount() == 2) { final int row = this.rowAtPoint(e.getPoint()); final E obj = this.getExtTableModel().getObjectbyRow(row); // System.out.println(row); if (obj != null) { this.onDoubleClick(e, obj); this.eventSender.fireEvent(new ExtTableEvent<E>(this, ExtTableEvent.Types.DOUBLECLICK, obj)); } } else if (e.getButton() == MouseEvent.BUTTON1 && e.getClickCount() == 1) { final int row = this.rowAtPoint(e.getPoint()); final E obj = this.getExtTableModel().getObjectbyRow(row); // System.out.println(row); if (obj != null) { this.onSingleClick(e, obj); } } } else if (e.getID() == MouseEvent.MOUSE_PRESSED) { if (this.rowAtPoint(e.getPoint()) < 0) { this.clearSelection(); } } } protected void reconfigureColumnButton() { final Container c1 = this.getParent(); if (c1 instanceof JViewport) { final Container c2 = c1.getParent(); if (c2 instanceof JScrollPane) { final JScrollPane scrollPane = (JScrollPane) c2; final JViewport viewport = scrollPane.getViewport(); if (viewport == null || viewport.getView() != this) { return; } if (this.isColumnButtonVisible()) { this.verticalScrollPolicy = scrollPane.getVerticalScrollBarPolicy(); scrollPane.setCorner(ScrollPaneConstants.UPPER_TRAILING_CORNER, this.getColumnButton()); scrollPane.setVerticalScrollBarPolicy(ScrollPaneConstants.VERTICAL_SCROLLBAR_ALWAYS); } else { if (this.verticalScrollPolicy != 0) { scrollPane.setVerticalScrollBarPolicy(this.verticalScrollPolicy); } try { scrollPane.setCorner(ScrollPaneConstants.UPPER_TRAILING_CORNER, null); } catch (final Throwable nothing) { } } } } } /** * Removes a rowhilighter * * @param highlighter */ public void removeRowHighlighter(final ExtRowHighlighter highlighter) { this.rowHighlighters.remove(highlighter); } public void scrollToRow(final int row) { System.out.println("Scrol " + row); if (row < 0) { return; } new EDTHelper<Object>() { @Override public Object edtRun() { final JViewport viewport = (JViewport) ExtTable.this.getParent(); if (viewport == null) { return null; } final Rectangle rect = ExtTable.this.getCellRect(row, 0, true); final Point pt = viewport.getViewPosition(); rect.setLocation(rect.x - pt.x, rect.y - pt.y); viewport.scrollRectToVisible(rect); System.out.println("Scrol " + rect); return null; } }.start(); } protected void scrollToSelection() { new EDTHelper<Object>() { @Override public Object edtRun() { final JViewport viewport = (JViewport) ExtTable.this.getParent(); if (viewport == null) { return null; } final int[] sel = ExtTable.this.getSelectedRows(); if (sel == null || sel.length == 0) { return null; } final Rectangle rect = ExtTable.this.getCellRect(sel[0], 0, true); final Rectangle rect2 = ExtTable.this.getCellRect(sel[sel.length - 1], 0, true); rect.height += rect2.y - rect.y; final Point pt = viewport.getViewPosition(); rect.setLocation(rect.x - pt.x, rect.y - pt.y); viewport.scrollRectToVisible(rect); return null; } }.start(); } public void setColumnBottonVisibility(final boolean visible) { this.columnButtonVisible = visible; this.reconfigureColumnButton(); } public void setColumnButton(final JComponent c) { this.columnButton = c; this.reconfigureColumnButton(); } /** * @param searchEnabled * the searchEnabled to set */ public void setSearchEnabled(final boolean searchEnabled) { this.searchEnabled = searchEnabled; } private synchronized void startSearch() { try { if (this.searchDialog != null && this.searchDialog.isShowing()) { this.searchDialog.requestFocus(); } else { this.searchDialog = new SearchDialog(SearchDialog.NO_REGEX_FLAG, this) { private static final long serialVersionUID = 2652101312418765845L; @Override public void actionPerformed(final ActionEvent e) { final String ret = ExtTable.this.searchDialog.getReturnID(); if (ret != null) { final int[] sel = ExtTable.this.getSelectedRows(); int startRow = -1; if (sel != null & sel.length > 0) { startRow = sel[sel.length - 1]; } final E found = ExtTable.this.getExtTableModel().searchNextObject(startRow + 1, ret, ExtTable.this.searchDialog.isCaseSensitive(), ExtTable.this.searchDialog.isRegex()); ExtTable.this.getExtTableModel().setSelectedObject(found); ExtTable.this.scrollToSelection(); } } }; } } catch (final IOException e) { Log.exception(e); } } }
package net.hearthstats; import java.awt.image.BufferedImage; import java.util.Observable; public class HearthstoneAnalyzer extends Observable { private boolean _coin; private BufferedImage _image; private String _mode; private String _opponentClass; private String _result; private String _screen; private String _yourClass; private int _deckSlot; private boolean _isNewArena = false; public HearthstoneAnalyzer() { } public void analyze(BufferedImage image) { _image = image; if(getScreen() != "Main Menu" && getScreen() != "Playing") { _testForMainMenuScreen(); } if(getScreen() != "Play") { _testForPlayScreen(); } if(getScreen() != "Arena") { _testForArenaModeScreen(); } if(getScreen() == "Play" || getScreen() == "Arena") { _testForFindingOpponent(); if (getScreen() == "Play") { if(getMode() != "Casual") _testForCasualMode(); if(getMode() != "Ranked") _testForRankedMode(); _testForDeckSlot(); } } if(getScreen() == "Finding Opponent") { _testForMatchStartScreen(); } if(getScreen() == "Match Start") { if(getYourClass() == null) _testForYourClass(); if(getOpponentClass() == null) _testForOpponentClass(); if(!getCoin()) _testForCoin(); _testForPlayingScreen(); } if(getScreen() == "Result") { _testForArenaEnd(); } if(getScreen() == "Playing") { _testForVictory(); _testForDefeat(); } if(getScreen() == "Arena" && !isNewArena()) { _testForNewArenaRun(); } _image.flush(); } public boolean getCoin() { return _coin; } public int getDeckSlot() { return _deckSlot; } public String getMode() { return _mode; } public String getOpponentClass() { return _opponentClass; } public String getResult() { return _result; } public String getScreen() { return _screen; } public String getYourClass() { return _yourClass; } public boolean isNewArena() { return _isNewArena; } private void _notifyObserversOfChangeTo(String property) { setChanged(); notifyObservers(property); } public void setIsNewArena(boolean isNew) { _isNewArena = isNew; _notifyObserversOfChangeTo("newArena"); } private void _setDeckSlot(int deckSlot) { _deckSlot = deckSlot; _notifyObserversOfChangeTo("deckSlot"); } private void _setCoin(boolean coin) { _coin = coin; _notifyObserversOfChangeTo("coin"); } private void _setMode(String screen) { _mode = screen; _notifyObserversOfChangeTo("mode"); } private void _setOpponentClass(String opponentClass) { _opponentClass = opponentClass; _notifyObserversOfChangeTo("opponentClass"); } private void _setResult(String result) { _result = result; _notifyObserversOfChangeTo("result"); } private void _setScreen(String screen) { _screen = screen; _notifyObserversOfChangeTo("screen"); } private void _setYourClass(String yourClass) { _yourClass = yourClass; _notifyObserversOfChangeTo("yourClass"); } private void _testForArenaEnd() { int[][] tests = { { 315, 387, 239, 32, 39 }, { 399, 404, 237, 41, 33 }, { 448, 408, 223, 8, 16 } }; if((new PixelGroupTest(_image, tests)).passed()) { _screen = "Arena"; _notifyObserversOfChangeTo("arenaEnd"); } } private void _testForArenaModeScreen() { int[][] tests = { { 807, 707, 95, 84, 111 }, { 324, 665, 77, 114, 169 }, { 120, 685, 255, 215, 115 }, { 697, 504, 78, 62, 56 } }; if((new PixelGroupTest(_image, tests)).passed()) { _setScreen("Arena"); _setMode("Arena"); } } private void _testForCasualMode() { int[][] tests = { { 833, 94, 100, 22, 16 }, // ranked off { 698, 128, 200, 255, 255 } // casual blue }; if((new PixelGroupTest(_image, tests)).passed()) _setMode("Casual"); } private void _testForCoin() { int[][] tests = { // fourth card right edge { 869, 389, 155, 250, 103 }, { 864, 328, 130, 255, 85 }, { 864, 379, 126, 255, 82 } }; if((new PixelGroupTest(_image, tests)).passedOr()) _setCoin(true); } private void _testForDeckSlot() { if(getDeckSlot() != 1) { int[][] slotOnePixels = { { 163, 178, 33, 129, 242}, { 183, 178, 33, 129, 242} }; if((new PixelGroupTest(_image, slotOnePixels)).passedOr()) _setDeckSlot(1); } if(getDeckSlot() != 2) { int[][] slotTwoPixels = { { 348, 178, 36, 144, 247 }, { 368, 178, 36, 144, 247 } }; if((new PixelGroupTest(_image, slotTwoPixels)).passedOr()) _setDeckSlot(2); } if(getDeckSlot() != 3) { int[][] slotTwoPixels = { { 506, 178, 36, 144, 247 }, { 526, 178, 36, 144, 247 } }; if((new PixelGroupTest(_image, slotTwoPixels)).passedOr()) _setDeckSlot(3); } if(getDeckSlot() != 4) { int[][] slotOnePixels = { { 163, 339, 33, 129, 242}, { 183, 339, 33, 129, 242} }; if((new PixelGroupTest(_image, slotOnePixels)).passedOr()) _setDeckSlot(4); } if(getDeckSlot() != 5) { int[][] slotTwoPixels = { { 348, 339, 36, 144, 247 }, { 368, 339, 36, 144, 247 } }; if((new PixelGroupTest(_image, slotTwoPixels)).passedOr()) _setDeckSlot(5); } if(getDeckSlot() != 6) { int[][] slotTwoPixels = { { 506, 339, 36, 144, 247 }, { 526, 339, 36, 144, 247 } }; if((new PixelGroupTest(_image, slotTwoPixels)).passedOr()) _setDeckSlot(6); } if(getDeckSlot() != 7) { int[][] slotOnePixels = { { 163, 497, 33, 129, 242}, { 183, 497, 33, 129, 242} }; if((new PixelGroupTest(_image, slotOnePixels)).passedOr()) _setDeckSlot(7); } if(getDeckSlot() != 8) { int[][] slotTwoPixels = { { 348, 497, 36, 144, 247 }, { 368, 497, 36, 144, 247 } }; if((new PixelGroupTest(_image, slotTwoPixels)).passedOr()) _setDeckSlot(8); } if(getDeckSlot() != 9) { int[][] slotTwoPixels = { { 506, 497, 36, 144, 247 }, { 526, 497, 36, 144, 247 } }; if((new PixelGroupTest(_image, slotTwoPixels)).passedOr()) _setDeckSlot(9); } } private void _testForDefeat() { int[][] tests = { { 745, 219, 164, 162, 155 }, { 344, 383, 134, 153, 239 }, { 696, 357, 201, 197, 188 } }; PixelGroupTest pxTest = new PixelGroupTest(_image, tests); int[][] testsTwo = { { 347, 382, 129, 148, 236 }, { 275, 345, 137, 138, 134 }, { 537, 155, 235, 226, 67 } }; PixelGroupTest pxTestTwo = new PixelGroupTest(_image, testsTwo); int[][] testsThree = { { 347, 382, 129, 148, 236 }, { 275, 345, 137, 138, 134 }, { 537, 155, 235, 226, 67 } }; PixelGroupTest pxTestThree = new PixelGroupTest(_image, testsThree); if (pxTest.passed() || pxTestTwo.passed() || pxTestThree.passed()) { _setScreen("Result"); _setResult("Defeat"); } } private void _testForClass(String className, int[][] pixelTests, boolean isYours) { if((new PixelGroupTest(_image, pixelTests)).passed()) { if(isYours) _setYourClass(className); else _setOpponentClass(className); } } private void _testForFindingOpponent() { int[][] tests = { { 401, 143, 180, 122, 145 }, // title bar { 765, 583, 121, 72, 100 } // bottom bar }; PixelGroupTest pxTest = new PixelGroupTest(_image, tests); int[][] arenaTests = { { 393, 145, 205, 166, 135 }, // title bar { 819, 235, 109, 87, 79 }, { 839, 585, 139, 113, 77 } }; PixelGroupTest arenaPxTest = new PixelGroupTest(_image, arenaTests); if (pxTest.passed() || arenaPxTest.passed()) { _coin = false; _yourClass = null; _opponentClass = null; _setScreen("Finding Opponent"); } } private void _testForMainMenuScreen() { int[][] tests = { { 338, 453, 159, 96, 42 }, // box top { 211, 658, 228, 211, 116 }, // quest button exclamation mark { 513, 148, 36, 23, 24 } // dark vertical line in top center }; if((new PixelGroupTest(_image, tests)).passed()) _setScreen("Main Menu"); } private void _testForMatchStartScreen() { int[][] tests = { { 403, 487, 201, 173, 94 }, // title bar { 946, 149, 203, 174, 96 } // bottom bar }; if ((new PixelGroupTest(_image, tests)).passed()) { _setScreen("Match Start"); } } private void _testForNewArenaRun() { int[][] tests = { { 298, 170, 255, 239, 148 }, // key //{ 492, 204, 128, 79, 47 }, // key stem { 382, 294, 255, 255, 255 }, // zero { 393, 281, 255, 255, 255 }, // zero { 321, 399, 209, 179, 127 }, // no red x }; if ((new PixelGroupTest(_image, tests)).passed()) { setIsNewArena(true); } } private void _testForOpponentClass() { // Druid Test int[][] druidTests = { { 743, 118, 205, 255, 242 }, { 882, 141, 231, 255, 252 }, { 766, 215, 203, 160, 198 } }; _testForClass("Druid", druidTests, false); // Hunter Test int[][] hunterTests = { { 825, 66, 173, 178, 183 }, { 818, 175, 141, 37, 0 }, { 739, 309, 216, 214, 211 } }; _testForClass("Hunter", hunterTests, false); // Mage Test int[][] mageTests = { { 790, 68, 88, 23, 99 }, { 788, 312, 215, 188, 177 }, { 820, 247, 53, 64, 82 } }; _testForClass("Mage", mageTests, false); // Paladin Test int[][] paladinTests = { { 895, 213, 255, 247, 147 }, { 816, 301, 125, 237, 255 }, { 767, 82, 133, 107, 168 } }; _testForClass("Paladin", paladinTests, false); // Priest Test int[][] priestTests = { { 724, 189, 255, 236, 101 }, { 796, 243, 58, 72, 138 }, { 882, 148, 27, 20, 38 } }; _testForClass("Priest", priestTests, false); // Rogue Test int[][] rogueTests = { { 889, 254, 132, 196, 72 }, { 790, 273, 88, 21, 34 }, { 841, 73, 100, 109, 183 } }; _testForClass("Rogue", rogueTests, false); // Shaman Test int[][] shamanTests = { { 748, 94, 5, 50, 100 }, { 887, 169, 234, 50, 32 }, { 733, 206, 186, 255, 255 } }; _testForClass("Shaman", shamanTests, false); // Warlock Test int[][] warlockTests = { { 711, 203, 127, 142, 36 }, { 832, 264, 240, 244, 252 }, { 832, 65, 98, 129, 0 } }; _testForClass("Warlock", warlockTests, false); // Warrior Test int[][] warriorTests = { { 795, 64, 37, 4, 0 }, { 780, 83, 167, 23, 4 }, { 809, 92, 255, 247, 227 } }; _testForClass("Warrior", warriorTests, false); } private void _testForPlayingScreen() { // check for normal play boards int[][] tests = { { 336, 203, 231, 198, 124 }, { 763, 440, 234, 198, 124 } }; PixelGroupTest normalPxTest = new PixelGroupTest(_image, tests); // check for lighter orc board int[][] orcBoardTests = { { 906, 283, 222, 158, 94 }, { 120, 468, 195, 134, 78 } }; PixelGroupTest orcPxTest = new PixelGroupTest(_image, orcBoardTests); if (normalPxTest.passed() || orcPxTest.passed()) _setScreen("Playing"); } private void _testForPlayScreen() { int[][] tests = { { 543, 130, 121, 32, 22 }, // play mode red background { 254, 33, 197, 173, 132 }, // mode title light brown background { 956, 553, 24, 8, 8 }, { 489, 688, 68, 65, 63 } }; if((new PixelGroupTest(_image, tests)).passed()) _setScreen("Play"); } private void _testForRankedMode() { int[][] tests = { { 833, 88, 220, 255, 255 }, // ranked blue { 698, 120, 56, 16, 8 } // casual off }; if((new PixelGroupTest(_image, tests)).passed()) _setMode("Ranked"); } private void _testForVictory() { int[][] tests = { { 334, 504, 88, 101, 192 }, { 683, 510, 74, 88, 173 }, { 549, 162, 255, 224, 119 } }; PixelGroupTest pxTest = new PixelGroupTest(_image, tests); int[][] testsTwo = { { 347, 469, 85, 102, 203 }, { 737, 339, 63, 76, 148 }, { 774, 214, 253, 243, 185 } }; PixelGroupTest pxTestTwo = new PixelGroupTest(_image, testsTwo); int[][] testsThree = { { 370, 528, 66, 81, 165 }, { 690, 553, 63, 76, 162 }, { 761, 228, 249, 234, 163 } }; PixelGroupTest pxTestThree = new PixelGroupTest(_image, testsThree); if(pxTest.passed() || pxTestTwo.passed() || pxTestThree.passed()) { _setScreen("Result"); _setResult("Victory"); } } private void _testForYourClass() { // Druid Test int[][] druidTests = { { 225, 480, 210, 255, 246 }, { 348, 510, 234, 255, 251 }, { 237, 607, 193, 155, 195 } }; _testForClass("Druid", druidTests, true); // Hunter Test int[][] hunterTests = { { 289, 438, 173, 161, 147 }, { 366, 554, 250, 200, 81 }, { 210, 675, 209, 209, 211 } }; _testForClass("Hunter", hunterTests, true); // Mage Test int[][] mageTests = { { 259, 439, 96, 31, 102 }, { 294, 677, 219, 210, 193 }, { 216, 591, 0, 0, 56 } }; _testForClass("Mage", mageTests, true); // Paladin Test int[][] paladinTests = { { 249, 447, 133, 105, 165 }, { 304, 671, 74, 146, 234 }, { 368, 581, 244, 238, 141 } }; _testForClass("Paladin", paladinTests, true); // Priest Test int[][] priestTests = { { 229, 491, 180, 178, 166 }, { 256, 602, 82, 104, 204 }, { 350, 611, 22, 23, 27 } }; _testForClass("Priest", priestTests, true); // Rogue Test int[][] rogueTests = { { 309, 446, 91, 107, 175 }, { 291, 468, 187, 37, 25 }, { 362, 623, 122, 186, 67 } }; _testForClass("Rogue", rogueTests, true); // Shaman Test int[][] shamanTests = { { 223, 458, 4, 46, 93 }, { 360, 533, 213, 32, 6 }, { 207, 578, 177, 245, 249 } }; _testForClass("Shaman", shamanTests, true); // Warlock Test int[][] warlockTests = { { 301, 435, 104, 138, 8 }, { 265, 493, 221, 51, 32 }, { 294, 680, 60, 75, 182 } }; _testForClass("Warlock", warlockTests, true); // Warrior Test int[][] warriorTests = { { 252, 452, 163, 10, 0 }, { 291, 579, 234, 192, 53 }, { 280, 461, 255, 245, 225 } }; _testForClass("Warior", warriorTests, true); } }
// PrairieReader.java package loci.formats.in; import java.io.*; import java.text.*; import java.util.*; import loci.formats.*; import loci.formats.meta.MetadataStore; public class PrairieReader extends FormatReader { // -- Constants -- // Private tags present in Prairie TIFF files // IMPORTANT NOTE: these are the same as Metamorph's private tags - therefore, // it is likely that Prairie TIFF files will be incorrectly // identified unless the XML or CFG file is specified private static final int PRAIRIE_TAG_1 = 33628; private static final int PRAIRIE_TAG_2 = 33629; private static final int PRAIRIE_TAG_3 = 33630; // -- Fields -- /** List of files in the current dataset */ private String[] files; /** Helper reader for opening images */ private TiffReader tiff; /** Names of the associated XML files */ private String xmlFile, cfgFile; private boolean readXML = false, readCFG = false; // -- Constructor -- /** Constructs a new Prairie TIFF reader. */ public PrairieReader() { super("Prairie (TIFF)", new String[] {"tif", "tiff", "cfg", "xml"}); } // -- IFormatReader API methods -- /* @see loci.formats.IFormatReader#isThisType(byte[]) */ public boolean isThisType(byte[] block) { // adapted from MetamorphReader.isThisType(byte[]) if (block.length < 3) return false; if (block.length < 8) { return true; // we have no way of verifying further } String s = new String(block); if (s.indexOf("xml") != -1 && s.indexOf("PV") != -1) return true; boolean little = (block[0] == 0x49 && block[1] == 0x49); int ifdlocation = DataTools.bytesToInt(block, 4, little); if (ifdlocation < 0) return false; else if (ifdlocation + 1 > block.length) return true; else { int ifdnumber = DataTools.bytesToInt(block, ifdlocation, 2, little); for (int i=0; i<ifdnumber; i++) { if (ifdlocation + 3 + (i*12) > block.length) { return false; } else { int ifdtag = DataTools.bytesToInt(block, ifdlocation + 2 + (i*12), 2, little); if (ifdtag == PRAIRIE_TAG_1 || ifdtag == PRAIRIE_TAG_2 || ifdtag == PRAIRIE_TAG_3) { return true; } } } return false; } } /* @see loci.formats.IFormatReader#fileGroupOption(String) */ public int fileGroupOption(String id) throws FormatException, IOException { id = id.toLowerCase(); return (id.endsWith(".cfg") || id.endsWith(".xml")) ? FormatTools.MUST_GROUP : FormatTools.CAN_GROUP; } /* @see loci.formats.IFormatReader#getUsedFiles() */ public String[] getUsedFiles() { FormatTools.assertId(currentId, true, 1); String[] s = new String[files.length + 2]; System.arraycopy(files, 0, s, 0, files.length); s[files.length] = xmlFile; s[files.length + 1] = cfgFile; return s; } /* @see loci.formats.IFormatReader#openBytes(int, byte[]) */ public byte[] openBytes(int no, byte[] buf) throws FormatException, IOException { FormatTools.assertId(currentId, true, 1); FormatTools.checkPlaneNumber(this, no); tiff.setId(files[no]); return tiff.openBytes(0, buf); } /* @see loci.formats.IFormatReader#close(boolean) */ public void close(boolean fileOnly) throws IOException { if (fileOnly && tiff != null) tiff.close(fileOnly); else if (!fileOnly) close(); } // -- IFormatHandler API methods -- /* @see loci.formats.IFormatHandler#isThisType(String, boolean) */ public boolean isThisType(String name, boolean open) { if (!super.isThisType(name, open)) return false; // check extension if (!isGroupFiles()) return false; // check if there is an XML file in the same directory Location f = new Location(name); f = f.getAbsoluteFile(); Location parent = f.getParentFile(); String[] listing = parent.list(); if (listing == null) return false; // file doesn't exist, or other problem int xmlCount = 0; for (int i=0; i<listing.length; i++) { if (listing[i].toLowerCase().endsWith(".xml")) { try { RandomAccessStream s = new RandomAccessStream( parent.getAbsolutePath() + File.separator + listing[i]); if (s.readString(512).indexOf("PV") != -1) xmlCount++; } catch (IOException e) { } } } if (xmlCount == 0) { listing = (String[]) Location.getIdMap().keySet().toArray(new String[0]); for (int i=0; i<listing.length; i++) { if (listing[i].toLowerCase().endsWith(".xml")) { try { RandomAccessStream s = new RandomAccessStream(listing[i]); if (s.readString(512).indexOf("PV") != -1) xmlCount++; } catch (IOException e) { } } } } boolean xml = xmlCount > 0; // just checking the filename isn't enough to differentiate between // Prairie and regular TIFF; open the file and check more thoroughly return open ? checkBytes(name, 524304) && xml : xml; } /* @see loci.formats.IFormatHandler#close() */ public void close() throws IOException { if (tiff != null) tiff.close(); currentId = xmlFile = cfgFile = null; tiff = null; files = null; readXML = false; readCFG = false; } // -- Internal FormatReader API methods -- /* @see loci.formats.IFormatReader#initFile(String) */ protected void initFile(String id) throws FormatException, IOException { if (debug) debug("PrairieReader.initFile(" + id + ")"); if (metadata == null) metadata = new Hashtable(); if (core == null) core = new CoreMetadata(1); if (id.endsWith("xml") || id.endsWith("cfg")) { // we have been given the XML file that lists TIFF files (best case) status("Parsing XML"); if (id.endsWith("xml")) { super.initFile(id); tiff = new TiffReader(); xmlFile = id; readXML = true; } else if (id.endsWith("cfg")) { cfgFile = id; readCFG = true; } RandomAccessStream is = new RandomAccessStream(id); byte[] b = new byte[(int) is.length()]; is.read(b); is.close(); String s = new String(b); Vector elements = new Vector(); while (s.length() > 0) { int ndx = s.indexOf("<"); int val1 = s.indexOf(">", ndx); if (val1 != -1 && val1 > ndx) { String sub = s.substring(ndx + 1, val1); s = s.substring(val1 + 1); elements.add(sub); } } int zt = 0; boolean isZ = false; Vector f = new Vector(); int fileIndex = 1; if (id.endsWith(".xml")) core.imageCount[0] = 0; float pixelSizeX = 1f, pixelSizeY = 1f; String date = null, laserPower = null; Vector gains = new Vector(), offsets = new Vector(); String pastPrefix = ""; for (int i=1; i<elements.size(); i++) { String el = (String) elements.get(i); if (el.indexOf(" ") != -1) { boolean closed = el.endsWith("/"); String prefix = el.substring(0, el.indexOf(" ")); if (prefix.equals("File")) core.imageCount[0]++; if (prefix.equals("Frame")) { zt++; fileIndex = 1; } if (!prefix.equals("Key") && !prefix.equals("Frame")) { el = el.substring(el.indexOf(" ") + 1); while (el.indexOf("=") != -1) { int eq = el.indexOf("="); String key = el.substring(0, eq); String value = el.substring(eq + 2, el.indexOf("\"", eq + 2)); if (prefix.equals("File")) { addMeta(pastPrefix + " " + prefix + " " + fileIndex + " " + key, value); if (key.equals("filename")) fileIndex++; } else { addMeta(pastPrefix + " " + prefix + " " + key, value); if (pastPrefix.equals("PVScan") && prefix.equals("Sequence") && key.equals("type")) { isZ = value.equals("ZSeries"); } if (prefix.equals("PVScan") && key.equals("date")) { date = value; } } el = el.substring(el.indexOf("\"", eq + 2) + 1).trim(); if (prefix.equals("File") && key.equals("filename")) { File current = new File(id).getAbsoluteFile(); String dir = ""; if (current.exists()) { dir = current.getPath(); dir = dir.substring(0, dir.lastIndexOf(File.separator) + 1); } f.add(dir + value); } } } else if (prefix.equals("Key")) { int keyIndex = el.indexOf("key") + 5; int valueIndex = el.indexOf("value") + 7; String key = el.substring(keyIndex, el.indexOf("\"", keyIndex)); String value = el.substring(valueIndex, el.indexOf("\"", valueIndex)); addMeta(key, value); if (key.equals("pixelsPerLine")) { core.sizeX[0] = Integer.parseInt(value); } else if (key.equals("linesPerFrame")) { core.sizeY[0] = Integer.parseInt(value); } else if (key.equals("micronsPerPixel_XAxis")) { pixelSizeX = Float.parseFloat(value); } else if (key.equals("micronsPerPixel_YAxis")) { pixelSizeY = Float.parseFloat(value); } else if (key.startsWith("pmtGain_")) gains.add(value); else if (key.startsWith("pmtOffset_")) offsets.add(value); else if (key.equals(" PVScan date")) date = value; else if (key.equals("laserPower_0")) laserPower = value; } if (!closed) { pastPrefix = prefix; if (prefix.equals("Frame")) { int index = el.indexOf("index") + 7; String idx = el.substring(index, el.indexOf("\"", index)); pastPrefix += " " + idx; } } } } if (id.endsWith("xml")) { files = new String[f.size()]; f.copyInto(files); tiff.setId(files[0]); status("Populating metadata"); if (zt == 0) zt = 1; core.sizeZ[0] = isZ ? zt : 1; core.sizeT[0] = isZ ? 1 : zt; core.sizeC[0] = core.imageCount[0] / (core.sizeZ[0] * core.sizeT[0]); core.currentOrder[0] = "XYC" + (isZ ? "ZT" : "TZ"); core.pixelType[0] = FormatTools.UINT16; core.rgb[0] = false; core.interleaved[0] = false; core.littleEndian[0] = tiff.isLittleEndian(); core.indexed[0] = tiff.isIndexed(); core.falseColor[0] = false; MetadataStore store = getMetadataStore(); store.setImageName("", 0); MetadataTools.populatePixels(store, this); store.setDimensionsPhysicalSizeX(new Float(pixelSizeX), 0, 0); store.setDimensionsPhysicalSizeY(new Float(pixelSizeY), 0, 0); for (int i=0; i<core.sizeC[0]; i++) { String gain = (String) gains.get(i); String offset = (String) offsets.get(i); /* if (offset != null) { store.setDetectorSettingsOffset(new Float(offset), 0, i); } if (gain != null) { store.setDetectorSettingsGain(new Float(gain), 0, i); } */ } if (date != null) { SimpleDateFormat parse = new SimpleDateFormat("MM/dd/yyyy h:mm:ss a"); Date d = parse.parse(date, new ParsePosition(0)); SimpleDateFormat fmt = new SimpleDateFormat("yyyy-MM-dd'T'HH:mm:ss"); date = fmt.format(d); } store.setImageCreationDate(date, 0); /* if (laserPower != null) { store.setLaserPower(new Float(laserPower), 0, 0); } */ // CTR CHECK /* String zoom = (String) getMeta("opticalZoom"); if (zoom != null) { store.setDisplayOptions(new Float(zoom), new Boolean(core.sizeC[0] > 1), new Boolean(core.sizeC[0] > 1), new Boolean(core.sizeC[0] > 2), Boolean.FALSE, null, null, null, null, null, null, null, null, null, null, null); } */ } if (!readXML || !readCFG) { File file = new File(id).getAbsoluteFile(); File parent = file.getParentFile(); String[] listing = file.exists() ? parent.list() : (String[]) Location.getIdMap().keySet().toArray(new String[0]); for (int i=0; i<listing.length; i++) { String path = listing[i].toLowerCase(); if ((!readXML && path.endsWith(".xml")) || (readXML && path.endsWith(".cfg"))) { String dir = ""; if (file.exists()) { dir = parent.getPath(); if (!dir.endsWith(File.separator)) dir += File.separator; } initFile(dir + listing[i]); } } } } else { // we have been given a TIFF file - reinitialize with the proper XML file status("Finding XML file"); Location f = new Location(id); f = f.getAbsoluteFile(); Location parent = f.getParentFile(); String[] listing = parent.list(); for (int i=0; i<listing.length; i++) { String path = listing[i].toLowerCase(); if (path.endsWith(".xml") || path.endsWith(".cfg")) { initFile(new Location(path).getAbsolutePath()); } } } if (currentId == null) currentId = id; } }
package nl.rutgerkok.blocklocker.impl.nms; import java.lang.reflect.Constructor; import java.lang.reflect.Field; import java.lang.reflect.Method; import org.bukkit.Bukkit; import org.bukkit.World; import org.bukkit.block.Sign; import org.json.simple.JSONArray; import org.json.simple.JSONValue; import com.google.common.base.Optional; /** * Implementation of methods required by * nl.rutgerkok.chestsignprotect.impl.NMSAccessor for Minecraft 1.7.8 and 1.7.9. * */ public final class NMSAccessor implements ServerSpecific { static Object call(Object on, Method method, Object... parameters) { try { return method.invoke(on, parameters); } catch (Exception e) { throw new RuntimeException(e); } } static Object enumField(Class<Enum<?>> enumClass, String name) { try { Method valueOf = getMethod(Enum.class, "valueOf", Class.class, String.class); return invokeStatic(valueOf, enumClass, name); } catch (Exception e) { throw new RuntimeException(e); } } static Constructor<?> getConstructor(Class<?> clazz, Class<?>... paramTypes) { try { return clazz.getConstructor(paramTypes); } catch (Exception e) { throw new RuntimeException(e); } } static Field getField(Class<?> clazz, String name) { try { return clazz.getField(name); } catch (Exception e) { throw new RuntimeException(e); } } static Method getMethod(Class<?> clazz, String name, Class<?>... parameterTypes) { try { return clazz.getMethod(name, parameterTypes); } catch (Exception e) { throw new RuntimeException(e); } } /** * Gets the Minecraft class version of the server, like "v1_8_R2". * * @return Minecraft class version. */ private static String getMinecraftClassVersion() { String serverClassName = Bukkit.getServer().getClass().getName(); String version = serverClassName.split("\\.")[3]; if (!version.startsWith("v")) { throw new AssertionError("Failed to detect Minecraft version, found " + version + " in " + serverClassName); } return version; } static Object invokeStatic(Method method, Object... parameters) { return call(null, method, parameters); } static Object newInstance(Constructor<?> constructor, Object... params) { try { return constructor.newInstance(params); } catch (Exception e) { throw new RuntimeException(e); } } static Object retrieve(Object on, Field field) { try { return field.get(on); } catch (Exception e) { throw new RuntimeException(e); } } private final String nmsPrefix; private final String obcPrefix; final Class<?> BlockPosition; final Constructor<?> BlockPosition_new; final Class<?> ChatComponentText; final Constructor<?> ChatComponentText_new; final Class<?> ChatHoverable; final Method ChatHoverable_getChatComponent; final Constructor<?> ChatHoverable_new; final Class<?> ChatModifier; final Method ChatModifier_getGetHoverEvent; final Constructor<?> ChatModifier_new; final Class<?> CraftChatMessage; final Method CraftChatMessage_fromComponent; final Class<?> CraftWorld; final Method CraftWorld_getHandle; final Class<Enum<?>> EnumHoverAction; final Object EnumHoverAction_SHOW_TEXT; final Class<?> IChatBaseComponent; final Method IChatBaseComponent_getChatModifier; final Method ChatModifier_setChatHoverable; final Class<?> TileEntitySign; final Field TileEntitySign_lines; final Class<?> WorldServer; final Method WorldServer_getTileEntity; public NMSAccessor() { String version = getMinecraftClassVersion(); nmsPrefix = "net.minecraft.server." + version + "."; obcPrefix = "org.bukkit.craftbukkit." + version + "."; BlockPosition = getNMSClass("BlockPosition"); WorldServer = getNMSClass("WorldServer"); ChatModifier = getNMSClass("ChatModifier"); ChatHoverable = getNMSClass("ChatHoverable"); IChatBaseComponent = getNMSClass("IChatBaseComponent"); EnumHoverAction = getAnyNMSEnum("EnumHoverAction", "ChatHoverable$EnumHoverAction"); TileEntitySign = getNMSClass("TileEntitySign"); ChatComponentText = getNMSClass("ChatComponentText"); CraftWorld = getOBCClass("CraftWorld"); CraftChatMessage = getOBCClass("util.CraftChatMessage"); CraftWorld_getHandle = getMethod(CraftWorld, "getHandle"); CraftChatMessage_fromComponent = getMethod(CraftChatMessage, "fromComponent", IChatBaseComponent); WorldServer_getTileEntity = getMethod(WorldServer, "getTileEntity", BlockPosition); IChatBaseComponent_getChatModifier = getMethod(IChatBaseComponent, "getChatModifier"); ChatModifier_setChatHoverable = getMethod(ChatModifier, "setChatHoverable", ChatHoverable); ChatModifier_getGetHoverEvent = getMethod(ChatModifier, "getHoverEvent"); ChatHoverable_getChatComponent = getMethod(ChatHoverable, "b"); ChatComponentText_new = getConstructor(ChatComponentText, String.class); BlockPosition_new = getConstructor(BlockPosition, int.class, int.class, int.class); ChatModifier_new = getConstructor(ChatModifier); ChatHoverable_new = getConstructor(ChatHoverable, EnumHoverAction, IChatBaseComponent); TileEntitySign_lines = getField(TileEntitySign, "lines"); EnumHoverAction_SHOW_TEXT = enumField(EnumHoverAction, "SHOW_TEXT"); } private String chatComponentToString(Object chatComponent) { return (String) invokeStatic(CraftChatMessage_fromComponent, chatComponent); } Class<Enum<?>> getAnyNMSEnum(String... possibleNames) { Exception lastException = null; for (String name : possibleNames) { try { return getNMSEnum(name); } catch (Exception e) { lastException = e; } } throw new RuntimeException(lastException); } Object getBlockPosition(int x, int y, int z) { return newInstance(BlockPosition_new, x, y, z); } @Override public JsonSign getJsonData(World world, int x, int y, int z) { // Find sign Optional<?> nmsSign = toNmsSign(world, x, y, z); if (!nmsSign.isPresent()) { return JsonSign.EMPTY; } // Find strings stored in hovertext Optional<String> secretData = getSecretData(nmsSign.get()); if (!secretData.isPresent()) { return JsonSign.EMPTY; } // Find first line Object firstLineObj = ((Object[]) retrieve(nmsSign.get(), TileEntitySign_lines))[0]; String firstLine = firstLineObj == null ? "" : chatComponentToString(firstLineObj); // Parse and sanitize the sting Object data = JSONValue.parse(secretData.get()); if (data instanceof JSONArray) { return new JsonSign(firstLine, (JSONArray) data); } return JsonSign.EMPTY; } Class<?> getNMSClass(String name) { try { return Class.forName(nmsPrefix + name); } catch (ClassNotFoundException e) { throw new RuntimeException(e); } } Class<Enum<?>> getNMSEnum(String name) { Class<?> clazz = getNMSClass(name); if (!clazz.isEnum()) { throw new IllegalArgumentException(clazz + " is not an enum"); } @SuppressWarnings("unchecked") Class<Enum<?>> enumClazz = (Class<Enum<?>>) clazz; return enumClazz; } Class<?> getOBCClass(String name) { try { return Class.forName(obcPrefix + name); } catch (Exception e) { throw new RuntimeException(e); } } private Optional<String> getSecretData(Object tileEntitySign) { Object line = ((Object[]) retrieve(tileEntitySign, TileEntitySign_lines))[0]; if (line == null) { return Optional.absent(); } Object chatModifier = call(line, IChatBaseComponent_getChatModifier); if (chatModifier == null) { return Optional.absent(); } Object chatHoverable = call(chatModifier, ChatModifier_getGetHoverEvent); if (chatHoverable == null) { return Optional.absent(); } return Optional.of(chatComponentToString(call(chatHoverable, ChatHoverable_getChatComponent))); } @Override public void setJsonData(Sign sign, JSONArray jsonArray) { Optional<?> nmsSign = toNmsSign(sign.getWorld(), sign.getX(), sign.getY(), sign.getZ()); if (!nmsSign.isPresent()) { throw new RuntimeException("No sign at " + sign.getLocation()); } setSecretData(nmsSign.get(), jsonArray.toJSONString()); } private void setSecretData(Object tileEntitySign, String data) { Object line = ((Object[]) retrieve(tileEntitySign, TileEntitySign_lines))[0]; Object modifier = call(line, IChatBaseComponent_getChatModifier); if (modifier == null) { modifier = newInstance(ChatModifier_new); } Object chatComponentText = newInstance(ChatComponentText_new, data); Object hoverable = newInstance(ChatHoverable_new, EnumHoverAction_SHOW_TEXT, chatComponentText); call(modifier, ChatModifier_setChatHoverable, hoverable); } private Optional<?> toNmsSign(World world, int x, int y, int z) { Object nmsWorld = call(world, CraftWorld_getHandle); Object tileEntity = call(nmsWorld, WorldServer_getTileEntity, getBlockPosition(x, y, z)); if (!TileEntitySign.isInstance(tileEntity)) { return Optional.absent(); } return Optional.of(tileEntity); } }
package org.bdgp.OpenHiCAMM; import java.util.List; import java.util.ArrayList; import org.micromanager.acquisition.MMAcquisition; import org.micromanager.utils.MMScriptException; public class MMAcquisitionCache { private static List<MMCache> cache = new ArrayList<MMCache>(); private static final int MAX_CACHE = 2; private MMAcquisitionCache() { } public static synchronized MMAcquisition getAcquisition( String name, String dir, boolean show, boolean diskCached, boolean existing) { MMCache mmCache = new MMCache(name, dir, show, diskCached, existing); if (!cache.contains(mmCache)) { if (cache.size() >= MAX_CACHE) cache.remove(0); cache.add(mmCache); } return cache.get(cache.indexOf(mmCache)).getAcquisition(); } public static class MMCache { private String name; private String dir; private boolean show; private boolean diskCached; private boolean existing; private MMAcquisition acquisition; public MMCache(String name, String dir, boolean show, boolean diskCached, boolean existing) { this.name = name; this.dir = dir; this.show = show; this.diskCached = diskCached; this.existing = existing; } public String getName() { return name; } public String getDir() { return dir; } public boolean isShow() { return show; } public boolean isDiskCached() { return diskCached; } public boolean isExisting() { return existing; } public MMAcquisition getAcquisition() { if (this.acquisition == null) { try { this.acquisition = new MMAcquisition(name, dir, show, diskCached, existing); this.acquisition.initialize(); } catch (MMScriptException e) {throw new RuntimeException(e);} } return this.acquisition; } @Override public int hashCode() { final int prime = 31; int result = 1; result = prime * result + ((dir == null) ? 0 : dir.hashCode()); result = prime * result + (diskCached ? 1231 : 1237); result = prime * result + (existing ? 1231 : 1237); result = prime * result + ((name == null) ? 0 : name.hashCode()); result = prime * result + (show ? 1231 : 1237); return result; } @Override public boolean equals(Object obj) { if (this == obj) return true; if (obj == null) return false; if (getClass() != obj.getClass()) return false; MMCache other = (MMCache) obj; if (dir == null) { if (other.dir != null) return false; } else if (!dir.equals(other.dir)) return false; if (diskCached != other.diskCached) return false; if (existing != other.existing) return false; if (name == null) { if (other.name != null) return false; } else if (!name.equals(other.name)) return false; if (show != other.show) return false; return true; } } }
package net.hearthstats; import java.awt.Color; import java.awt.Graphics; import java.awt.Image; import java.awt.Toolkit; import java.awt.image.BufferedImage; import java.awt.image.BufferedImageOp; import java.awt.image.ColorConvertOp; import java.awt.image.CropImageFilter; import java.awt.image.DataBufferInt; import java.awt.image.FilteredImageSource; import java.awt.image.RescaleOp; import java.io.File; import java.io.IOException; import java.util.Observable; import javax.imageio.ImageIO; import net.sourceforge.tess4j.Tesseract; import net.sourceforge.tess4j.TesseractException; public class HearthstoneAnalyzer extends Observable { private boolean _coin; private BufferedImage _image; private String _mode; private String _opponentClass; private String _opponentName; private String _result; private String _screen; private String _yourClass; private int _deckSlot; private boolean _isNewArena = false; private float _ratio; private int _xOffset; private int _width; private int _height; private float _screenRatio; public HearthstoneAnalyzer() { } public void analyze(BufferedImage image) { _image = image; _calculateResolutionRatios(); if(getScreen() != "Main Menu" && getScreen() != "Playing") { _testForMainMenuScreen(); } if(getScreen() != "Play") { _testForPlayScreen(); } if(getScreen() != "Arena") { _testForArenaModeScreen(); } if(getScreen() == "Play" || getScreen() == "Arena") { _testForFindingOpponent(); if (getScreen() == "Play") { if(getMode() != "Casual") _testForCasualMode(); if(getMode() != "Ranked") _testForRankedMode(); _testForDeckSlot(); } } if(getScreen() == "Match Start" || getScreen() == "Opponent Name") { if(getYourClass() == null) _testForYourClass(); if(getOpponentClass() == null) _testForOpponentClass(); if(!getCoin()) _testForCoin(); if(getScreen() != "Opponent Name") _testForOpponentName(); } else { if(getScreen() != "Playing") _testForMatchStartScreen(); } if(getScreen() == "Result" || getScreen() == "Arena") { _testForArenaEnd(); } if(getScreen() == "Playing") { _testForVictory(); _testForDefeat(); } else { if(getScreen() != "Result") _testForPlayingScreen(); } if(getScreen() == "Arena" && !isNewArena()) { _testForNewArenaRun(); } _image.flush(); } private void _calculateResolutionRatios() { // handle 4:3 screen ratios _ratio = _image.getHeight() / (float) 768; _xOffset = 0; _width = _image.getWidth(); _height = _image.getHeight(); _screenRatio = (float) _width / _height; // handle widescreen x offsets if(_screenRatio > 1.4) { _xOffset = 107; _xOffset = (int) (((float) _width - (_ratio * 1024)) / 2); } } public boolean getCoin() { return _coin; } public int getDeckSlot() { return _deckSlot; } public String getMode() { return _mode; } public String getOpponentClass() { return _opponentClass; } public String getOpponentName() { return _opponentName; } public String getResult() { return _result; } public String getScreen() { return _screen; } public String getYourClass() { return _yourClass; } public boolean isNewArena() { return _isNewArena; } private void _notifyObserversOfChangeTo(String property) { setChanged(); notifyObservers(property); } public void setIsNewArena(boolean isNew) { _isNewArena = isNew; _notifyObserversOfChangeTo("newArena"); } private void _setDeckSlot(int deckSlot) { _deckSlot = deckSlot; _notifyObserversOfChangeTo("deckSlot"); } private void _setCoin(boolean coin) { _coin = coin; _notifyObserversOfChangeTo("coin"); } private void _setMode(String screen) { _mode = screen; _notifyObserversOfChangeTo("mode"); } private void _setOpponentClass(String opponentClass) { _opponentClass = opponentClass; _notifyObserversOfChangeTo("opponentClass"); } private void _setOpponentName(String opponentName) { _opponentName = opponentName; _notifyObserversOfChangeTo("opponentName"); } private void _setResult(String result) { _result = result; _notifyObserversOfChangeTo("result"); } private void _setScreen(String screen) { _screen = screen; _notifyObserversOfChangeTo("screen"); } private void _setYourClass(String yourClass) { _yourClass = yourClass; _notifyObserversOfChangeTo("yourClass"); } private void _testForArenaEnd() { int[][] tests = { { 315, 387, 239, 32, 39 }, { 399, 404, 237, 41, 33 }, { 448, 408, 223, 8, 16 } }; if((new PixelGroupTest(_image, tests)).passed()) { _screen = "Arena"; _notifyObserversOfChangeTo("arenaEnd"); } } private void _testForArenaModeScreen() { int[][] tests = { { 807, 707, 95, 84, 111 }, { 324, 665, 77, 114, 169 }, { 120, 685, 255, 215, 115 }, { 697, 504, 78, 62, 56 } }; if((new PixelGroupTest(_image, tests)).passed()) { _setScreen("Arena"); _setMode("Arena"); } } private void _testForCasualMode() { int[][] tests = { { 833, 94, 100, 22, 16 }, // ranked off { 698, 128, 200, 255, 255 } // casual blue }; PixelGroupTest testOne = new PixelGroupTest(_image, tests); int[][] testsTwo = { { 812, 178, 255, 255, 255}, { 758, 202, 215, 255, 255 } }; PixelGroupTest testTwo = new PixelGroupTest(_image, testsTwo); if(testOne.passed() || testTwo.passed()) _setMode("Casual"); } private void _testForCoin() { int[][] tests = { // fourth card right edge { 869, 389, 155, 250, 103 }, { 864, 328, 130, 255, 85 }, { 870, 340, 127, 255, 83 }, { 769, 280, 125, 255, 82 }, { 864, 379, 126, 255, 82 } }; if((new PixelGroupTest(_image, tests)).passedOr()) _setCoin(true); } private void _testForDeckSlot() { if(getDeckSlot() != 1) { int[][] slotOnePixels = { { 163, 178, 33, 129, 242}, { 183, 178, 33, 129, 242} }; if((new PixelGroupTest(_image, slotOnePixels)).passedOr()) _setDeckSlot(1); } if(getDeckSlot() != 2) { int[][] slotTwoPixels = { { 348, 178, 36, 144, 247 }, { 368, 178, 36, 144, 247 } }; if((new PixelGroupTest(_image, slotTwoPixels)).passedOr()) _setDeckSlot(2); } if(getDeckSlot() != 3) { int[][] slotTwoPixels = { { 506, 178, 36, 144, 247 }, { 526, 178, 36, 144, 247 } }; if((new PixelGroupTest(_image, slotTwoPixels)).passedOr()) _setDeckSlot(3); } if(getDeckSlot() != 4) { int[][] slotOnePixels = { { 163, 339, 33, 129, 242}, { 183, 339, 33, 129, 242} }; if((new PixelGroupTest(_image, slotOnePixels)).passedOr()) _setDeckSlot(4); } if(getDeckSlot() != 5) { int[][] slotTwoPixels = { { 348, 339, 36, 144, 247 }, { 368, 339, 36, 144, 247 } }; if((new PixelGroupTest(_image, slotTwoPixels)).passedOr()) _setDeckSlot(5); } if(getDeckSlot() != 6) { int[][] slotTwoPixels = { { 506, 339, 36, 144, 247 }, { 526, 339, 36, 144, 247 } }; if((new PixelGroupTest(_image, slotTwoPixels)).passedOr()) _setDeckSlot(6); } if(getDeckSlot() != 7) { int[][] slotOnePixels = { { 163, 497, 33, 129, 242}, { 183, 497, 33, 129, 242} }; if((new PixelGroupTest(_image, slotOnePixels)).passedOr()) _setDeckSlot(7); } if(getDeckSlot() != 8) { int[][] slotTwoPixels = { { 348, 497, 36, 144, 247 }, { 368, 497, 36, 144, 247 } }; if((new PixelGroupTest(_image, slotTwoPixels)).passedOr()) _setDeckSlot(8); } if(getDeckSlot() != 9) { int[][] slotTwoPixels = { { 506, 497, 36, 144, 247 }, { 526, 497, 36, 144, 247 } }; if((new PixelGroupTest(_image, slotTwoPixels)).passedOr()) _setDeckSlot(9); } } private void _testForDefeat() { int[][] tests = { { 745, 219, 164, 162, 155 }, { 344, 383, 134, 153, 239 }, { 696, 357, 201, 197, 188 } }; PixelGroupTest pxTest = new PixelGroupTest(_image, tests); int[][] testsTwo = { { 347, 382, 129, 148, 236 }, { 275, 345, 137, 138, 134 }, { 537, 155, 235, 226, 67 } }; PixelGroupTest pxTestTwo = new PixelGroupTest(_image, testsTwo); int[][] testsThree = { { 347, 382, 129, 148, 236 }, { 275, 345, 137, 138, 134 }, { 537, 155, 235, 226, 67 } }; PixelGroupTest pxTestThree = new PixelGroupTest(_image, testsThree); if (pxTest.passed() || pxTestTwo.passed() || pxTestThree.passed()) { _setScreen("Result"); _setResult("Defeat"); } } private void _testForClass(String className, int[][] pixelTests, boolean isYours) { if((new PixelGroupTest(_image, pixelTests)).passed()) { if(isYours) _setYourClass(className); else _setOpponentClass(className); } } private void _testForFindingOpponent() { int[][] tests = { { 401, 143, 180, 122, 145 }, // title bar { 765, 583, 121, 72, 100 } // bottom bar }; PixelGroupTest pxTest = new PixelGroupTest(_image, tests); int[][] arenaTests = { { 393, 145, 205, 166, 135 }, // title bar { 819, 235, 109, 87, 79 }, { 839, 585, 139, 113, 77 } }; PixelGroupTest arenaPxTest = new PixelGroupTest(_image, arenaTests); if (pxTest.passed() || arenaPxTest.passed()) { _coin = false; _yourClass = null; _opponentClass = null; _opponentName = null; _setScreen("Finding Opponent"); } } private void _testForOpponentName() { int[][] tests = { { 383, 116, 187, 147, 79 }, // title banner left { 631, 107, 173, 130, 70 }, // title banner right { 505, 595, 129, 199, 255 } // confirm button }; PixelGroupTest pxTest = new PixelGroupTest(_image, tests); if(pxTest.passed()) { _setScreen("Opponent Name"); _analyzeOpponnentName(); } } private void _analyzeOpponnentName() { int x = (int) ((getMode() == "Ranked" ? 76 : 6) * _ratio); int y = (int) (34 * _ratio); // with class name underneath // int y = (int) (40 * ratio); int imageWidth = (int) (150 * _ratio); int imageHeight = (int) (19 * _ratio); int bigWidth = imageWidth * 3; int bigHeight = imageHeight * 3; // get cropped image of name BufferedImage opponentNameImg = _image.getSubimage(x, y, imageWidth, imageHeight); // to gray scale BufferedImage grayscale = new BufferedImage(opponentNameImg.getWidth(), opponentNameImg.getHeight(), BufferedImage.TYPE_INT_RGB); BufferedImageOp grayscaleConv = new ColorConvertOp(opponentNameImg.getColorModel().getColorSpace(), grayscale.getColorModel().getColorSpace(), null); grayscaleConv.filter(opponentNameImg, grayscale); // blow it up for ocr BufferedImage newImage = new BufferedImage(bigWidth, bigHeight, BufferedImage.TYPE_INT_RGB); Graphics g = newImage.createGraphics(); g.drawImage(grayscale, 0, 0, bigWidth, bigHeight, null); g.dispose(); // invert image for (x = 0; x < newImage.getWidth(); x++) { for (y = 0; y < newImage.getHeight(); y++) { int rgba = newImage.getRGB(x, y); Color col = new Color(rgba, true); col = new Color(255 - col.getRed(), 255 - col.getGreen(), 255 - col.getBlue()); newImage.setRGB(x, y, col.getRGB()); } } // increase contrast RescaleOp rescaleOp = new RescaleOp(1.8f, -30, null); rescaleOp.filter(newImage, newImage); // Source and destination are the same. // save it to a file File outputfile = new File(Main.getExtractionFolder() + "/opponentname.jpg"); try { ImageIO.write(newImage, "jpg", outputfile); } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); _notifyObserversOfChangeTo("Exception: " + e.getMessage()); } _setOpponentName(OCR.process(Main.getExtractionFolder() + "/opponentname.jpg")); } private void _testForMainMenuScreen() { int[][] tests = { { 338, 453, 159, 96, 42 }, // box top { 211, 658, 228, 211, 116 }, // quest button exclamation mark { 513, 148, 36, 23, 24 } // dark vertical line in top center }; if((new PixelGroupTest(_image, tests)).passed()) _setScreen("Main Menu"); } private void _testForMatchStartScreen() { int[][] tests = { { 403, 487, 201, 173, 94 }, // title bar { 946, 149, 203, 174, 96 } // bottom bar }; if ((new PixelGroupTest(_image, tests)).passed()) { _setScreen("Match Start"); } } private void _testForNewArenaRun() { int[][] tests = { { 298, 170, 255, 239, 148 }, // key //{ 492, 204, 128, 79, 47 }, // key stem { 382, 294, 255, 255, 255 }, // zero { 393, 281, 255, 255, 255 }, // zero { 321, 399, 209, 179, 127 }, // no red x }; if ((new PixelGroupTest(_image, tests)).passed()) { setIsNewArena(true); } } private void _testForOpponentClass() { // Druid Test int[][] druidTests = { { 743, 118, 205, 255, 242 }, { 882, 141, 231, 255, 252 }, { 766, 215, 203, 160, 198 } }; _testForClass("Druid", druidTests, false); // Hunter Test int[][] hunterTests = { { 825, 66, 173, 178, 183 }, { 818, 175, 141, 37, 0 }, { 739, 309, 216, 214, 211 } }; _testForClass("Hunter", hunterTests, false); // Mage Test int[][] mageTests = { { 790, 68, 88, 23, 99 }, { 788, 312, 215, 188, 177 }, { 820, 247, 53, 64, 82 } }; _testForClass("Mage", mageTests, false); // Paladin Test int[][] paladinTests = { { 895, 213, 255, 247, 147 }, { 816, 301, 125, 237, 255 }, { 767, 82, 133, 107, 168 } }; _testForClass("Paladin", paladinTests, false); // Priest Test int[][] priestTests = { { 724, 189, 255, 236, 101 }, { 796, 243, 58, 72, 138 }, { 882, 148, 27, 20, 38 } }; _testForClass("Priest", priestTests, false); // Rogue Test int[][] rogueTests = { { 889, 254, 132, 196, 72 }, { 790, 273, 88, 21, 34 }, { 841, 73, 100, 109, 183 } }; _testForClass("Rogue", rogueTests, false); // Shaman Test int[][] shamanTests = { { 748, 94, 5, 50, 100 }, { 887, 169, 234, 50, 32 }, { 733, 206, 186, 255, 255 } }; _testForClass("Shaman", shamanTests, false); // Warlock Test int[][] warlockTests = { { 711, 203, 127, 142, 36 }, { 832, 264, 240, 244, 252 }, { 832, 65, 98, 129, 0 } }; _testForClass("Warlock", warlockTests, false); // Warrior Test int[][] warriorTests = { { 795, 64, 37, 4, 0 }, { 780, 83, 167, 23, 4 }, { 809, 92, 255, 247, 227 } }; _testForClass("Warrior", warriorTests, false); } private void _testForPlayingScreen() { // check for normal play boards int[][] tests = { { 336, 203, 231, 198, 124 }, { 763, 440, 234, 198, 124 } }; PixelGroupTest normalPxTest = new PixelGroupTest(_image, tests); // check for lighter orc board int[][] orcBoardTests = { { 906, 283, 222, 158, 94 }, { 120, 468, 195, 134, 78 } }; PixelGroupTest orcPxTest = new PixelGroupTest(_image, orcBoardTests); if (normalPxTest.passed() || orcPxTest.passed()) { _setScreen("Playing"); // _analyzeOpponnentName(); } } private void _testForPlayScreen() { int[][] tests = { { 543, 130, 121, 32, 22 }, // play mode red background { 254, 33, 197, 173, 132 }, // mode title light brown background { 956, 553, 24, 8, 8 }, { 489, 688, 68, 65, 63 } }; if((new PixelGroupTest(_image, tests)).passed()) _setScreen("Play"); } private void _testForRankedMode() { int[][] tests = { { 833, 88, 220, 255, 255 }, // ranked blue { 698, 120, 56, 16, 8 } // casual off }; PixelGroupTest testOne = new PixelGroupTest(_image, tests); int[][] testsTwo = { { 840, 184, 199, 255, 255 }, { 948, 167, 192, 255, 255 } }; PixelGroupTest testTwo = new PixelGroupTest(_image, testsTwo); if(testOne.passed() || testTwo.passed()) _setMode("Ranked"); } private void _testForVictory() { int[][] tests = { { 334, 504, 88, 101, 192 }, { 683, 510, 74, 88, 173 }, { 549, 162, 255, 224, 119 } }; PixelGroupTest pxTest = new PixelGroupTest(_image, tests); int[][] testsTwo = { { 347, 469, 85, 102, 203 }, { 737, 339, 63, 76, 148 }, { 774, 214, 253, 243, 185 } }; PixelGroupTest pxTestTwo = new PixelGroupTest(_image, testsTwo); int[][] testsThree = { { 370, 528, 66, 81, 165 }, { 690, 553, 63, 76, 162 }, { 761, 228, 249, 234, 163 } }; PixelGroupTest pxTestThree = new PixelGroupTest(_image, testsThree); if(pxTest.passed() || pxTestTwo.passed() || pxTestThree.passed()) { _setScreen("Result"); _setResult("Victory"); } } private void _testForYourClass() { // Druid Test int[][] druidTests = { { 225, 480, 210, 255, 246 }, { 348, 510, 234, 255, 251 }, { 237, 607, 193, 155, 195 } }; _testForClass("Druid", druidTests, true); // Hunter Test int[][] hunterTests = { { 289, 438, 173, 161, 147 }, { 366, 554, 250, 200, 81 }, { 210, 675, 209, 209, 211 } }; _testForClass("Hunter", hunterTests, true); // Mage Test int[][] mageTests = { { 259, 439, 96, 31, 102 }, { 294, 677, 219, 210, 193 }, { 216, 591, 0, 0, 56 } }; _testForClass("Mage", mageTests, true); // Paladin Test int[][] paladinTests = { { 249, 447, 133, 105, 165 }, { 304, 671, 74, 146, 234 }, { 368, 581, 244, 238, 141 } }; _testForClass("Paladin", paladinTests, true); // Priest Test int[][] priestTests = { { 229, 491, 180, 178, 166 }, { 256, 602, 82, 104, 204 }, { 350, 611, 22, 23, 27 } }; _testForClass("Priest", priestTests, true); // Rogue Test int[][] rogueTests = { { 309, 446, 91, 107, 175 }, { 291, 468, 187, 37, 25 }, { 362, 623, 122, 186, 67 } }; _testForClass("Rogue", rogueTests, true); // Shaman Test int[][] shamanTests = { { 223, 458, 4, 46, 93 }, { 360, 533, 213, 32, 6 }, { 207, 578, 177, 245, 249 } }; _testForClass("Shaman", shamanTests, true); // Warlock Test int[][] warlockTests = { { 301, 435, 104, 138, 8 }, { 265, 493, 221, 51, 32 }, { 294, 680, 60, 75, 182 } }; _testForClass("Warlock", warlockTests, true); // Warrior Test int[][] warriorTests = { { 252, 452, 163, 10, 0 }, { 291, 579, 234, 192, 53 }, { 280, 461, 255, 245, 225 } }; _testForClass("Warior", warriorTests, true); } }
package nl.topicus.jdbc.transaction; import java.sql.SQLException; import java.sql.Savepoint; import java.util.ArrayList; import java.util.Arrays; import java.util.HashMap; import java.util.HashSet; import java.util.Iterator; import java.util.List; import java.util.Map; import java.util.Set; import java.util.concurrent.BlockingQueue; import java.util.concurrent.LinkedBlockingQueue; import java.util.concurrent.TimeUnit; import java.util.stream.Collectors; import com.google.cloud.Timestamp; import com.google.cloud.spanner.DatabaseClient; import com.google.cloud.spanner.Mutation; import com.google.cloud.spanner.ResultSet; import com.google.cloud.spanner.SpannerException; import com.google.cloud.spanner.Statement; import com.google.cloud.spanner.TransactionContext; import com.google.cloud.spanner.TransactionRunner; import com.google.cloud.spanner.TransactionRunner.TransactionCallable; import com.google.common.base.Preconditions; import com.google.rpc.Code; import nl.topicus.jdbc.CloudSpannerDriver; import nl.topicus.jdbc.Logger; import nl.topicus.jdbc.exception.CloudSpannerSQLException; class TransactionThread extends Thread { public static class QueryException extends RuntimeException { private static final long serialVersionUID = 1L; private QueryException(String message, Throwable cause) { super(message, cause); } } private static class RollbackException extends RuntimeException { private static final long serialVersionUID = 1L; } enum TransactionStatus { NOT_STARTED, RUNNING, SUCCESS, FAIL; } private enum TransactionStopStatement { COMMIT, ROLLBACK, PREPARE, COMMIT_PREPARED, ROLLBACK_PREPARED; } private final Logger logger; private final StackTraceElement[] stackTraceElements; private final Object monitor = new Object(); private DatabaseClient dbClient; private boolean stop; private boolean stopped; private TransactionStatus status = TransactionStatus.NOT_STARTED; private Timestamp commitTimestamp; private Exception exception; private TransactionStopStatement stopStatement = null; /** * The XA transaction id to be prepared/committed/rolled back */ private String xid; private final Set<String> stopStatementStrings = new HashSet<>(Arrays.asList(TransactionStopStatement.values()).stream().map(x -> x.name()) .collect(Collectors.toList())); private List<Mutation> mutations = new ArrayList<>(40); private Map<Savepoint, Integer> savepoints = new HashMap<>(); private BlockingQueue<Statement> statements = new LinkedBlockingQueue<>(); private BlockingQueue<ResultSet> resultSets = new LinkedBlockingQueue<>(); private static int threadInitNumber; private static synchronized int nextThreadNum() { return threadInitNumber++; } TransactionThread(DatabaseClient dbClient, Logger logger) { super("Google Cloud Spanner JDBC Transaction Thread-" + nextThreadNum()); Preconditions.checkNotNull(dbClient, "dbClient may not be null"); Preconditions.checkNotNull(logger, "logger may not be null"); this.dbClient = dbClient; this.logger = logger; if (logger != null && logger.logDebug()) { this.stackTraceElements = Thread.currentThread().getStackTrace(); } else { this.stackTraceElements = null; } setDaemon(true); } @Override public void run() { TransactionRunner runner = dbClient.readWriteTransaction(); synchronized (monitor) { try { status = runner.run(new TransactionCallable<TransactionStatus>() { @Override public TransactionStatus run(TransactionContext transaction) throws Exception { long startTime = System.currentTimeMillis(); long lastTriggerTime = startTime; boolean transactionStartedLogged = false; boolean stackTraceLoggedForKeepAlive = false; boolean stackTraceLoggedForLongRunning = false; status = TransactionStatus.RUNNING; while (!stop) { try { Statement statement = statements.poll(5, TimeUnit.SECONDS); if (statement != null) { String sql = statement.getSql(); if (!stopStatementStrings.contains(sql)) { resultSets.put(transaction.executeQuery(statement)); } } else { // keep alive transactionStartedLogged = logTransactionStarted(transactionStartedLogged, startTime); logger.info(String.format("%s, %s", getName(), "Transaction has been inactive for more than 5 seconds and will do a keep-alive query")); if (!stackTraceLoggedForKeepAlive) { logStartStackTrace(); stackTraceLoggedForKeepAlive = true; } try (ResultSet rs = transaction.executeQuery(Statement.of("SELECT 1"))) { rs.next(); } } if (!stop && logger.logInfo() && (System.currentTimeMillis() - lastTriggerTime) > CloudSpannerDriver .getLongTransactionTrigger()) { transactionStartedLogged = logTransactionStarted(transactionStartedLogged, startTime); logger.info(String.format("%s, %s", getName(), "Transaction has been running for " + (System.currentTimeMillis() - startTime) + "ms")); if (!stackTraceLoggedForLongRunning) { logStartStackTrace(); stackTraceLoggedForLongRunning = true; } lastTriggerTime = System.currentTimeMillis(); } } catch (InterruptedException e) { logDebugIfTransactionStartedLogged(transactionStartedLogged, "Transaction interrupted"); stopped = true; exception = e; throw e; } } switch (stopStatement) { case COMMIT: logDebugIfTransactionStartedLogged(transactionStartedLogged, "Transaction committed"); transaction.buffer(mutations); break; case ROLLBACK: // throw an exception to force a rollback logDebugIfTransactionStartedLogged(transactionStartedLogged, "Transaction rolled back"); throw new RollbackException(); case PREPARE: logDebugIfTransactionStartedLogged(transactionStartedLogged, "Transaction prepare called"); XATransaction.prepareMutations(transaction, xid, mutations); break; case COMMIT_PREPARED: logDebugIfTransactionStartedLogged(transactionStartedLogged, "Transaction commit prepared called"); XATransaction.commitPrepared(transaction, xid); break; case ROLLBACK_PREPARED: logDebugIfTransactionStartedLogged(transactionStartedLogged, "Transaction rollback prepared called"); XATransaction.rollbackPrepared(transaction, xid); break; } logDebugIfTransactionStartedLogged(transactionStartedLogged, "Transaction successfully stopped"); return TransactionStatus.SUCCESS; } }); commitTimestamp = runner.getCommitTimestamp(); } catch (Exception e) { if (e.getCause() instanceof RollbackException) { status = TransactionStatus.SUCCESS; } else { // if statement prevents unnecessary String.format(...) call if (logger.logDebug()) { logger.debug(String.format("%s, %s", getName(), "Transaction threw an exception: " + e.getMessage())); } status = TransactionStatus.FAIL; exception = e; } } finally { stopped = true; monitor.notifyAll(); } } } private void logDebugIfTransactionStartedLogged(boolean transactionStartedLogged, String log) { if (transactionStartedLogged) { logger.debug(String.format("%s, %s", getName(), log)); } } private boolean logTransactionStarted(boolean transactionStartedLogged, long startTime) { if (!transactionStartedLogged) { logger.debug(String.format("%s, %s", getName(), "This transaction started at " + new java.sql.Timestamp(startTime).toString())); } return true; } private void logStartStackTrace() { if (stackTraceElements != null) { logger.debug(String.format("%s, %s", getName(), "Transaction was started by: ")); for (StackTraceElement ste : stackTraceElements) { logger.debug("\t" + ste.toString()); } } } ResultSet executeQuery(Statement statement) { try { statements.put(statement); return resultSets.take(); } catch (InterruptedException e) { Thread.currentThread().interrupt(); throw new QueryException("Query execution interrupted", e); } } boolean hasBufferedMutations() { return !mutations.isEmpty(); } int numberOfBufferedMutations() { return mutations.size(); } void buffer(Mutation mutation) { if (mutation == null) throw new NullPointerException("Mutation is null"); mutations.add(mutation); } void buffer(Iterable<Mutation> mutations) { Iterator<Mutation> it = mutations.iterator(); while (it.hasNext()) buffer(it.next()); } void setSavepoint(Savepoint savepoint) { Preconditions.checkNotNull(savepoint); savepoints.put(savepoint, mutations.size()); } void rollbackSavepoint(Savepoint savepoint) throws CloudSpannerSQLException { Preconditions.checkNotNull(savepoint); Integer index = savepoints.get(savepoint); if (index == null) { throw new CloudSpannerSQLException("Unknown savepoint: " + savepoint.toString(), Code.INVALID_ARGUMENT); } mutations.subList(index.intValue(), mutations.size()).clear(); removeSavepointsAfter(index.intValue()); } void releaseSavepoint(Savepoint savepoint) throws CloudSpannerSQLException { Preconditions.checkNotNull(savepoint); Integer index = savepoints.get(savepoint); if (index == null) { throw new CloudSpannerSQLException("Unknown savepoint: " + savepoint.toString(), Code.INVALID_ARGUMENT); } removeSavepointsAfter(index.intValue()); } private void removeSavepointsAfter(int index) { savepoints.entrySet().removeIf(e -> e.getValue() >= index); } Timestamp commit() throws SQLException { stopTransaction(TransactionStopStatement.COMMIT); return commitTimestamp; } void rollback() throws SQLException { stopTransaction(TransactionStopStatement.ROLLBACK); } void prepareTransaction(String xid) throws SQLException { this.xid = xid; stopTransaction(TransactionStopStatement.PREPARE); } void commitPreparedTransaction(String xid) throws SQLException { this.xid = xid; stopTransaction(TransactionStopStatement.COMMIT_PREPARED); } void rollbackPreparedTransaction(String xid) throws SQLException { this.xid = xid; stopTransaction(TransactionStopStatement.ROLLBACK_PREPARED); } private void stopTransaction(TransactionStopStatement statement) throws SQLException { if (status == TransactionStatus.FAIL || status == TransactionStatus.SUCCESS) return; while (status == TransactionStatus.NOT_STARTED) { try { Thread.sleep(1); } catch (InterruptedException e) { Thread.currentThread().interrupt(); throw new CloudSpannerSQLException(getFailedMessage(statement, e), Code.ABORTED, e); } } this.stopStatement = statement; stop = true; // Add a statement object in order to get the transaction thread to // proceed statements.add(Statement.of(statement.name())); synchronized (monitor) { while (!stopped || status == TransactionStatus.NOT_STARTED || status == TransactionStatus.RUNNING) { try { monitor.wait(); } catch (InterruptedException e) { Thread.currentThread().interrupt(); throw new CloudSpannerSQLException(getFailedMessage(statement, e), Code.ABORTED, e); } } } if (status == TransactionStatus.FAIL && exception != null) { Code code = Code.UNKNOWN; if (exception instanceof CloudSpannerSQLException) code = ((CloudSpannerSQLException) exception).getCode(); if (exception instanceof SpannerException) code = Code.forNumber(((SpannerException) exception).getCode()); throw new CloudSpannerSQLException(getFailedMessage(statement, exception), code, exception); } } private String getFailedMessage(TransactionStopStatement statement, Exception e) { return statement.toString() + " failed: " + e.getMessage(); } TransactionStatus getTransactionStatus() { return status; } }
package org.broad.igv.sam.reader; import htsjdk.samtools.*; import htsjdk.samtools.seekablestream.SeekableStream; import htsjdk.samtools.util.CloseableIterator; import org.apache.log4j.Logger; import org.broad.igv.exceptions.DataLoadException; import org.broad.igv.sam.PicardAlignment; import org.broad.igv.util.FileUtils; import org.broad.igv.util.HttpUtils; import org.broad.igv.util.ResourceLocator; import org.broad.igv.util.stream.IGVSeekableBufferedStream; import org.broad.igv.util.stream.IGVSeekableStreamFactory; import java.io.*; import java.net.URL; import java.util.ArrayList; import java.util.Hashtable; import java.util.List; import java.util.Set; public class BAMHttpReader implements AlignmentReader<PicardAlignment> { static Logger log = Logger.getLogger(BAMHttpReader.class); // Length of day in milliseconds public static final long oneDay = 24 * 60 * 60 * 1000; static Hashtable<String, File> indexFileCache = new Hashtable<String, File>(); private final ResourceLocator locator; URL url; SAMFileHeader header; htsjdk.samtools.SamReader reader; List<String> sequenceNames; private boolean indexed = false; // False until proven otherwise public BAMHttpReader(ResourceLocator locator, boolean requireIndex) throws IOException { this.locator = locator; this.url = new URL(locator.getPath()); reader = getSamReader(locator, requireIndex); } public SamReader getSamReader(ResourceLocator locator, boolean requireIndex) throws IOException { if (requireIndex) { final SamReaderFactory factory = SamReaderFactory.makeDefault().validationStringency(ValidationStringency.SILENT); SeekableStream indexStream = getIndexStream(locator.getBamIndexPath()); this.indexed = true; SeekableStream ss = new IGVSeekableBufferedStream(IGVSeekableStreamFactory.getInstance().getStreamFor(url), 128000); SamInputResource resource = SamInputResource.of(ss).index(indexStream); return factory.open(resource); } else { InputStream is = HttpUtils.getInstance().openConnectionStream(url); return new SAMFileReader(new BufferedInputStream(is)); } } public void close() throws IOException { if (reader != null) { reader.close(); } } public SAMFileHeader getFileHeader() { if (header == null) { header = reader.getFileHeader(); } return header; } public boolean hasIndex() { return indexed; } public Set<String> getPlatforms() { return AlignmentReaderFactory.getPlatforms(getFileHeader()); } public List<String> getSequenceNames() { if (sequenceNames == null) { SAMFileHeader header = getFileHeader(); if (header == null) { return null; } sequenceNames = new ArrayList(); List<SAMSequenceRecord> records = header.getSequenceDictionary().getSequences(); if (records.size() > 0) { for (SAMSequenceRecord rec : header.getSequenceDictionary().getSequences()) { String chr = rec.getSequenceName(); sequenceNames.add(chr); } } } return sequenceNames; } public CloseableIterator<PicardAlignment> iterator() { try { if (reader == null) { InputStream is = HttpUtils.getInstance().openConnectionStream(url); reader = new SAMFileReader(new BufferedInputStream(is)); } return new WrappedIterator(reader.iterator()); } catch (IOException e) { log.error("Error creating iterator", e); throw new RuntimeException(e); } } public CloseableIterator<PicardAlignment> query(String sequence, int start, int end, boolean contained) { try { if (reader == null) { reader = getSamReader(locator, true); } CloseableIterator<SAMRecord> iter = reader.query(sequence, start + 1, end, contained); return new WrappedIterator(iter); } catch (IOException e) { log.error("Error opening SAM reader", e); throw new RuntimeException("Error opening SAM reader", e); } } private SeekableStream getIndexStream(String indexPath) throws IOException { List<String> pathsTried = new ArrayList<String>(); pathsTried.add(indexPath); if (HttpUtils.getInstance().resourceAvailable(new URL(indexPath))) { return IGVSeekableStreamFactory.getInstance().getStreamFor(new URL(indexPath)); } else { if (indexPath.endsWith(".bam.bai")) { indexPath = indexPath.substring(0, indexPath.length() - 8) + ".bai"; pathsTried.add(indexPath); if (HttpUtils.getInstance().resourceAvailable(new URL(indexPath))) { log.info("Index found: " + indexPath); return IGVSeekableStreamFactory.getInstance().getStreamFor(new URL(indexPath)); } } else if (indexPath.endsWith(".bai")) { indexPath = indexPath.substring(0, indexPath.length() - 4) + ".bam.bai"; pathsTried.add(indexPath); if (HttpUtils.getInstance().resourceAvailable(new URL(indexPath))){ log.info("Index found: " + indexPath); return IGVSeekableStreamFactory.getInstance().getStreamFor(new URL(indexPath)); } } } String msg = "Index file not found. Tried "; for(String path : pathsTried) { msg += "<br>" + indexPath; } throw new DataLoadException(msg, indexPath); } }
package net.maizegenetics.prefs; import java.util.prefs.Preferences; /** * * @author terryc */ public class TasselPrefs { // Top level preferences public static final String TASSEL_TOP = "/tassel"; public static final String TASSEL_SAVE_DIR = "saveDir"; public static final String TASSEL_SAVE_DIR_DEFAULT = ""; public static final String TASSEL_OPEN_DIR = "openDir"; public static final String TASSEL_OPEN_DIR_DEFAULT = ""; public static final String TASSEL_FONT_METRICS_CHAR_WIDTH = "fontMetricsCharWidth"; public static final int TASSEL_FONT_METRICS_CHAR_WIDTH_DEFAULT = 9; public static final String TASSEL_IDENTIFIER_JOIN_STRICT = "idJoinStrict"; public static final boolean TASSEL_IDENTIFIER_JOIN_STRICT_DEFAULT = false; private static boolean TASSEL_IDENTIFIER_JOIN_STRICT_VALUE = getBooleanPref(TASSEL_TOP, TASSEL_IDENTIFIER_JOIN_STRICT, TASSEL_IDENTIFIER_JOIN_STRICT_DEFAULT); // FilterAlignmentPlugin preferences public static final String FILTER_ALIGN_PLUGIN_TOP = "/tassel/plugins/filterAlign"; // Min. frequency for filtering sites. public static final String FILTER_ALIGN_PLUGIN_MIN_FREQ = "minFreq"; public static final double FILTER_ALIGN_PLUGIN_MIN_FREQ_DEFAULT = 0.01; // Max. frequency for filtering sites. public static final String FILTER_ALIGN_PLUGIN_MAX_FREQ = "maxFreq"; public static final double FILTER_ALIGN_PLUGIN_MAX_FREQ_DEFAULT = 1.0; // Min. frequency for filtering sites. public static final String FILTER_ALIGN_PLUGIN_MIN_COUNT = "minCount"; public static final int FILTER_ALIGN_PLUGIN_MIN_COUNT_DEFAULT = 1; // Alignment preferences public static final String ALIGNMENT_TOP = "/tassel/alignment"; public static final String ALIGNMENT_MAX_ALLELES_TO_RETAIN = "maxAllelesToRetain"; public static final int ALIGNMENT_MAX_ALLELES_TO_RETAIN_DEFAULT = 2; public static final String ALIGNMENT_RETAIN_RARE_ALLELES = "retainRareAlleles"; public static final boolean ALIGNMENT_RETAIN_RARE_ALLELES_DEFAULT = true; /** * Creates a new instance of TasselPrefs */ private TasselPrefs() { } public static String getPref(String path, String key, String def) { Preferences node = Preferences.userRoot(); node = node.node(path); return node.get(key, def); } public static void putPref(String path, String key, String value) { Preferences node = Preferences.userRoot(); node = node.node(path); node.put(key, value); } public static double getDoublePref(String path, String key, double def) { Preferences node = Preferences.userRoot(); node = node.node(path); return node.getDouble(key, def); } public static void putDoublePref(String path, String key, double value) { Preferences node = Preferences.userRoot(); node = node.node(path); node.putDouble(key, value); } public static int getIntPref(String path, String key, int def) { Preferences node = Preferences.userRoot(); node = node.node(path); return node.getInt(key, def); } public static void putIntPref(String path, String key, int value) { Preferences node = Preferences.userRoot(); node = node.node(path); node.putInt(key, value); } public static boolean getBooleanPref(String path, String key, boolean def) { Preferences node = Preferences.userRoot(); node = node.node(path); return node.getBoolean(key, def); } public static void putBooleanPref(String path, String key, boolean value) { Preferences node = Preferences.userRoot(); node = node.node(path); node.putBoolean(key, value); } // Top level preferences public static String getSaveDir() { return getPref(TASSEL_TOP, TASSEL_SAVE_DIR, TASSEL_SAVE_DIR_DEFAULT); } public static void putSaveDir(String value) { putPref(TASSEL_TOP, TASSEL_SAVE_DIR, value); } public static String getOpenDir() { return getPref(TASSEL_TOP, TASSEL_OPEN_DIR, TASSEL_OPEN_DIR_DEFAULT); } public static void putOpenDir(String value) { putPref(TASSEL_TOP, TASSEL_OPEN_DIR, value); } public static int getFontMetricsCharWidth() { return getIntPref(TASSEL_TOP, TASSEL_FONT_METRICS_CHAR_WIDTH, TASSEL_FONT_METRICS_CHAR_WIDTH_DEFAULT); } public static void putFontMetricsCharWidth(int value) { putIntPref(TASSEL_TOP, TASSEL_FONT_METRICS_CHAR_WIDTH, value); } public static boolean getIDJoinStrict() { // This can be called many times, so to improve performance // this will return value without executing system call. return TASSEL_IDENTIFIER_JOIN_STRICT_VALUE; // return getBooleanPref(TASSEL_TOP, TASSEL_IDENTIFIER_JOIN_STRICT, TASSEL_IDENTIFIER_JOIN_STRICT_DEFAULT); } public static void putIDJoinStrict(boolean value) { TASSEL_IDENTIFIER_JOIN_STRICT_VALUE = value; putBooleanPref(TASSEL_TOP, TASSEL_IDENTIFIER_JOIN_STRICT, value); } // FilterAlignmentPlugin preferences public static double getFilterAlignPluginMinFreq() { return getDoublePref(FILTER_ALIGN_PLUGIN_TOP, FILTER_ALIGN_PLUGIN_MIN_FREQ, FILTER_ALIGN_PLUGIN_MIN_FREQ_DEFAULT); } public static void putFilterAlignPluginMinFreq(double value) { putDoublePref(FILTER_ALIGN_PLUGIN_TOP, FILTER_ALIGN_PLUGIN_MIN_FREQ, value); } public static double getFilterAlignPluginMaxFreq() { return getDoublePref(FILTER_ALIGN_PLUGIN_TOP, FILTER_ALIGN_PLUGIN_MAX_FREQ, FILTER_ALIGN_PLUGIN_MAX_FREQ_DEFAULT); } public static void putFilterAlignPluginMaxFreq(double value) { putDoublePref(FILTER_ALIGN_PLUGIN_TOP, FILTER_ALIGN_PLUGIN_MAX_FREQ, value); } public static int getFilterAlignPluginMinCount() { return getIntPref(FILTER_ALIGN_PLUGIN_TOP, FILTER_ALIGN_PLUGIN_MIN_COUNT, FILTER_ALIGN_PLUGIN_MIN_COUNT_DEFAULT); } public static void putFilterAlignPluginMinCount(int value) { putIntPref(FILTER_ALIGN_PLUGIN_TOP, FILTER_ALIGN_PLUGIN_MIN_COUNT, value); } // Alignment preferences public static int getAlignmentMaxAllelesToRetain() { return getIntPref(ALIGNMENT_TOP, ALIGNMENT_MAX_ALLELES_TO_RETAIN, ALIGNMENT_MAX_ALLELES_TO_RETAIN_DEFAULT); } public static void putAlignmentMaxAllelesToRetain(int value) { putIntPref(ALIGNMENT_TOP, ALIGNMENT_MAX_ALLELES_TO_RETAIN, value); } public static boolean getAlignmentRetainRareAlleles() { return getBooleanPref(ALIGNMENT_TOP, ALIGNMENT_RETAIN_RARE_ALLELES, ALIGNMENT_RETAIN_RARE_ALLELES_DEFAULT); } public static void putAlignmentRetainRareAlleles(boolean value) { putBooleanPref(ALIGNMENT_TOP, ALIGNMENT_RETAIN_RARE_ALLELES, value); } }
package org.drupal.project.computing; import java.util.logging.Logger; /** * Connect to Drupal through direct database access. It uses JDBC and Apache Commons DBUtils, so it's independent of * DBMS implementations. Currently we support MySQL and PostgreSQL. * * Due to security reasons, it is not recommended to use this class directly to access Drupal database unless necessary. * Typical reasons to use this class: 1) performance, 2) prototyping. Other than those 2 cases, you should consider * to use {computing_record} to pass data in/out of Drupal. * * This can be used as standalone class. */ public class DDatabase { protected Logger logger = DUtils.getInstance().getPackageLogger(); }
package nl.mpi.arbil.templates; import java.io.BufferedWriter; import java.io.File; import java.io.FileInputStream; import java.io.FileWriter; import java.io.IOException; import java.io.InputStream; import java.net.URI; import java.net.URISyntaxException; import java.util.ArrayList; import java.util.Collections; import java.util.Comparator; import java.util.Enumeration; import java.util.Vector; import nl.mpi.arbil.GuiHelper; import nl.mpi.arbil.LinorgSessionStorage; import nl.mpi.arbil.LinorgWindowManager; import nl.mpi.arbil.data.ImdiTreeObject; import org.apache.xmlbeans.SchemaProperty; import org.apache.xmlbeans.SchemaType; import org.apache.xmlbeans.SchemaTypeSystem; import org.apache.xmlbeans.XmlBeans; import org.apache.xmlbeans.XmlException; import org.apache.xmlbeans.XmlObject; import org.apache.xmlbeans.XmlOptions; public class CmdiTemplate extends ArbilTemplate { public void loadTemplate(String nameSpaceString) { // testing only //super.readTemplate(new File(""), "template_cmdi"); // construct the template from the XSD try { // create a temp file of the read template data so that it can be compared to a hand made version File debugTempFile = File.createTempFile("templatetext", ".tmp"); debugTempFile.deleteOnExit(); BufferedWriter debugTemplateFileWriter = new BufferedWriter(new FileWriter(debugTempFile)); ArrayList<String[]> childNodePathsList = new ArrayList<String[]>(); URI xsdUri = new URI(nameSpaceString); readSchema(xsdUri, childNodePathsList); childNodePaths = childNodePathsList.toArray(new String[][]{}); for (String[] currentArray : childNodePaths) { System.out.println("loadTemplate: " + currentArray[1] + ":" + currentArray[0]); debugTemplateFileWriter.write("<ChildNodePath ChildPath=\"" + currentArray[0] + "\" SubNodeName=\"" + currentArray[1] + "\" />\r\n"); } debugTemplateFileWriter.close(); // lanunch the hand made template and the generated template for viewing // LinorgWindowManager.getSingleInstance().openUrlWindowOnce("templatetext", debugTempFile.toURL()); // LinorgWindowManager.getSingleInstance().openUrlWindowOnce("templatejar", CmdiTemplate.class.getResource("/nl/mpi/arbil/resources/templates/template_cmdi.xml")); // LinorgWindowManager.getSingleInstance().openUrlWindowOnce("templatejar", CmdiTemplate.class.getResource("/nl/mpi/arbil/resources/templates/template.xml")); } catch (URISyntaxException urise) { GuiHelper.linorgBugCatcher.logError(urise); } catch (IOException urise) { GuiHelper.linorgBugCatcher.logError(urise); } // this should be adequate for cmdi templates //templatesArray = childNodePaths; // TODO: complete these requiredFields = new String[]{}; fieldConstraints = new String[][]{}; preferredNameFields = new String[]{}; fieldUsageArray = new String[][]{}; fieldTriggersArray = new String[][]{}; autoFieldsArray = new String[][]{}; } @Override public Enumeration listTypesFor(Object targetNodeUserObject) { // get the xpath of the target node String targetNodeXpath = ((ImdiTreeObject) targetNodeUserObject).getURI().getFragment(); System.out.println("targetNodeXpath: " + targetNodeXpath); if (targetNodeXpath != null) { targetNodeXpath = targetNodeXpath.replaceAll("\\(\\d+\\)", ""); } System.out.println("targetNodeXpath: " + targetNodeXpath); Vector<String[]> childTypes = new Vector<String[]>(); if (targetNodeUserObject instanceof ImdiTreeObject) { for (String[] childPathString : childNodePaths) { boolean allowEntry = false; if (targetNodeXpath == null) { System.out.println("allowing: " + childPathString[0]); allowEntry = true; } else if (childPathString[0].startsWith(targetNodeXpath)) { System.out.println("allowing: " + childPathString[0]); allowEntry = true; } if (targetNodeXpath != null && childPathString[0].length() == targetNodeXpath.length()) { System.out.println("disallowing: " + childPathString[0]); allowEntry = false; } // remove types that require a container type that has not already been added to the target for (String[] childPathTest : childNodePaths) { // only if the test path is valid if (targetNodeXpath == null || childPathTest[0].startsWith(targetNodeXpath)) { if (childPathString[0].startsWith(childPathTest[0])) { if (childPathTest[0].length() < childPathString[0].length()) { System.out.println("removing: " + childPathString[0]); System.out.println("based on: " + childPathTest[0]); allowEntry = false; } } } } // TODO: check that the sub node addables are being correctly listed in the context menu // System.out.println("childPathString[0]: " + childPathString[0]); // System.out.println("childPathString[1]: " + childPathString[1]); if (allowEntry) { childTypes.add(new String[]{childPathString[1], childPathString[0]}); } } Collections.sort(childTypes, new Comparator() { public int compare(Object o1, Object o2) { String value1 = ((String[]) o1)[0]; String value2 = ((String[]) o2)[0]; return value1.compareTo(value2); } }); } return childTypes.elements(); } private void readSchema(URI xsdFile, ArrayList<String[]> childNodePathsList) { File schemaFile = LinorgSessionStorage.getSingleInstance().updateCache(xsdFile.toString(), 5); templateFile = schemaFile; // store the template file for later use such as adding child nodes try { InputStream inputStream = new FileInputStream(schemaFile); //Since we're dealing with xml schema files here the character encoding is assumed to be UTF-8 XmlOptions options = new XmlOptions(); options.setCharacterEncoding("UTF-8"); SchemaTypeSystem sts = XmlBeans.compileXsd(new XmlObject[]{XmlObject.Factory.parse(inputStream, options)}, XmlBeans.getBuiltinTypeSystem(), null); for (SchemaType schemaType : sts.documentTypes()) { System.out.println("T-documentTypes:"); constructXml(schemaType, childNodePathsList, ""); break; // there can only be a single root node and the IMDI schema specifies two (METATRANSCRIPT and VocabularyDef) so we must stop before that error creates another } } catch (IOException e) { GuiHelper.linorgBugCatcher.logError(e); } catch (XmlException e) { GuiHelper.linorgBugCatcher.logError(e); } } private void constructXml(SchemaType schemaType, ArrayList<String[]> childNodePathsList, String pathString) { for (SchemaProperty schemaProperty : schemaType.getElementProperties()) { String localName = schemaProperty.getName().getLocalPart(); String currentPathString = pathString + "." + localName; boolean canHaveMultiple = true; if (schemaProperty.getMaxOccurs() == null) { // absence of the max occurs also means multiple canHaveMultiple = true; // todo: also check that min and max are the same because there may be cases of zero required but only one can be added } else if (schemaProperty.getMaxOccurs().toString().equals("unbounded")) { canHaveMultiple = true; } else { // todo: take into account max occurs in the add menu canHaveMultiple = schemaProperty.getMaxOccurs().intValue() > 1; } boolean hasSubNodes = false; System.out.println("Found template element: " + currentPathString); SchemaType currentSchemaType = schemaProperty.getType(); constructXml(currentSchemaType, childNodePathsList, currentPathString); hasSubNodes = true; // todo: complete or remove this hasSubNodes case if (canHaveMultiple && hasSubNodes) { childNodePathsList.add(new String[]{currentPathString, localName}); } } } }
package org.exist.security.xacml; import com.sun.xacml.attr.AnyURIAttribute; import com.sun.xacml.attr.AttributeValue; import com.sun.xacml.attr.StringAttribute; import com.sun.xacml.ctx.Attribute; import com.sun.xacml.ctx.RequestCtx; import com.sun.xacml.ctx.Subject; import java.net.URI; import java.net.URISyntaxException; import java.util.Collections; import java.util.HashSet; import java.util.Set; import org.exist.dom.QName; import org.exist.security.User; import org.exist.xquery.ExternalModule; import org.exist.xquery.Module; import org.exist.xquery.XQueryContext; /* * Source.getKey().toString() needs to be unique: * potential collision between FileSource and DBSource ?? */ /** * This class provides methods for creating an XACML request. The main methods * are those that return a <code>RequestCtx</code>. Links are provided to the * relevant constants in <code>XACMLConstants</code> to facilitate policy * writing. * * @see XACMLConstants */ public class RequestHelper { public RequestCtx createQueryRequest(XQueryContext context, XACMLSource source) { Set subjects = createQuerySubjects(context.getUser(), null); Set resourceAttributes = createQueryResource(source); Set actionAttributes = createBasicAction(XACMLConstants.EXECUTE_QUERY_ACTION); Set environmentAttributes = createEnvironment(context.getAccessContext()); return new RequestCtx(subjects, resourceAttributes, actionAttributes, environmentAttributes); } /** * Creates a <code>RequestCtx</code> for a request concerning reflective * access to Java code from an XQuery. This handles occurs when a method * is being invoked on the class in question. This method creates a * request with the following content: * <ul> * * <li>Subjects for the contextModule and user are created with the * createQuerySubjects method.</li> * * <li>Resource attributes are created with the * <code>createReflectionResource</code> method.</li> * * <li>Action attributes are created with the * <code>createBasicAction</code> method. The action-id is * {@link XACMLConstants#INVOKE_METHOD_ACTION invoke method}.</li> * * <li>The {@link XACMLConstants#ACCESS_CONTEXT_ATTRIBUTE} access context * attribute is generated for the environment section.</li> * * </ul> * * @param context The <code>XQueryContext</code> for the module making the * request. * @param contextModule The query containing the reflection. * @param className The name of the class that is being accessed or loaded. * @param methodName The name of the method that is being invoked * @return A <code>RequestCtx</code> that represents the access in question. */ public RequestCtx createReflectionRequest(XQueryContext context, Module contextModule, String className, String methodName) { User user = context.getUser(); Set subjects = createQuerySubjects(user, contextModule); Set resourceAttributes = createReflectionResource(className, methodName); Set actionAttributes = createBasicAction(XACMLConstants.INVOKE_METHOD_ACTION); Set environmentAttributes = createEnvironment(context.getAccessContext()); return new RequestCtx(subjects, resourceAttributes, actionAttributes, environmentAttributes); } /** * Creates a <code>RequestCtx</code> for a request concerning access * to a function in an XQuery library module. If the function is * from a main module, this method returns null to indicate that. * The client should interpret this to mean that the request is * granted because access to a main module implies access to its * functions. * * <p> * This method creates a request with the following content: * <ul> * * <li>Subjects for the contextModule and user (obtained from the * XQueryContext) are created with the createQuerySubjects method.</li> * * <li>The specified functionModule parameter is used to generate the * {@link XACMLConstants#SOURCE_KEY_ATTRIBUTE source-key}, * {@link XACMLConstants#SOURCE_TYPE_ATTRIBUTE source-type}, and * {@link XACMLConstants#MODULE_CATEGORY_ATTRIBUTE module category} * attributes. The functionName parameter is the value of the * {@link XACMLConstants#RESOURCE_ID_ATTRIBUTE subject-id} attribute * (the local part) and of the * {@link XACMLConstants#MODULE_NS_ATTRIBUTE module namespace} * attribute (the namespace URI part). The * {@link XACMLConstants#RESOURCE_CATEGORY_ATTRIBUTE resource-category} * attribute is {@link XACMLConstants#FUNCTION_RESOURCE function}. * * <li>Action attributes are created with the * <code>createBasicAction</code> method. The action is * {@link XACMLConstants#CALL_FUNCTION_ACTION call function}. * * <li>The {@link XACMLConstants#ACCESS_CONTEXT_ATTRIBUTE} access context * attribute is generated for the environment section.</li> * * </ul> * * @param context The query context. * @param contextModule The query making the access. * @param functionName The <code>QName</code> of the function being called. * @return A <code>RequestCtx</code> that represents the access in question * or <code>null</code> if the function belongs to a main module and * not a library module. */ public RequestCtx createFunctionRequest(XQueryContext context, Module contextModule, QName functionName) { String namespaceURI = functionName.getNamespaceURI(); Module functionModule = context.getModule(namespaceURI); if(functionModule == null) { //main module, not a library module, so access to function is always allowed return null; } User user = context.getUser(); Set subjects = createQuerySubjects(user, contextModule); Set resourceAttributes = new HashSet(8); addStringAttribute(resourceAttributes, XACMLConstants.MODULE_CATEGORY_ATTRIBUTE, getModuleCategory(functionModule)); XACMLSource moduleSrc = generateModuleSource(functionModule); addSourceAttributes(resourceAttributes, moduleSrc); addValidURIAttribute(resourceAttributes, XACMLConstants.MODULE_NS_ATTRIBUTE, namespaceURI); addStringAttribute(resourceAttributes, XACMLConstants.RESOURCE_CATEGORY_ATTRIBUTE, XACMLConstants.FUNCTION_RESOURCE); addStringAttribute(resourceAttributes, XACMLConstants.RESOURCE_ID_ATTRIBUTE, functionName.getLocalName()); Set actionAttributes = createBasicAction(XACMLConstants.CALL_FUNCTION_ACTION); Set environmentAttributes = createEnvironment(context.getAccessContext()); return new RequestCtx(subjects, resourceAttributes, actionAttributes, environmentAttributes); } /** * Creates a <code>Subject</code> for a <code>User</code>. * The user's name is the value of the * {@link XACMLConstants#SUBJECT_ID_ATTRIBUTE subject-id} attribute. The * subject-category is {@link XACMLConstants#ACCESS_SUBJECT access-subject}. * The {@link XACMLConstants#GROUP_ATTRIBUTE group} attribute is a bag * containing the name of each group of which the user is a member. * * @param user The user making the request * @return A <code>Subject</code> for use in a <code>RequestCtx</code> */ public Subject createUserSubject(User user) { AttributeValue value = new StringAttribute(user.getName()); Attribute attr = new Attribute(XACMLConstants.SUBJECT_ID_ATTRIBUTE, null, null, value); return new Subject(XACMLConstants.ACCESS_SUBJECT, Collections.singleton(attr)); } /** * Creates the basic attributes needed to describe a simple action * in a request. The <code>action</code> parameter is the value of * the {@link XACMLConstants#ACTION_ID_ATTRIBUTE action-id} attribute and the * {@link XACMLConstants#ACTION_NS_ATTRIBUTE namespace} attribute for the * action-id is eXist's XACML * {@link XACMLConstants#ACTION_NS action namespace}. * * @param action The {@link XACMLConstants#ACTION_ID_ATTRIBUTE action-id} * of the action. * @return A <code>Set</code> that contains attributes describing the * action for use in a <code>RequestCtx</code> */ public Set createBasicAction(String action) { if(action == null) return null; Set attributes = new HashSet(4); addStringAttribute(attributes, XACMLConstants.ACTION_ID_ATTRIBUTE, action); addValidURIAttribute(attributes, XACMLConstants.ACTION_NS_ATTRIBUTE, XACMLConstants.ACTION_NS); return attributes; } /** * Creates a <code>Subject</code> for a <code>Module</code>. * If the module is external, its <code>Source</code> is the value of the * {@link XACMLConstants#SUBJECT_ID_ATTRIBUTE subject-id} attribute, otherwise, * the name of the implementing class is used. The subject-category is * {@link XACMLConstants#CODEBASE_SUBJECT codebase}. The value of the * {@link XACMLConstants#SUBJECT_NS_ATTRIBUTE module namespace} attribute * is the namespace URI of the module. The * {@link XACMLConstants#MODULE_CATEGORY_ATTRIBUTE module category} * attribute is the type of module, either * {@link XACMLConstants#INTERNAL_LIBRARY_MODULE internal} or * {@link XACMLConstants#EXTERNAL_LIBRARY_MODULE external}. * * @param module A query module involved in making the request * @return A <code>Subject</code> for use in a <code>RequestCtx</code> */ public Subject createModuleSubject(Module module) { if(module == null) return null; Set attributes = new HashSet(8); addValidURIAttribute(attributes, XACMLConstants.SUBJECT_NS_ATTRIBUTE, module.getNamespaceURI()); addStringAttribute(attributes, XACMLConstants.MODULE_CATEGORY_ATTRIBUTE, getModuleCategory(module)); XACMLSource moduleSrc = generateModuleSource(module); addSourceAttributes(attributes, moduleSrc); addStringAttribute(attributes, XACMLConstants.SUBJECT_ID_ATTRIBUTE, moduleSrc.createId()); return new Subject(XACMLConstants.CODEBASE_SUBJECT, attributes); } /** * Creates a <code>Set</code> of <code>Attribute</code>s for a resource * representing Java reflection in an XQuery. * The {@link XACMLConstants#RESOURCE_CATEGORY_ATTRIBUTE resource-category} * attribute is {@link XACMLConstants#METHOD_RESOURCE method}. * The {@link XACMLConstants#SOURCE_TYPE_ATTRIBUTE source-type} attribute is * {@link XACMLConstants#CLASS_SOURCE_TYPE class} and the * {@link XACMLConstants#SOURCE_KEY_ATTRIBUTE source-key} attribute is the * name of the class. The * {@link XACMLConstants#RESOURCE_ID_ATTRIBUTE resource-id} attribute is the * method name. * * @param className The name of the Java class * @param methodName The name of the method being invoked * @return A <code>Set</code> containing the <code>Attribute</code>s * describing access to Java code by reflection. */ public Set createReflectionResource(String className, String methodName) { if(className == null) throw new NullPointerException("Class name cannot be null"); if(methodName == null) throw new NullPointerException("Method name cannot be null"); Set resourceAttributes = new HashSet(8); addStringAttribute(resourceAttributes, XACMLConstants.RESOURCE_CATEGORY_ATTRIBUTE, XACMLConstants.METHOD_RESOURCE); XACMLSource source = XACMLSource.getInstance(className); addSourceAttributes(resourceAttributes, source); addStringAttribute(resourceAttributes, XACMLConstants.RESOURCE_ID_ATTRIBUTE, methodName); return resourceAttributes; } /** * Creates the Resource section of a request for a main module. * * @param source The source of the query. * @return A <code>Set</code> containing attributes for the specified * query. */ public Set createQueryResource(XACMLSource source) { if(source == null) throw new NullPointerException("Query source cannot be null"); Set resourceAttributes = new HashSet(4); addSourceAttributes(resourceAttributes, source); addStringAttribute(resourceAttributes, XACMLConstants.RESOURCE_ID_ATTRIBUTE, source.createId()); addStringAttribute(resourceAttributes, XACMLConstants.RESOURCE_CATEGORY_ATTRIBUTE, XACMLConstants.MAIN_MODULE_RESOURCE); return resourceAttributes; } public Set createQuerySubjects(User user, Module contextModule) { if(user == null) throw new NullPointerException("User cannot be null"); Set subjects = new HashSet(4); Subject userSubject = createUserSubject(user); subjects.add(userSubject); if(contextModule != null) { Subject moduleSubject = createModuleSubject(contextModule); subjects.add(moduleSubject); } return subjects; } /** * Creates the environment section of a request for the given * <code>AccessContext</code>. * * @param accessCtx The context * @return A <code>Set</code> containing one attribute, the * {@link XACMLConstants#ACCESS_CONTEXT_ATTRIBUTE access context} * attribute with the value of the specified access context. */ public Set createEnvironment(AccessContext accessCtx) { if(accessCtx == null) throw new NullAccessContextException(); Set environment = new HashSet(4); addStringAttribute(environment, XACMLConstants.ACCESS_CONTEXT_ATTRIBUTE, accessCtx.toString()); return environment; } /** * Generates an <code>XACMLSource</code> for a <code>Module</code> * based on its implementing class name (if it is an * <code>InternalModule</code>) or its <code>Source</code> * (if it is an <code>ExternalModule</code>). * * @param module the module for which the source should be generated * @return an <code>XACMLSource</code> that uniquely defines the source * of the given module */ public static XACMLSource generateModuleSource(Module module) { if(module == null) throw new NullPointerException("Module cannot be null"); if(module.isInternalModule()) return XACMLSource.getInstance(module.getClass()); return XACMLSource.getInstance(((ExternalModule)module).getSource()); } /** * Returns the module type for the given XQuery library module. This * is either * {@link XACMLConstants#INTERNAL_LIBRARY_MODULE internal} or * {@link XACMLConstants#EXTERNAL_LIBRARY_MODULE external} * * @param module The XQuery library module. If it is null, this method * returns null. * @return null if module is null, the module's category (internal or external) * otherwise */ public static String getModuleCategory(Module module) { if(module == null) return null; return module.isInternalModule() ? XACMLConstants.INTERNAL_LIBRARY_MODULE : XACMLConstants.EXTERNAL_LIBRARY_MODULE; } /** * Adds new attributes to the specified <code>Set</code> of attributes * that represent the specified source. The added attributes are the * {@link XACMLConstants#SOURCE_KEY_ATTRIBUTE source's key} and the * {@link XACMLConstants#SOURCE_TYPE_ATTRIBUTE source's type}. * * @param attributes The <code>Set</code> to which attributes will be * added. If null, this method does nothing. * @param source The source for which attributes will be added. It * cannot be null. */ public static void addSourceAttributes(Set attributes, XACMLSource source) { if(source == null) throw new NullPointerException("Source cannot be null"); addStringAttribute(attributes, XACMLConstants.SOURCE_KEY_ATTRIBUTE, source.getKey()); addStringAttribute(attributes, XACMLConstants.SOURCE_TYPE_ATTRIBUTE, source.getType()); } /** * Adds a new attribute of type string to the specified * <code>Set</code> of attributes. The new attribute's value is * constructed from the attrValue parameter and is given the id * of the attrID parameter. * * @param attributes The <code>Set</code> to which the new attribute * should be added. If it is null, this method does nothing. * @param attrID The ID of the new attribute, cannot be null * @param attrValue The value of the new attribute. It cannot be null. */ public static void addStringAttribute(Set attributes, URI attrID, String attrValue) { if(attributes == null) return; if(attrID == null) throw new NullPointerException("Attribute ID cannot be null"); if(attrValue == null) throw new NullPointerException("Attribute value cannot be null"); AttributeValue value = new StringAttribute(attrValue); Attribute attr = new Attribute(attrID, null, null, value); attributes.add(attr); } /** * Adds a new attribute of type anyURI to the specified * <code>Set</code> of attributes. The new attribute's value is * constructed from the uriString parameter and is given the id * of the attrID parameter. * * @param attributes The <code>Set</code> to which the new attribute * should be added. If it is null, this method does nothing. * @param attrID The ID of the new attribute, cannot be null * @param uriString The value of the new attribute. It must parse into a * valid URI and cannot be null. * @throws URISyntaxException if the specified attribute value is not a * valid URI. */ public static void addURIAttribute(Set attributes, URI attrID, String uriString) throws URISyntaxException { if(attributes == null) return; if(attrID == null) throw new NullPointerException("Attribute ID cannot be null"); if(uriString == null) throw new NullPointerException("Attribute value cannot be null"); URI uri = new URI(uriString); AttributeValue value = new AnyURIAttribute(uri); Attribute attr = new Attribute(attrID, null, null, value); attributes.add(attr); } //wrapper for when the URI is known to be valid, such as when obtained from a source //that validates the URI or from a constant private static void addValidURIAttribute(Set attributes, URI attrID, String uriString) { try { addURIAttribute(attributes, attrID, uriString); } catch(URISyntaxException e) { throw new RuntimeException("URI should never be invalid", e); } } RequestHelper() {} }
package org.jpos.ee; import java.util.Date; import java.util.List; import org.hibernate.Criteria; import org.hibernate.HibernateException; import org.hibernate.criterion.Order; import org.hibernate.criterion.Restrictions; @SuppressWarnings("unused") public class RevisionManager { DB db; public RevisionManager (DB db) { this.db = db; } @SuppressWarnings("unchecked") public List<Revision> getRevisionsByRef (String ref) throws HibernateException { Criteria crit = db.session().createCriteria (Revision.class) .add (Restrictions.eq ("ref", ref)) .addOrder (Order.desc("id")); return (List<Revision>) crit.list(); } @SuppressWarnings("unchecked") public List<Revision> getRevisionsByAuthor (User author) throws HibernateException { Criteria crit = db.session().createCriteria (Revision.class) .add (Restrictions.eq ("author", author)) .addOrder (Order.desc("id")); return (List<Revision>) crit.list(); } /** * factory method used to create a Revision associated with this user. * * @param author the revision author * @param ref associated with this revision * @param info information * @return a revision entry */ public Revision createRevision (User author, String ref, String info) { Revision re = new Revision(); re.setDate (new Date()); re.setInfo (info); re.setRef (ref); re.setAuthor (author); db.save (re); return re; } }
package org.exist.xquery; import org.exist.dom.DocumentSet; import org.exist.xquery.util.ExpressionDumper; import org.exist.xquery.value.Item; import org.exist.xquery.value.Sequence; import org.exist.xquery.value.Type; /** * XQuery if ... then ... else expression. * * @author wolf */ public class ConditionalExpression extends AbstractExpression implements RewritableExpression { private Expression testExpr; private Expression thenExpr; private Expression elseExpr; public ConditionalExpression(XQueryContext context, Expression testExpr, Expression thenExpr, Expression elseExpr) { super(context); this.testExpr = testExpr.simplify(); this.thenExpr = thenExpr.simplify(); this.elseExpr = elseExpr.simplify(); } /* (non-Javadoc) * @see org.exist.xquery.AbstractExpression#getDependencies() */ public int getDependencies() { return Dependency.CONTEXT_SET | Dependency.CONTEXT_ITEM; } public Expression getTestExpr() { return testExpr; } public Expression getThenExpr() { return thenExpr; } public Expression getElseExpr() { return elseExpr; } /* (non-Javadoc) * @see org.exist.xquery.AbstractExpression#getCardinality() */ public int getCardinality() { return thenExpr.getCardinality() | elseExpr.getCardinality(); } /* (non-Javadoc) * @see org.exist.xquery.Expression#analyze(org.exist.xquery.Expression) */ public void analyze(AnalyzeContextInfo contextInfo) throws XPathException { AnalyzeContextInfo myContextInfo = new AnalyzeContextInfo(contextInfo); myContextInfo.setFlags(myContextInfo.getFlags() & (~IN_PREDICATE)); myContextInfo.setParent(this); testExpr.analyze(myContextInfo); myContextInfo.setParent(this); thenExpr.analyze(myContextInfo); myContextInfo.setParent(this); elseExpr.analyze(myContextInfo); } /* (non-Javadoc) * @see org.exist.xquery.Expression#eval(org.exist.dom.DocumentSet, * org.exist.xquery.value.Sequence, org.exist.xquery.value.Item) */ public Sequence eval(Sequence contextSequence, Item contextItem) throws XPathException { context.expressionStart(this); final Sequence testSeq = testExpr.eval(contextSequence, contextItem); try { if (testSeq.effectiveBooleanValue()) { return thenExpr.eval(contextSequence, contextItem); } else { return elseExpr.eval(contextSequence, contextItem); } } catch (final XPathException e) { if (e.getLine() == 0) {e.setLocation(line, column);} throw e; } finally { context.expressionEnd(this); } } /* (non-Javadoc) * @see org.exist.xquery.Expression#preselect(org.exist.dom.DocumentSet) */ public DocumentSet preselect(DocumentSet in_docs) throws XPathException { return in_docs; } /* (non-Javadoc) * @see org.exist.xquery.Expression#dump(org.exist.xquery.util.ExpressionDumper) */ public void dump(ExpressionDumper dumper) { dumper.display("if ("); dumper.startIndent(); testExpr.dump(dumper); dumper.endIndent(); dumper.nl().display(") then"); dumper.startIndent(); thenExpr.dump(dumper); dumper.endIndent(); dumper.nl().display("else"); dumper.startIndent(); elseExpr.dump(dumper); dumper.endIndent(); } public String toString() { final StringBuilder result = new StringBuilder(); result.append("if ( "); result.append(testExpr.toString()); result.append(" ) then "); result.append(thenExpr.toString()); result.append(" else "); result.append(elseExpr.toString()); return result.toString(); } /* (non-Javadoc) * @see org.exist.xquery.Expression#returnsType() */ public int returnsType() { return Type.getCommonSuperType(thenExpr.returnsType(), elseExpr.returnsType()); } /* (non-Javadoc) * @see org.exist.xquery.AbstractExpression#resetState() */ public void resetState(boolean postOptimization) { super.resetState(postOptimization); testExpr.resetState(postOptimization); thenExpr.resetState(postOptimization); elseExpr.resetState(postOptimization); } public void accept(ExpressionVisitor visitor) { visitor.visitConditional(this); } /* RewritableExpression API */ @Override public void replace(Expression oldExpr, Expression newExpr) { if (testExpr == oldExpr) {testExpr = newExpr;} else if (thenExpr == oldExpr) {thenExpr = newExpr;} else if (elseExpr == oldExpr) {elseExpr = newExpr;} } @Override public Expression getPrevious(Expression current) { return null; } @Override public Expression getFirst() { return null; } @Override public void remove(Expression oldExpr) throws XPathException { //Nothing to do } /* END RewritableExpression API */ }
package org.esupportail.smsu.web; import java.io.File; import java.io.IOException; import java.util.LinkedList; import java.util.List; import java.util.Map; import java.util.Map.Entry; import java.util.TreeMap; import java.util.regex.MatchResult; import java.util.regex.Matcher; import java.util.regex.Pattern; import javax.inject.Inject; import org.apache.commons.lang.StringUtils; import org.codehaus.jackson.map.ObjectMapper; import org.esupportail.smsu.utils.AggregateToFile; import org.esupportail.smsu.utils.CachedDigest; public class ServerSideDirectives { private String scriptStart = "(<script [^>]*)"; private String scriptEnd = "([^>]*> *</script>)"; private String linkStart = "(<link [^>]*)"; private String linkEnd = "([^>]*>)"; private String stringValue = "\"([^\"]*)\""; private String srcStringValue = "([^>]*src)=" + stringValue; private String hrefStringValue = "([^>]*href)=" + stringValue; @Inject private CachedDigest cachedDigest; @Inject private AggregateToFile aggregateToFile; public String instantiate(String template, Map<String,Object> env, ServletContextWrapper context) { template = instantiate_vars(template, env); // first remove what is unneeded template = instantiate_serverSideIf(template, env); // generate angular templates js template = instantiate_serverSideAngularTemplates(template, env, context); template = instantiate_serverSideConcat(template, context); // must be done after Concat in case both are used template = instantiate_serverSideCacheBuster(template, context); // must be done after CacheBuster template = instantiate_serverSidePrefix(template, env); return template; } public String instantiate_vars(String template, final Map<String,Object> env) { String regex = Pattern.quote("{{serverSide.") + "([^}]+)" + Pattern.quote("}}"); return ReplaceAllWithCallback.doIt(template, regex, new ReplaceAllWithCallback.Callback() { public String replace(MatchResult m) { return (String) env.get(m.group(1)); } }); } private String instantiate_serverSideCacheBuster(String template, ServletContextWrapper context) { String ssp_src_regex = "\\bserver-side-cache-buster\\s+" + srcStringValue; String ssp_href_regex = "\\bserver-side-cache-buster\\s+" + hrefStringValue; template = instantiate_serverSideCacheBuster(template, scriptStart + ssp_src_regex + scriptEnd, context); template = instantiate_serverSideCacheBuster(template, linkStart + ssp_href_regex + linkEnd, context); if (template.matches("server-side-cache-buster")) throw new RuntimeException("syntax error for server-side-cache-buster in " + template); return template; } private String instantiate_serverSidePrefix(String template, Map<String,Object> env) { String ssp_src_regex = "\\bserver-side-prefix=" + stringValue + "\\s+" + srcStringValue; String ssp_href_regex = "\\bserver-side-prefix=" + stringValue + "\\s+" + hrefStringValue; template = instantiate_serverSidePrefix(template, scriptStart + ssp_src_regex + scriptEnd, env); template = instantiate_serverSidePrefix(template, linkStart + ssp_href_regex + linkEnd, env); if (template.matches("server-side-prefix")) throw new RuntimeException("syntax error for server-side-prefix in " + template); return template; } private String instantiate_serverSideConcat(String template, final ServletContextWrapper context) { String ssp_src_regex = "\\bserver-side-concat=" + stringValue + "\\s+" + srcStringValue; String ssp_href_regex = "\\bserver-side-concat=" + stringValue + "\\s+" + hrefStringValue; template = instantiate_serverSideConcat(template, scriptStart + ssp_src_regex + scriptEnd, context); template = instantiate_serverSideConcat(template, linkStart + ssp_href_regex + linkEnd, context); if (template.matches("server-side-concat")) throw new RuntimeException("syntax error for server-side-concat in " + template); return template; } private String instantiate_serverSideAngularTemplates(String template, Map<String, Object> env, final ServletContextWrapper context) { String ssp_src_regex = "\\bserver-side-angular-templates=" + stringValue + "\\s+" + srcStringValue; template = instantiate_serverSideAngularTemplates(template, scriptStart + ssp_src_regex + scriptEnd, env, context); if (template.matches("server-side-angular-templates")) throw new RuntimeException("syntax error for server-side-concat in " + template); return template; } private String instantiate_serverSideIf(String template, Map<String, Object> env) { String ssp_regex = "\\bserver-side-if=" + stringValue + "\\s*"; template = instantiate_serverSideIf(template, scriptStart + ssp_regex + scriptEnd, env); template = instantiate_serverSideIf(template, linkStart + ssp_regex + linkEnd, env); if (template.matches("server-side-if")) throw new RuntimeException("syntax error for server-side-if in " + template); return template; } private String instantiate_serverSideCacheBuster(String template, String regex, final ServletContextWrapper context) { return ReplaceAllWithCallback.doIt(template, regex, new ReplaceAllWithCallback.Callback() { public String replace(MatchResult m) { String openTag = m.group(1), srcAttr = m.group(2), srcVal = m.group(3), endTag = m.group(4); File src = src2file(context, srcVal); String digest = cachedDigest.compute(src); digest = digest.substring(0, 8); // not too long, otherwise it's really ugly and non necessary return openTag + srcAttr + "=\"" + srcVal + "?d=" + digest + "\"" + endTag; } }); } private String instantiate_serverSidePrefix(String template, String regex, final Map<String,Object> env) { return ReplaceAllWithCallback.doIt(template, regex, new ReplaceAllWithCallback.Callback() { public String replace(MatchResult m) { String openTag = m.group(1), prefixVar = m.group(2), srcAttr = m.group(3), srcVal = m.group(4), endTag = m.group(5); String prefix = (String) env.get(prefixVar); if (prefix == null) throw new RuntimeException("invalid server-side-prefix " + prefixVar); return openTag + srcAttr + "=\"" + prefix + "/" + srcVal + "\"" + endTag; } }); } private String instantiate_serverSideConcat(String template, String regex, final ServletContextWrapper context) { final Map<String,List<File>> destination2sources = new TreeMap<String, List<File>>(); String result = ReplaceAllWithCallback.doIt(template, regex, new ReplaceAllWithCallback.Callback() { public String replace(MatchResult m) { String openTag = m.group(1), dest = m.group(2), srcAttr = m.group(3), srcVal = m.group(4), endTag = m.group(5); List<File> sources = destination2sources.get(dest); boolean isFirst = sources == null; if (isFirst) { sources = new LinkedList<File>(); destination2sources.put(dest, sources); } sources.add(src2file(context, srcVal)); if (isFirst) { return openTag + srcAttr + "=\"" + dest + "\"" + endTag; } else { return ""; // keep only the first, remove the others } } }); try { for (Entry<String,List<File>> e : destination2sources.entrySet()) { aggregateToFile.concat(e.getValue(), src2file(context, e.getKey())); } } catch (IOException e) { // failed to write concat, return input template unmodified return template; } return result; } private String instantiate_serverSideAngularTemplates(String template, String regex, final Map<String, Object> env, final ServletContextWrapper context) { return ReplaceAllWithCallback.doIt(template, regex, new ReplaceAllWithCallback.Callback() { public String replace(MatchResult m) { String openTag = m.group(1), templates = m.group(2), srcAttr = m.group(3), dest = m.group(4), closeTag = m.group(5); String urlPrefix = getServerSidePrefix(m.group(), env); final Map<File,String> htmlFileToURL = new TreeMap<File, String>(); for (String relative : templates.split("\\s+")) { htmlFileToURL.put(src2file(context, relative), urlPrefix + "/" + relative); } try { aggregateToFile.concat(htmlFileToURL.keySet(), src2file(context, dest), "", "", new AggregateToFile.Filter() { public String filter(File file, String html) { try { String url = htmlFileToURL.get(file); return prepareForClientSideInclude(prepareAngularTemplate(html, url)); } catch (IOException e) { throw new RuntimeException(e); } } }); return openTag + srcAttr + "=\"" + dest + "\"" + closeTag; } catch (IOException e) { return ""; } } }); } private String instantiate_serverSideIf(String template, String regex, final Map<String,Object> env) { String result = ReplaceAllWithCallback.doIt(template, regex, new ReplaceAllWithCallback.Callback() { public String replace(MatchResult m) { String openTag = m.group(1), varName = m.group(2), endTag = m.group(3); Object val = env.get(varName); if (val == null) throw new RuntimeException("invalid server-side-if " + varName); return isFalse(val) ? "" : openTag + endTag; } }); return result; } // similar to perl/python falseness private boolean isFalse(Object val) { if (val == null) return true; if (val instanceof Boolean) return !(Boolean) val; if (val instanceof String) return StringUtils.isBlank((String) val); if (val instanceof Number) return ((Number) val).doubleValue() == 0; return false; } private File src2file(final ServletContextWrapper context, String src) { File baseURL = new File(context.getRealPath("/")); return new File(baseURL, src); } private String prepareAngularTemplate(String html, String url) { return "<script type=\"text/ng-template\" id=\"" + url + "\">\n" + html + "\n</script>\n\n"; } private String prepareForClientSideInclude(String script) throws IOException { return "document.write(" + new ObjectMapper().writeValueAsString(script) + ");\n"; } private String getServerSidePrefix(String scriptTag, final Map<String, Object> env) { String urlPrefixVar = getFirstMatch("\\bserver-side-prefix=" + stringValue, scriptTag); String urlPrefix = (String) env.get(urlPrefixVar); if (urlPrefix == null) throw new RuntimeException("invalid server-side-prefix " + urlPrefixVar); return urlPrefix; } private String getFirstMatch(String re, String s) { Matcher m = Pattern.compile(re).matcher(s); return m.find() ? m.group(1) : null; } static public class ReplaceAllWithCallback { static public interface Callback { public String replace(MatchResult matchResult); } static public String doIt(String subject, String regex, Callback callback) { return doIt(subject, Pattern.compile(regex), callback); } static public String doIt(String subject, Pattern pattern, Callback callback) { Matcher m = pattern.matcher(subject); StringBuffer result = new StringBuffer(); while (m.find()) { m.appendReplacement(result, ""); // add before match in result result.append(callback.replace(m)); } m.appendTail(result); // add after match in result return result.toString(); } } }
//This code is developed as part of the Java CoG Kit project //This message may not be removed or altered. package org.griphyn.vdl.mapping.file; import java.io.File; import java.io.IOException; import java.lang.reflect.Array; import java.lang.reflect.InvocationTargetException; import java.lang.reflect.Method; public class SymLinker { private static final String[] EMPTY_STRING_ARRAY = new String[0]; private static Object EMPTY_FILE_ATTR_ARRAY; private static boolean canSymLink; private static Class<?> clsPaths; private static Class<?> clsFiles; private static Method methodPathsGet; private static Method methodFilesSymLink; private static Method methodReadLink; private static Method methodIsLink; static { if (init()) { canSymLink = true; canSymLink = symLinkTest(); } else { canSymLink = false; } } private static synchronized boolean init() { String spec = System.getProperty("java.specification.version"); // assume digit.digit try { if (spec.length() == 3) { int major = Integer.parseInt(spec.substring(0, 1)); int minor = Integer.parseInt(spec.substring(2, 3)); boolean canSymLink = (major > 1) || (major == 1 && minor >= 7); if (!canSymLink) { return false; } } } catch (Exception e) { return false; } try { Class<?> clsFileAttribute = Class.forName("java.nio.file.attribute.FileAttribute"); Class<?> clsFileAttributeArray = Class.forName("[Ljava.nio.file.attribute.FileAttribute;"); EMPTY_FILE_ATTR_ARRAY = Array.newInstance(clsFileAttribute, 0); Class<?> clsPath = Class.forName("java.nio.file.Path"); clsPaths = Class.forName("java.nio.file.Paths"); clsFiles = Class.forName("java.nio.file.Files"); methodPathsGet = clsPaths.getMethod("get", new Class[] {String.class, String[].class}); methodFilesSymLink = clsFiles.getMethod("createSymbolicLink", new Class[] {clsPath, clsPath, clsFileAttributeArray}); methodReadLink = clsFiles.getMethod("readSymbolicLink", new Class[] {clsPath}); methodIsLink = clsFiles.getMethod("isSymbolicLink", new Class[] {clsPath}); return true; } catch (Exception e) { return false; } } public static boolean canSymLink() { return canSymLink; } private static boolean symLinkTest() { try { File f = File.createTempFile("symlinktest", "tmp"); try { File g = File.createTempFile("symlinktest", "tmp"); try { g.delete(); symLink(getPath(f.getAbsolutePath()), g.getAbsolutePath()); return true; } catch (Exception e) { return false; } finally { g.delete(); } } finally { f.delete(); } } catch (Exception e) { return false; } } public static void symLink(Object target, String link) throws IOException { Object filePath = target; Object linkPath = getPath(link); filePath = resolveLink(filePath); createLink(filePath, linkPath); } /** * Determines if a path is a symbolic link. If it is, it resolves it * and returns the link target. If not, it returns <code>null</code> */ public static Object readLink(String file) throws IOException { try { Object filePath = getPath(file); Object[] linkPathArg = new Object[] {filePath}; Boolean isLink = (Boolean) methodIsLink.invoke(null, linkPathArg); if (isLink) { return methodReadLink.invoke(null, linkPathArg); } else { return null; } } catch (IllegalArgumentException e) { throw new UnsupportedOperationException(e); } catch (IllegalAccessException e) { throw new UnsupportedOperationException(e); } catch (InvocationTargetException e) { Throwable t = e.getTargetException(); if (t instanceof UnsupportedOperationException) { throw (UnsupportedOperationException) t; } else if (t instanceof IOException) { throw (IOException) t; } else if (t instanceof SecurityException) { throw new UnsupportedOperationException(t); } else { throw new UnsupportedOperationException(t); } } } private static Object resolveLink(Object linkPath) throws IOException { try { Object[] linkPathArg = new Object[] {linkPath}; Boolean isLink = (Boolean) methodIsLink.invoke(null, linkPathArg); if (isLink) { return methodReadLink.invoke(null, linkPathArg); } else { return linkPath; } } catch (IllegalArgumentException e) { throw new UnsupportedOperationException(e); } catch (IllegalAccessException e) { throw new UnsupportedOperationException(e); } catch (InvocationTargetException e) { Throwable t = e.getTargetException(); if (t instanceof UnsupportedOperationException) { throw (UnsupportedOperationException) t; } else if (t instanceof IOException) { throw (IOException) t; } else if (t instanceof SecurityException) { throw new UnsupportedOperationException(t); } else { throw new UnsupportedOperationException(t); } } } private static void createLink(Object file, Object link) throws IOException { try { methodFilesSymLink.invoke(null, new Object[] {link, file, EMPTY_FILE_ATTR_ARRAY}); } catch (IllegalArgumentException e) { throw new UnsupportedOperationException(e); } catch (IllegalAccessException e) { throw new UnsupportedOperationException(e); } catch (InvocationTargetException e) { Throwable t = e.getTargetException(); if (t instanceof UnsupportedOperationException) { throw (UnsupportedOperationException) t; } else if (t instanceof IOException) { throw (IOException) t; } else if (t instanceof SecurityException) { throw new UnsupportedOperationException(t); } else if (t instanceof RuntimeException) { // expect FileAlreadyExistsException throw new IOException(t); } else { throw new UnsupportedOperationException(t); } } } public static Object getPath(String file) throws IOException { if (!canSymLink) { return null; } try { return methodPathsGet.invoke(null, new Object[] {file, EMPTY_STRING_ARRAY}); } catch (IllegalArgumentException e) { throw new UnsupportedOperationException(e); } catch (IllegalAccessException e) { throw new UnsupportedOperationException(e); } catch (InvocationTargetException e) { Throwable t = e.getTargetException(); if (t instanceof RuntimeException) { // expect InvalidPathException throw new IOException(t); } else { throw new UnsupportedOperationException(t); } } } }
package org.jabref.gui.importer.fetcher; import javafx.geometry.Pos; import javafx.scene.Node; import javafx.scene.control.Button; import javafx.scene.control.ComboBox; import javafx.scene.control.TextField; import javafx.scene.layout.HBox; import javafx.scene.layout.Priority; import javafx.scene.layout.StackPane; import javafx.scene.layout.VBox; import org.jabref.gui.JabRefFrame; import org.jabref.gui.SidePaneComponent; import org.jabref.gui.SidePaneManager; import org.jabref.gui.SidePaneType; import org.jabref.gui.actions.Action; import org.jabref.gui.actions.ActionFactory; import org.jabref.gui.actions.StandardActions; import org.jabref.gui.help.HelpAction; import org.jabref.gui.icon.IconTheme; import org.jabref.gui.search.SearchTextField; import org.jabref.gui.util.ViewModelListCellFactory; import org.jabref.logic.importer.SearchBasedFetcher; import org.jabref.logic.l10n.Localization; import org.jabref.preferences.JabRefPreferences; import org.fxmisc.easybind.EasyBind; public class WebSearchPane extends SidePaneComponent { private final JabRefPreferences preferences; private final WebSearchPaneViewModel viewModel; public WebSearchPane(SidePaneManager sidePaneManager, JabRefPreferences preferences, JabRefFrame frame) { super(sidePaneManager, IconTheme.JabRefIcons.WWW, Localization.lang("Web search")); this.preferences = preferences; this.viewModel = new WebSearchPaneViewModel(preferences.getImportFormatPreferences(), frame, preferences); } @Override public Action getToggleAction() { return StandardActions.TOGGLE_WEB_SEARCH; } @Override protected Node createContentPane() { // Setup combo box for fetchers ComboBox<SearchBasedFetcher> fetchers = new ComboBox<>(); new ViewModelListCellFactory<SearchBasedFetcher>() .withText(SearchBasedFetcher::getName) .install(fetchers); fetchers.itemsProperty().bind(viewModel.fetchersProperty()); fetchers.valueProperty().bindBidirectional(viewModel.selectedFetcherProperty()); fetchers.setMaxWidth(Double.POSITIVE_INFINITY); // Create help button for currently selected fetcher StackPane helpButtonContainer = new StackPane(); ActionFactory factory = new ActionFactory(preferences.getKeyBindingRepository()); EasyBind.subscribe(viewModel.selectedFetcherProperty(), fetcher -> { if ((fetcher != null) && fetcher.getHelpPage().isPresent()) { HelpAction helpCommand = new HelpAction(fetcher.getHelpPage().get()); Button helpButton = factory.createIconButton(StandardActions.HELP, helpCommand.getCommand()); helpButtonContainer.getChildren().setAll(helpButton); } else { helpButtonContainer.getChildren().clear(); } }); HBox fetcherContainer = new HBox(fetchers, helpButtonContainer); HBox.setHgrow(fetchers, Priority.ALWAYS); // Create text field for query input TextField query = SearchTextField.create(); query.setOnAction(event -> viewModel.search()); viewModel.queryProperty().bind(query.textProperty()); // Create button that triggers search Button search = new Button(Localization.lang("Search")); search.setDefaultButton(false); search.setOnAction(event -> viewModel.search()); // Put everything together VBox container = new VBox(); container.setAlignment(Pos.CENTER); container.getChildren().addAll(fetcherContainer, query, search); return container; } @Override public SidePaneType getType() { return SidePaneType.WEB_SEARCH; } @Override public void beforeClosing() { preferences.putBoolean(JabRefPreferences.WEB_SEARCH_VISIBLE, Boolean.FALSE); } @Override public void afterOpening() { preferences.putBoolean(JabRefPreferences.WEB_SEARCH_VISIBLE, Boolean.TRUE); } @Override public Priority getResizePolicy() { return Priority.NEVER; } }
// $Id: MergeData.java,v 1.3 2004/09/06 13:55:40 belaban Exp $ package org.jgroups.protocols.pbcast; import org.jgroups.Address; import org.jgroups.View; import java.io.Externalizable; import java.io.IOException; import java.io.ObjectInput; import java.io.ObjectOutput; /** * Encapsulates data sent with a MERGE_RSP (handleMergeResponse()) and INSTALL_MERGE_VIEW * (handleMergeView()). * * @author Bela Ban Oct 22 2001 */ public class MergeData implements Externalizable { Address sender=null; boolean merge_rejected=false; View view=null; Digest digest=null; /** * Empty constructor needed for externalization */ public MergeData() { ; } public MergeData(Address sender, View view, Digest digest) { this.sender=sender; this.view=view; this.digest=digest; } public Address getSender() { return sender; } public View getView() { return view; } public Digest getDigest() { return digest; } public void setView(View v) { view=v; } public void setDigest(Digest d) { digest=d; } public boolean equals(Object other) { return sender != null && other != null && other instanceof MergeData && ((MergeData)other).sender != null && ((MergeData)other).sender.equals(sender); } public void writeExternal(ObjectOutput out) throws IOException { out.writeObject(sender); out.writeBoolean(merge_rejected); if(!merge_rejected) { out.writeObject(view); out.writeObject(digest); } } public void readExternal(ObjectInput in) throws IOException, ClassNotFoundException { sender=(Address)in.readObject(); merge_rejected=in.readBoolean(); if(!merge_rejected) { view=(View)in.readObject(); digest=(Digest)in.readObject(); } } public String toString() { StringBuffer sb=new StringBuffer(); sb.append("sender=" + sender); if(merge_rejected) sb.append(" (merge_rejected)"); else { sb.append(", view=" + view + ", digest=" + digest); } return sb.toString(); } }
package org.jenkinsci.remoting.protocol; import hudson.remoting.Future; import java.io.Closeable; import java.io.IOException; import java.nio.ByteBuffer; import java.nio.channels.ClosedChannelException; import java.util.ArrayList; import java.util.List; import java.util.concurrent.RejectedExecutionException; import java.util.concurrent.TimeUnit; import java.util.concurrent.atomic.AtomicInteger; import java.util.concurrent.locks.ReadWriteLock; import java.util.concurrent.locks.ReentrantReadWriteLock; import java.util.logging.Level; import java.util.logging.LogRecord; import java.util.logging.Logger; import javax.annotation.CheckForNull; import javax.annotation.Nonnull; import javax.annotation.Nullable; import javax.annotation.OverridingMethodsMustInvokeSuper; import javax.annotation.concurrent.GuardedBy; import javax.annotation.concurrent.NotThreadSafe; import org.jenkinsci.remoting.util.ByteBufferPool; /** * A stack of {@link ProtocolLayer} that make a network protocol. The stack will start with a {@link NetworkLayer} * instance, * optionally followed by a series of {@link FilterLayer} instances and terminated by a {@link ApplicationLayer} * instance. * * Instances are created using the {@link #on(NetworkLayer)} entry point, for example * * {@code ProtocolStack.on(netLayer).filter(filterLayer1).filter(filterLayer2).filter(filterLayer3).build(appLayer)} * * For this stack, the layers will be initialized and started in the following sequence: * * <ol> * <li>{@link NetworkLayer#init(ProtocolStack.Ptr)} (<em>netLayer</em>)</li> * <li>{@link FilterLayer#init(ProtocolStack.Ptr)} (<em>filterLayer1</em>)</li> * <li>{@link FilterLayer#init(ProtocolStack.Ptr)} (<em>filterLayer2</em>)</li> * <li>{@link FilterLayer#init(ProtocolStack.Ptr)} (<em>filterLayer3</em>)</li> * <li>{@link ApplicationLayer#init(ProtocolStack.Ptr)} (<em>appLayer</em>)</li> * <li>{@link NetworkLayer#start()} (<em>netLayer</em>)</li> * <li>{@link FilterLayer#start()} (<em>filterLayer1</em>)</li> * <li>{@link FilterLayer#start()} (<em>filterLayer2</em>)</li> * <li>{@link FilterLayer#start()} (<em>filterLayer3</em>)</li> * <li>{@link ApplicationLayer#start()} (<em>appLayer</em>)</li> * </ol> * * If this stack is closed via the network layer - a network initiated close - then the close will be propagated in the * following sequence: * * <ol> * <li>{@link NetworkLayer} (<em>netLayer</em>) detects close</li> * <li>{@link FilterLayer#onRecvClosed(IOException)} (<em>filterLayer1</em>)</li> * <li>{@link FilterLayer#onRecvClosed(IOException)} (<em>filterLayer2</em>)</li> * <li>{@link FilterLayer#onRecvClosed(IOException)} (<em>filterLayer3</em>)</li> * <li>{@link FilterLayer#onRecvClosed(IOException)} (<em>appLayer</em>)</li> * <li>{@link FilterLayer#doCloseSend()} (<em>filterLayer3</em>)</li> * <li>{@link FilterLayer#doCloseSend()} (<em>filterLayer2</em>)</li> * <li>{@link FilterLayer#doCloseSend()} (<em>filterLayer1</em>)</li> * <li>{@link NetworkLayer#doCloseSend()} (<em>netLayer</em>)</li> * </ol> * * If this stack is closed via a protocol layer - a mid-stack initiated close - then the close will be propagated in the * following sequence: * * <ol> * <li>{@link FilterLayer} (<em>filterLayer2</em>) initiates close</li> * <li>{@link FilterLayer#onRecvClosed(IOException)} (<em>filterLayer3</em>)</li> * <li>{@link FilterLayer#onRecvClosed(IOException)} (<em>appLayer</em>)</li> * <li>{@link FilterLayer#doCloseSend()} (<em>filterLayer3</em>)</li> * <li>{@link FilterLayer#doCloseSend()} (<em>filterLayer2</em>)</li> * <li>{@link FilterLayer#doCloseSend()} (<em>filterLayer1</em>)</li> * <li>{@link NetworkLayer#doCloseSend()} (<em>netLayer</em>)</li> * <li>{@link FilterLayer#onRecvClosed(IOException)} (<em>filterLayer1</em>)</li> * </ol> * * @param <T> the application specific API. * @since 3.0 */ public class ProtocolStack<T> implements Closeable, ByteBufferPool { /** * Our logger. */ private static final Logger LOGGER = Logger.getLogger(ProtocolStack.class.getName()); /** * The lock that guards the {@link Ptr#nextSend} and {@link Ptr#nextRecv} pointers. */ private final ReadWriteLock stackLock = new ReentrantReadWriteLock(); /** * Our network layer. */ private final NetworkLayer network; /** * Our application layer. */ private final ApplicationLayer<T> application; /** * The first layer for receiving data, should always point to {@link #network}. */ private final Ptr recvHead; /** * The name of this stack in to provide when logging. */ // TODO replace with org.slf4j.MDC once we switch to slf4j private String name; /** * Our listeners. */ @GuardedBy("stackLock") private final List<Listener> listeners = new ArrayList<Listener>(); private final long handshakingTimeout = 10L; private final TimeUnit handshakingUnits = TimeUnit.SECONDS; /** * Private constructor used by {@link Builder#build(ApplicationLayer)} * * @param name the name of this stack to attach to logs. * @param network the network transport. * @param filters the filters. * @param application the application layer. */ private ProtocolStack(String name, NetworkLayer network, List<FilterLayer> filters, ApplicationLayer<T> application, List<Listener> listeners) { this.name = name; this.network = network; this.application = application; this.recvHead = new Ptr(network); this.listeners.addAll(listeners); Ptr sendHead = recvHead; for (FilterLayer protocol : filters) { sendHead = new Ptr(sendHead, protocol); } new Ptr(sendHead, application); } /** * Create a {@link ProtocolStack} on the supplied {@link NetworkLayer}. * * @param network the {@link NetworkLayer} to build the stack on. * @return the {@link ProtocolStack.Builder}. */ public static ProtocolStack.Builder on(NetworkLayer network) { return new Builder(network); } /** * Initialize the stack. * * @throws IOException if the stack could not be initialized. */ private void init() throws IOException { if (LOGGER.isLoggable(Level.FINEST)) { LOGGER.log(Level.FINEST, "[{0}] Initializing", name()); } assert recvHead.layer == network; for (Ptr p = recvHead; p != null; p = p.getNextRecv()) { p.layer.init(p); } if (LOGGER.isLoggable(Level.FINEST)) { LOGGER.log(Level.FINEST, "[{0}] Starting", name()); } for (Ptr p = recvHead; p != null; p = p.getNextRecv()) { try { p.layer.start(); } catch (IOException e) { if (LOGGER.isLoggable(Level.FINEST)) { LogRecord record = new LogRecord(Level.FINEST, "[{0}] Start failure"); record.setParameters(new Object[]{name()}); record.setThrown(e); LOGGER.log(record); } Ptr nextRecv = p.getNextRecv(); if (nextRecv != null) { p.onRecvClosed(e); } throw e; } } if (LOGGER.isLoggable(Level.FINEST)) { LOGGER.log(Level.FINEST, "[{0}] Started", name()); } } /** * Gets the application specific API. * * @return the application specific API. * @see ApplicationLayer#get() */ public T get() { return application.get(); } /** * The name of this stack to use in logging. * * @return the name of this stack to use in logging. */ public String name() { return name; } /** * Updates the name of this stack to use in logging. * * @param name the new name of this stack to use in logging. */ public void name(String name) { if (!(this.name == null ? name == null : this.name.equals(name))) { if (LOGGER.isLoggable(Level.FINER)) { LOGGER.log(Level.FINER, "[{0}] is now known as [{1}]", new Object[]{this.name, name}); } this.name = name != null && !name.isEmpty() ? name : this.name; } } /** * {@inheritDoc} */ @Override public void close() throws IOException { if (LOGGER.isLoggable(Level.FINEST)) { LOGGER.log(Level.FINEST, "[{0}] Closing", name()); } try { application.doCloseWrite(); } catch (IOException e) { if (LOGGER.isLoggable(Level.FINEST)) { LogRecord record = new LogRecord(Level.FINEST, "[{0}] Abnormal close"); record.setParameters(new Object[]{name()}); record.setThrown(e); LOGGER.log(record); } throw e; } finally { if (LOGGER.isLoggable(Level.FINEST)) { LOGGER.log(Level.FINEST, "[{0}] Closed", name()); } } } /** * Adds a listener. * * @param listener the listener. */ public void addListener(Listener listener) { stackLock.writeLock().lock(); try { listeners.add(listener); } finally { stackLock.writeLock().unlock(); } } /** * Removes a listener. * * @param listener the listener. */ public void removeListener(Listener listener) { stackLock.writeLock().lock(); try { listeners.remove(listener); } finally { stackLock.writeLock().unlock(); } } /** * Request the {@link NetworkLayer} to stop receiving data. */ /*package*/ void doCloseRecv() { network.doCloseRecv(); } /** * Check if the {@link NetworkLayer} is open to receive data. * * @return {@code true} if the {@link NetworkLayer} is receiving data. */ /*package*/ boolean isRecvOpen() { return network.isRecvOpen(); } /** * {@inheritDoc} */ @Override public int hashCode() { return System.identityHashCode(this); } /** * {@inheritDoc} */ @Override public boolean equals(Object obj) { return this == obj; } /** * {@inheritDoc} */ @Override public String toString() { final StringBuilder sb = new StringBuilder("ProtocolStack{"); sb.append("name='").append(name).append('\''); sb.append(",["); assert recvHead.layer == network; for (Ptr p = recvHead; p != null; p = p.getNextRecv()) { if (p != recvHead) { sb.append(','); } sb.append(p.layer); } sb.append("]}"); return sb.toString(); } /** * Callback notification that the protocol stack has been closed. * * @param cause the cause or {@code null} if the close was "normal". */ /*package*/ void onClosed(IOException cause) { final List<Listener> listeners = new ArrayList<Listener>(); stackLock.readLock().lock(); try { listeners.addAll(this.listeners); } finally { stackLock.readLock().unlock(); } for (Listener listener : listeners) { listener.onClosed(this, cause); } } /** * Executes the given command at some time in the future. * * @param task the runnable task * @throws RejectedExecutionException if this task cannot be accepted for execution * @throws NullPointerException if task is null */ @OverridingMethodsMustInvokeSuper public void execute(Runnable task) { network.getIoHub().execute(task); } /** * Executes a task at a future point in time. This method should not be used for timing critical scheduling, * rather it is intended to be used for things such as protocol timeouts. * * @param task the task. * @param delay the delay. * @param units the time units for the delay. * @return a {@link Future} that completes when the task has run and can be used to cancel the execution. * @throws RejectedExecutionException if this task cannot be accepted for execution * @throws NullPointerException if task is null */ @OverridingMethodsMustInvokeSuper public Future<?> executeLater(Runnable task, long delay, TimeUnit units) { return network.getIoHub().executeLater(task, delay, units); } /** * Gets this {@link ProtocolStack}'s handshaking timeout. * * @return this {@link ProtocolStack}'s handshaking timeout. * @see #getHandshakingUnits() */ public long getHandshakingTimeout() { return handshakingTimeout; } /** * Gets the {@link TimeUnit} of {@link #getHandshakingTimeout()}. * * @return the {@link TimeUnit} of {@link #getHandshakingTimeout()}. * @see #getHandshakingTimeout() () */ public TimeUnit getHandshakingUnits() { return handshakingUnits; } /** * {@inheritDoc} */ @Override public ByteBuffer acquire(int size) { return network.getIoHub().acquire(size); } /** * {@inheritDoc} */ @Override public void release(ByteBuffer buffer) { network.getIoHub().release(buffer); } /** * Builder for {@link ProtocolStack} instances. */ @NotThreadSafe public static class Builder { /** * Used tssign each stack a unique name unless a name has been specified. */ private static final AtomicInteger id = new AtomicInteger(); /** * The network layer to build on. */ private final NetworkLayer network; /** * The filters to build with. */ private final List<FilterLayer> filters; /** * The initial listeners to register. */ private final List<Listener> listeners = new ArrayList<Listener>(); /** * The name to give the protocol stack. */ @CheckForNull private String name; /** * Flag to track that this builder has been used. */ private boolean built; /** * Creates a new {@link Builder} * * @param network the network stack. */ private Builder(NetworkLayer network) { if (network.stack() != null) { throw new IllegalArgumentException(); } this.network = network; this.filters = new ArrayList<FilterLayer>(); } /** * Adds the supplied filter into the {@link ProtocolStack}. * * @param filter the filter to add, if {@code null} then it will be ignored (useful for conditionally adding * filters) * @return {@code this}. */ public Builder filter(@CheckForNull FilterLayer filter) { if (filter != null) { if (filter.stack() != null) { throw new IllegalArgumentException(); } checkNotBuilt(); filters.add(filter); } return this; } /** * Provide a custom name for the {@link ProtocolStack}. * * @param name the custom name. * @return {@code this} */ public Builder named(String name) { checkNotBuilt(); this.name = name; return this; } /** * Register a {@link Listener} for the {@link ProtocolStack}. * * @param listener the listener. * @return {@code this} */ public Builder listener(Listener listener) { checkNotBuilt(); this.listeners.add(listener); return this; } /** * Create the {@link ProtocolStack}. * * @param application the {@link ApplicationLayer} to use. * @param <T> the application specific API. * @return the {@link ProtocolStack}. * @throws IOException if the {@link ProtocolStack} could not be started. */ public <T> ProtocolStack<T> build(ApplicationLayer<T> application) throws IOException { if (application.stack() != null) { throw new IllegalArgumentException(); } checkNotBuilt(); built = true; ProtocolStack<T> stack = new ProtocolStack<T>( name == null || name.isEmpty() ? String.format("Stack-%d", id.incrementAndGet()) : name, network, filters, application, listeners); stack.init(); return stack; } /** * Enforce the {@link Builder} as single use. */ private void checkNotBuilt() { if (built) { throw new IllegalStateException("Builder is single-shot as Network layers cannot be reused"); } } } /** * Tracks where a {@link ProtocolLayer} is in the {@link ProtocolStack}. */ public class Ptr { /** * Our layer. */ private final ProtocolLayer layer; /** * The next layer for sending. */ @GuardedBy("ProtocolStack.stackLock") private Ptr nextSend; /** * The next layer for receiving. */ @GuardedBy("ProtocolStack.stackLock") private Ptr nextRecv; /** * Flag to track calling {@link ProtocolLayer.Recv#onRecvClosed(IOException)}. */ @GuardedBy("ProtocolStack.stackLock") private boolean recvOnClosed; /** * Flag to track calling {@link ProtocolLayer.Send#doCloseSend()}. */ @GuardedBy("ProtocolStack.stackLock") private boolean sendDoClosed; /** * Flag to track this {@link ProtocolLayer} as removed from the stack. */ private boolean removed; /** * Creates the first {@link Ptr}. * * @param network the {@link NetworkLayer}. */ private Ptr(NetworkLayer network) { stackLock.writeLock().lock(); try { nextSend = null; } finally { stackLock.writeLock().unlock(); } this.layer = network; } /** * Creates a filter {@link Ptr}. * * @param nextSend the previous {@link Ptr}. * @param filter the {@link FilterLayer} */ private Ptr(Ptr nextSend, FilterLayer filter) { stackLock.writeLock().lock(); try { this.nextSend = nextSend; nextSend.nextRecv = this; } finally { stackLock.writeLock().unlock(); } this.layer = filter; } /** * Creates the last {@link Ptr}. * * @param nextSend the previous {@link Ptr}. * @param application the {@link ApplicationLayer} */ private Ptr(Ptr nextSend, ApplicationLayer<?> application) { stackLock.writeLock().lock(); try { this.nextSend = nextSend; nextSend.nextRecv = this; } finally { stackLock.writeLock().unlock(); } this.layer = application; } /** * Each {@link ProtocolLayer.Recv} should call this method to hand received data up the stack to the next * {@link ProtocolLayer} (except for the {@link ApplicationLayer} which should eat the data). * * @param data the data to submit to the next layer up the stack. * @throws IOException if the next layer could not process the data. */ public void onRecv(ByteBuffer data) throws IOException { if (!data.hasRemaining()) { return; } Ptr nextRecv = getNextRecv(); if (nextRecv == null) { throw new UnsupportedOperationException("Application layer is not supposed to call onRecv"); } ProtocolLayer.Recv recv = (ProtocolLayer.Recv) nextRecv.layer; if (recv.isRecvOpen()) { recv.onRecv(data); } else { throw new ClosedChannelException(); } } /** * Each {@link ProtocolLayer.Send} should call this method to hand data for sending down the stack to the next * {@link ProtocolLayer} (except for the {@link NetworkLayer} which should eat the data). * * @param data the data to submit to the next layer down the stack. * @throws IOException if the next layer could not process the data. */ public void doSend(ByteBuffer data) throws IOException { if (!data.hasRemaining()) { return; } Ptr nextSend = getNextSend(); if (nextSend == null) { throw new UnsupportedOperationException("Network layer is not supposed to call doSend"); } ProtocolLayer.Send send = (ProtocolLayer.Send) nextSend.layer; if (send.isSendOpen()) { send.doSend(data); } else { throw new ClosedChannelException(); } } /** * Checks if the next layer up the stack is open to receive data. * * @return {@code true} if the next layer up the stack is open to receive data. */ public boolean isRecvOpen() { Ptr nextRecv; stackLock.readLock().lock(); try { nextRecv = getNextRecv(); if (nextRecv == null) { throw new UnsupportedOperationException("Application layer is not supposed to call isRecvOpen"); } if (recvOnClosed) { return false; } } finally { stackLock.readLock().unlock(); } return ((ProtocolLayer.Recv) nextRecv.layer).isRecvOpen(); } /** * Checks if the next layer down the stack is open to send data. * * @return {@code true} if the next layer down the stack is open to send data. */ public boolean isSendOpen() { Ptr nextSend; stackLock.readLock().lock(); try { nextSend = getNextSend(); if (nextSend == null) { throw new UnsupportedOperationException("Network layer is not supposed to call isSendOpen"); } if (sendDoClosed) { return false; } } finally { stackLock.readLock().unlock(); } return ((ProtocolLayer.Send) nextSend.layer).isSendOpen(); } /** * Helper method to access the {@link ProtocolStack}. * * @return the {@link ProtocolStack}. */ public ProtocolStack<?> stack() { return ProtocolStack.this; } /** * Requests removal of this {@link ProtocolLayer} from the {@link ProtocolStack} */ public void remove() { removed = true; } /** * Requests the next layer down the stack to close output. * * @throws IOException if there was an error closing the output. */ public void doCloseSend() throws IOException { if (getNextSend() == null) { throw new UnsupportedOperationException("Network layer is not allowed to call doClose()"); } stackLock.readLock().lock(); try { if (sendDoClosed) { return; } } finally { stackLock.readLock().unlock(); } stackLock.writeLock().lock(); try { if (sendDoClosed) { return; } sendDoClosed = true; } finally { stackLock.writeLock().unlock(); } if (nextSend().isSendOpen()) { nextSend().doCloseSend(); } } /** * Notify the next layer up the stack that input has been closed. * * @param cause the cause of the lower layer being closed or {@code null}. * @throws IOException if there was an error processing the close notification. */ public void onRecvClosed(IOException cause) throws IOException { if (getNextRecv() == null) { throw new UnsupportedOperationException("Application layer is not supposed to call onClose"); } stackLock.readLock().lock(); try { if (recvOnClosed) { return; } } finally { stackLock.readLock().unlock(); } stackLock.writeLock().lock(); try { if (recvOnClosed) { return; } recvOnClosed = true; } finally { stackLock.writeLock().unlock(); } if (nextRecv().isRecvOpen()) { nextRecv().onRecvClosed(cause); } } /** * Helper to get the next layer down the stack as a {@link ProtocolLayer.Send}. * * @return the next layer down the stack. * @throws NullPointerException if invoked from the {@link NetworkLayer}. */ @Nonnull private ProtocolLayer.Send nextSend() { return (ProtocolLayer.Send) getNextSend().layer; } /** * Gets the {@link Ptr} for the next layer down the stack (processing the send half of any intermediary * {@link #removed} flags if possible, if not possible it skips the removed {@link Ptr} instances anyway, * leaving the update to a later call) * * @return the {@link Ptr} for the next layer down the stack */ @Nullable private Ptr getNextSend() { Ptr nextSend; stackLock.readLock().lock(); try { nextSend = this.nextSend; while (nextSend != null && nextSend.removed && nextSend.nextSend != null) { nextSend = nextSend.nextSend; } if (nextSend == this.nextSend) { return nextSend; } } finally { stackLock.readLock().unlock(); } if (stackLock.writeLock().tryLock()) { // we only need to unwind ourselves eventually, if we cannot do it now ok to do it later try { while (this.nextSend != nextSend && this.nextSend != null && this.nextSend.removed) { assert this.nextSend.layer instanceof FilterLayer : "this is the layer before and there is a layer after nextSend thus nextSend " + "*must* be a FilterLayer"; ((FilterLayer) this.nextSend.layer).onSendRemoved(); // remove this.nextSend from the stack as it has set it's removed flag Ptr tmp = this.nextSend.nextSend; this.nextSend.nextSend = null; this.nextSend = tmp; } } finally { stackLock.writeLock().unlock(); } } return nextSend; } /** * Helper to get the next layer up the stack as a {@link ProtocolLayer.Recv}. * * @return the next layer up the stack. * @throws NullPointerException if invoked from the {@link ApplicationLayer}. */ @Nonnull private ProtocolLayer.Recv nextRecv() { return (ProtocolLayer.Recv) getNextRecv().layer; } /** * Gets the {@link Ptr} for the next layer up the stack (processing the receive half of any intermediary * {@link #removed} flags if possible, if not possible it skips the removed {@link Ptr} instances anyway, * leaving the update to a later call) * * @return the {@link Ptr} for the next layer up the stack */ @Nullable private Ptr getNextRecv() { Ptr nextRecv; stackLock.readLock().lock(); try { nextRecv = this.nextRecv; while (nextRecv != null && nextRecv.removed && nextRecv.nextRecv != null) { nextRecv = nextRecv.nextRecv; } if (nextRecv == this.nextRecv) { return this.nextRecv; } } finally { stackLock.readLock().unlock(); } if (stackLock.writeLock().tryLock()) { // we only need to unwind ourselves eventually, if we cannot do it now ok to do it later try { while (this.nextRecv != nextRecv && this.nextRecv != null && this.nextRecv.removed) { assert this.nextRecv.layer instanceof FilterLayer : "this is the layer before and there is a layer after nextRecv thus nextRecv " + "*must* be a FilterLayer"; ((FilterLayer) this.nextRecv.layer).onRecvRemoved(); // remove this.nextRecv from the stack as it has set it's removed flag Ptr tmp = this.nextRecv.nextRecv; this.nextRecv.nextRecv = null; this.nextRecv = tmp; } } finally { stackLock.writeLock().unlock(); } } return nextRecv; } } /** * Callback "interface" for changes in the state of {@link ProtocolStack}. */ public interface Listener { /** * When the stack was closed normally or abnormally due to an error. * * @param stack the stack that has closed. * @param cause if the stack is closed abnormally, this parameter * represents an exception that has triggered it. * Otherwise {@code null}. */ void onClosed(ProtocolStack<?> stack, IOException cause); } }
package org.jitsi.jicofo; import net.java.sip.communicator.impl.protocol.jabber.extensions.colibri.*; import net.java.sip.communicator.impl.protocol.jabber.extensions.rayo.*; import net.java.sip.communicator.service.protocol.*; import net.java.sip.communicator.util.Logger; import org.jitsi.impl.protocol.xmpp.extensions.*; import org.jitsi.jicofo.log.*; import org.jitsi.protocol.xmpp.*; import org.jitsi.util.*; import org.jitsi.videobridge.eventadmin.*; import org.jivesoftware.smack.*; import org.jivesoftware.smack.filter.*; import org.jivesoftware.smack.packet.*; import org.jivesoftware.smack.packet.Message; //disambiguation import org.jivesoftware.smack.provider.*; import org.jivesoftware.smackx.packet.*; /** * Class handles various Jitsi Meet extensions IQs like {@link MuteIq} and * Colibri for recording. * * @author Pawel Domas * @author Boris Grozev */ public class MeetExtensionsHandler implements PacketFilter, PacketListener { /** * The logger */ private final static Logger logger = Logger.getLogger(MeetExtensionsHandler.class); /** * <tt>FocusManager</tt> instance for accessing info about all active * conferences. */ private final FocusManager focusManager; /** * Operation set that provider XMPP connection. */ private OperationSetDirectSmackXmpp smackXmpp; /** * Creates new instance of {@link MeetExtensionsHandler}. * @param focusManager <tt>FocusManager</tt> that will be used by new * instance to access active conferences and focus * XMPP connection. */ public MeetExtensionsHandler(FocusManager focusManager) { this.focusManager = focusManager; MuteIqProvider muteIqProvider = new MuteIqProvider(); muteIqProvider.registerMuteIqProvider( ProviderManager.getInstance()); RayoIqProvider rayoIqProvider = new RayoIqProvider(); rayoIqProvider.registerRayoIQs( ProviderManager.getInstance()); StartMutedProvider startMutedProvider = new StartMutedProvider(); startMutedProvider.registerStartMutedProvider( ProviderManager.getInstance()); } /** * Initializes this instance and bind packet listeners. */ public void init() { this.smackXmpp = focusManager.getOperationSet( OperationSetDirectSmackXmpp.class); smackXmpp.addPacketHandler(this, this); } /** * Disposes this instance and stop listening for extensions packets. */ public void dispose() { if (smackXmpp != null) { smackXmpp.removePacketHandler(this); smackXmpp = null; } } @Override public boolean accept(Packet packet) { return acceptMuteIq(packet) || acceptColibriIQ(packet) || acceptRayoIq(packet) || acceptMessage(packet) || acceptPresence(packet); } @Override public void processPacket(Packet packet) { if (smackXmpp == null) { logger.error("Not initialized"); return; } if (packet instanceof ColibriConferenceIQ) { handleColibriIq((ColibriConferenceIQ) packet); } else if (packet instanceof MuteIq) { handleMuteIq((MuteIq) packet); } else if (packet instanceof RayoIqProvider.DialIq) { handleRayoIQ((RayoIqProvider.DialIq) packet); } else if (packet instanceof Message) { handleMessage((Message) packet); } else if (packet instanceof Presence) { handlePresence((Presence) packet); } else { logger.error("Unexpected packet: " + packet.toXML()); } } private boolean acceptColibriIQ(Packet packet) { return packet instanceof ColibriConferenceIQ // And with recording element && ((ColibriConferenceIQ)packet).getRecording() != null; } private void handleColibriIq(ColibriConferenceIQ colibriIQ) { ColibriConferenceIQ.Recording recording = colibriIQ.getRecording(); String from = colibriIQ.getFrom(); JitsiMeetConference conference = getConferenceForMucJid(colibriIQ.getFrom()); if (conference == null) { logger.debug("Room not found for JID: " + from); return; } boolean recordingState = conference.modifyRecordingState( colibriIQ.getFrom(), recording.getToken(), recording.getState(), recording.getDirectory()); ColibriConferenceIQ response = new ColibriConferenceIQ(); response.setType(IQ.Type.RESULT); response.setPacketID(colibriIQ.getPacketID()); response.setTo(colibriIQ.getFrom()); response.setFrom(colibriIQ.getTo()); response.setRecording( new ColibriConferenceIQ.Recording(recordingState)); smackXmpp.getXmppConnection().sendPacket(response); } private boolean acceptMuteIq(Packet packet) { return packet instanceof MuteIq; } private String getRoomNameFromMucJid(String mucJid) { int atIndex = mucJid.indexOf("@"); int slashIndex = mucJid.indexOf("/"); if (atIndex == -1 || slashIndex == -1) return null; return mucJid.substring(0, slashIndex); } private JitsiMeetConference getConferenceForMucJid(String mucJid) { String roomName = getRoomNameFromMucJid(mucJid); if (roomName == null) { return null; } return focusManager.getConference(roomName); } private void handleMuteIq(MuteIq muteIq) { Boolean doMute = muteIq.getMute(); String jid = muteIq.getJid(); if (doMute == null || StringUtils.isNullOrEmpty(jid)) return; String from = muteIq.getFrom(); JitsiMeetConference conference = getConferenceForMucJid(from); if (conference == null) { logger.debug("Mute error: room not found for JID: " + from); return; } IQ result; if (conference.handleMuteRequest(muteIq.getFrom(), jid, doMute)) { result = IQ.createResultIQ(muteIq); if (!muteIq.getFrom().equals(jid)) { MuteIq muteStatusUpdate = new MuteIq(); muteStatusUpdate.setType(IQ.Type.SET); muteStatusUpdate.setTo(jid); muteStatusUpdate.setMute(doMute); smackXmpp.getXmppConnection().sendPacket(muteStatusUpdate); } } else { result = IQ.createErrorResponse( muteIq, new XMPPError(XMPPError.Condition.interna_server_error)); } smackXmpp.getXmppConnection().sendPacket(result); } private boolean acceptRayoIq(Packet p) { return p instanceof RayoIqProvider.DialIq; } private void handleRayoIQ(RayoIqProvider.DialIq dialIq) { String from = dialIq.getFrom(); JitsiMeetConference conference = getConferenceForMucJid(from); if (conference == null) { logger.debug("Mute error: room not found for JID: " + from); return; } ChatRoomMemberRole role = conference.getRoleForMucJid(from); if (role == null) { // Only room members are allowed to send requests IQ error = createErrorResponse( dialIq, new XMPPError(XMPPError.Condition.forbidden)); smackXmpp.getXmppConnection().sendPacket(error); return; } if (ChatRoomMemberRole.MODERATOR.compareTo(role) < 0) { IQ error = createErrorResponse( dialIq, new XMPPError(XMPPError.Condition.not_allowed)); smackXmpp.getXmppConnection().sendPacket(error); return; } // Check if Jigasi is available String jigasiJid = conference.getServices().getSipGateway(); if (StringUtils.isNullOrEmpty(jigasiJid)) { // Not available IQ error = createErrorResponse( dialIq, new XMPPError(XMPPError.Condition.service_unavailable)); smackXmpp.getXmppConnection().sendPacket(error); return; } // Redirect original request to Jigasi component String originalPacketId = dialIq.getPacketID(); dialIq.setFrom(null); dialIq.setTo(jigasiJid); dialIq.setPacketID(IQ.nextID()); IQ reply = (IQ) smackXmpp.getXmppConnection().sendPacketAndGetReply(dialIq); // Send Jigasi response back to the client reply.setFrom(null); reply.setTo(from); reply.setPacketID(originalPacketId); smackXmpp.getXmppConnection().sendPacket(reply); } private boolean acceptMessage(Packet packet) { if (packet != null && packet instanceof Message) { for (PacketExtension pe : packet.getExtensions()) if (pe instanceof LogPacketExtension) return true; } return false; } /** * Handles "message" stanzas. */ private void handleMessage(Message message) { for (PacketExtension ext : message.getExtensions()) if (ext instanceof LogPacketExtension) handleLogRequest((LogPacketExtension) ext, message.getFrom()); } /** * Handles XEP-0337 "log" extensions. */ private void handleLogRequest(LogPacketExtension log, String jid) { JitsiMeetConference conference = getConferenceForMucJid(jid); if (conference == null) { logger.debug("Room not found for JID: " + jid); return; } Participant participant = conference.findParticipantForRoomJid(jid); if (participant != null) { EventAdmin eventAdmin = FocusBundleActivator.getEventAdmin(); if (eventAdmin != null) { if (LogUtil.LOG_ID_PC_STATS.equals(log.getID())) { String content = LogUtil.getContent(log); if (content != null) { Event event = EventFactory.peerConnectionStats( conference.getColibriConference().getConferenceId(), participant.getEndpointId(), content); if (event != null) eventAdmin.sendEvent(event); } } else { if (logger.isInfoEnabled()) logger.info("Ignoring log request with an unknown ID:" + log.getID()); } } } else { logger.info("Ignoring log request from an unknown JID: " + jid); } } private boolean acceptPresence(Packet packet) { return packet instanceof Presence; } /** * Handles presence stanzas * @param presence */ private void handlePresence(Presence presence) { // unavailable is sent when user leaves the room if (!presence.isAvailable()) { return; } String from = presence.getFrom(); JitsiMeetConference conference = getConferenceForMucJid(from); if (conference == null) { logger.debug("Room not found for JID: " + from); return; } ChatRoomMemberRole role = conference.getRoleForMucJid(presence.getFrom()); if(role != null && role.compareTo(ChatRoomMemberRole.MODERATOR) < 0) { StartMutedPacketExtension ext = (StartMutedPacketExtension) presence.getExtension( StartMutedPacketExtension.ELEMENT_NAME, StartMutedPacketExtension.NAMESPACE); if(ext != null) { boolean[] startMuted = new boolean[2]; startMuted[0] = ext.getAudioMuted(); startMuted[1] = ext.getVideoMuted(); conference.setStartMuted(startMuted); } } Participant participant = conference.findParticipantForRoomJid(presence.getFrom()); if (participant != null) { // Check if this conference is valid String conferenceId = conference.getColibriConference().getConferenceId(); if (StringUtils.isNullOrEmpty(conferenceId)) { logger.error( "Unable to send DisplayNameChanged event" + " - no conference id"); return; } // Check for changes to the display name String oldDisplayName = participant.getDisplayName(); String newDisplayName = null; for (PacketExtension pe : presence.getExtensions()) { if (pe instanceof Nick) { newDisplayName = ((Nick) pe).getName(); break; } } if ((oldDisplayName == null && newDisplayName != null) || (oldDisplayName != null && !oldDisplayName.equals(newDisplayName))) { participant.setDisplayName(newDisplayName); // Prevent NPE when adding to event hashtable if (newDisplayName == null) { newDisplayName = ""; } EventAdmin eventAdmin = FocusBundleActivator.getEventAdmin(); if (eventAdmin != null) { eventAdmin.sendEvent( EventFactory.endpointDisplayNameChanged( conferenceId, participant.getEndpointId(), newDisplayName)); } } } } /** * FIXME: replace with IQ.createErrorResponse * Prosody does not allow to include request body in error * response. Replace this method with IQ.createErrorResponse once fixed. */ private IQ createErrorResponse(IQ request, XMPPError error) { if (!(request.getType() == IQ.Type.GET || request.getType() == IQ.Type.SET)) { throw new IllegalArgumentException( "IQ must be of type 'set' or 'get'. Original IQ: " + request.toXML()); } final IQ result = new IQ() { public String getChildElementXML() { return ""; } }; result.setType(IQ.Type.ERROR); result.setPacketID(request.getPacketID()); result.setFrom(request.getTo()); result.setTo(request.getFrom()); result.setError(error); return result; } }
package org.jinstagram.utils; import java.nio.charset.Charset; import java.security.InvalidKeyException; import java.security.NoSuchAlgorithmException; import java.lang.NullPointerException; import javax.crypto.Mac; import javax.crypto.spec.SecretKeySpec; import org.apache.commons.codec.binary.Hex; import org.jinstagram.exceptions.InstagramException; @Deprecated public class EnforceSignedHeaderUtils { public static final String ENFORCE_SIGNED_HEADER = "X-Insta-Forwarded-For"; private static final String HMAC_SHA256 = "HmacSHA256"; @Deprecated public static String signature(String clientSecret, String message) throws InstagramException { try { SecretKeySpec keySpec = new SecretKeySpec(clientSecret.getBytes(Charset.forName("UTF-8")), HMAC_SHA256); Mac mac = Mac.getInstance(HMAC_SHA256); mac.init(keySpec); byte[] result = mac.doFinal(message.getBytes(Charset.forName("UTF-8"))); return Hex.encodeHexString(result); } catch (NoSuchAlgorithmException e) { throw new InstagramException("Invalid algorithm name!", e); } catch (InvalidKeyException e) { throw new InstagramException("Invalid key: " + clientSecret, e); } catch (NullPointerException e) { throw new InstagramException("Key is null!", e); } } }
package org.objectweb.proactive.core.node; import org.objectweb.proactive.ActiveObjectCreationException; import org.objectweb.proactive.core.runtime.ProActiveRuntime; /** * <p> * A <code>Node</code> offers a set of services needed by ProActive to work with * remote JVM. Each JVM that is aimed to hold active objects should contains at least * one instance of the node class. That instance, when created, will be registered * to some registry where it is possible to perform a lookup (such as the RMI registry). * </p><p> * When ProActive needs to interact with a remote JVM, it will lookup for one node associated * with that JVM (using typically the RMI Registry) and use this node to perform the interaction. * </p><p> * We expect several concrete implementations of the Node to be wrtten such as a RMI node, a JINI node ... * </p> * * @author ProActive Team * @version 1.1, 2002/08/28 * @since ProActive 0.9 * */ public interface Node { /** * Returns the node information as one object. This method allows to * retrieve all node information in one call to optimize performance. * @return the node information as one object */ public NodeInformation getNodeInformation(); /** * Returns a reference to the <code>ProActiveRuntime</code> where the node has been created * @return ProActiveRuntime. The reference to the <code>ProActiveRuntime</code> where the node has been created */ public ProActiveRuntime getProActiveRuntime(); /** * Returns all activeObjects deployed on this Node * @return Object[] contains all activeObjects deployed on this Node */ public Object[] getActiveObjects() throws NodeException,ActiveObjectCreationException; /** * Returns all activeObjects with the given name deployed on this Node * or null if such objects do not exist * @param objectName the class of the Active Objects * @return Object[].The set of activeObjects deployed on this node with the given name */ public Object[] getActiveObject(String objectName) throws NodeException,ActiveObjectCreationException; }
package org.lightmare.deploy.management; import java.io.File; import java.io.IOException; import java.io.Serializable; import java.io.Writer; import java.util.List; import javax.servlet.Servlet; import javax.servlet.ServletException; import javax.servlet.annotation.WebServlet; import javax.servlet.http.HttpServlet; import javax.servlet.http.HttpServletRequest; import javax.servlet.http.HttpServletResponse; import javax.servlet.http.HttpSession; import org.lightmare.deploy.fs.Watcher; import org.lightmare.utils.CollectionUtils; import org.lightmare.utils.IOUtils; import org.lightmare.utils.ObjectUtils; import org.lightmare.utils.StringUtils; /** * {@link Servlet} to manage deployed applications * * @author levan * */ @WebServlet("/DeployManager") public class DeployManager extends HttpServlet { private static final long serialVersionUID = 1L; public static final String DEPLOY_MANAGER_DEFAULT_NAME = CollectionUtils .getFirst(DeployManager.class.getAnnotation(WebServlet.class) .value()); // HTML tags private static final String BEGIN_TAGS = "<tr><td><a name = \""; private static final String NAME_OF_TAGS = "\" href=\" private static final String END_NAME_TAGS = "</a></td>\n"; private static final String END_TAGS = "</td><td><a href = \"DeployManager\">reload</a></td></tr>"; private static final String REDEPLOY_START_TAG = "<td><a name = \""; private static final String REDEPLOY_TYPE_TAG = "\" href=\"#\" onClick=\"sendRequest(this.name, '"; private static final String REDEPLOY_FILE_TYPE_TAG = "', '"; private static final String REDEPLOY_NAME_TAG = "')\">"; private static final String REDEPLOY_END_TAG = "</a></td>"; private static final String BEGIN_PAGE = StringUtils .concat("<html>\n", "\t<head><script type=\"text/javascript\">\n", "/* <![CDATA[ */\n", "\t\tfunction sendRequest(redeploy, type, fileType){\n ", "\t\t\tvar xmlhttp = new XMLHttpRequest();\n ", "\t\t\tvar reqUrl = \"DeployManager?file=\" + redeploy + \"&type=\" + type + \"&fileType=\" + fileType;\n", "\t\t\txmlhttp.open(\"GET\", reqUrl, true);\n", "\t\t\txmlhttp.send();\n", "}\n", "\n", "</script>\n", "\t<title>Deployment management</title>", "</head>\n", "\t<body>\n", "\t<table>\n"); private static final String TYPE_TAG = "\t\t<tr><td><br><b>"; private static final String END_TYPE_TAG = "</b></br></td></tr>\n"; private static final String END_PAGE = "</body></table>\n </html>"; private static final String LOGIN_PAGE = StringUtils .concat("<html>\n", "\t\t<head>\n", "\t\t\t<title>Login</title>\n", "\t\t</head>\n", "\t\t<body>\n", "\t\t\t\t\t\t<br><form name = \"ManagementLogin\" method=\"post\">", "\t\t\t\t\t\t\t<br><input type=\"user\" name=\"user\"></br>", "\t\t\t\t\t\t\t<br><input type=\"password\" name=\"password\"></br>", "\t\t\t\t\t\t\t<br><input type=\"submit\" value=\"Submit\"></br>", "\t\t\t\t\t\t</form></br>\n"); private static final String INCORRECT_MESSAGE = "<br><b>invalid user name / passowd</b></br>"; private static final String CONTROLL_NOT_ALLOWED_MESSAGE = "<br><b>server does not allows remote control</b></br>"; private static final String END_LOGIN_PAGE = "</html>"; private static final String DEPLOYMENTS = "deployments"; private static final String DATA_SOURCES = "datasources"; // HTTP parameters private static final String REDEPLOY_PARAM_NAME = "file"; private static final String TYPE_PARAM_NAME = "type"; private static final String REDEPLOY_TYPE = "redeploy"; private static final String UNDEPLOY_TYPE = "undeploy"; protected static final String FILE_TYPE_PARAMETER_NAME = "fileType"; private static final String APP_DEPLOYMENT_TYPE = "application"; private static final String DTS_DEPLOYMENT_TYPE = "datasource"; private static final String USER_PARAMETER_NAME = "user"; private static final String PASS_PARAMETER_NAME = "password"; // Security for deploy management private Security security; /** * Class to cache authenticated users for {@link DeployManager} java * {@link javax.servlet.http.HttpServlet} page * * @author levan * */ private static class DeployPass implements Serializable { private static final long serialVersionUID = 1L; private String userName; } private String getApplications() { List<File> apps = Watcher.listDeployments(); List<File> dss = Watcher.listDataSources(); StringBuilder builder = new StringBuilder(); builder.append(BEGIN_PAGE); builder.append(TYPE_TAG); builder.append(DEPLOYMENTS); builder.append(END_TYPE_TAG); String tag; if (CollectionUtils.valid(apps)) { for (File app : apps) { tag = getTag(app.getPath(), APP_DEPLOYMENT_TYPE); builder.append(tag); } } builder.append(BEGIN_PAGE); builder.append(TYPE_TAG); builder.append(DATA_SOURCES); builder.append(END_TYPE_TAG); if (CollectionUtils.valid(dss)) { for (File ds : dss) { tag = getTag(ds.getPath(), DTS_DEPLOYMENT_TYPE); builder.append(tag); } } builder.append(END_PAGE); return builder.toString(); } private void fillDeployType(StringBuilder builder, String app, String type, String fileType) { builder.append(REDEPLOY_START_TAG); builder.append(app); builder.append(REDEPLOY_TYPE_TAG); builder.append(type); builder.append(REDEPLOY_FILE_TYPE_TAG); builder.append(fileType); builder.append(REDEPLOY_NAME_TAG); builder.append(type); builder.append(REDEPLOY_END_TAG); } private String getTag(String app, String fileType) { StringBuilder builder = new StringBuilder(); builder.append(BEGIN_TAGS); builder.append(app); builder.append(NAME_OF_TAGS); builder.append(app); builder.append(END_NAME_TAGS); fillDeployType(builder, app, UNDEPLOY_TYPE, fileType); fillDeployType(builder, app, REDEPLOY_TYPE, fileType); builder.append(END_TAGS); return builder.toString(); } private String toLoginPage(boolean incorrect) { StringBuilder builder = new StringBuilder(); builder.append(LOGIN_PAGE); if (incorrect) { builder.append(INCORRECT_MESSAGE); } builder.append(END_LOGIN_PAGE); return builder.toString(); } private boolean authenticate(String userName, String password, HttpServletRequest request) { boolean valid = security.controlAllowed(request) && security.authenticate(userName, password); if (valid) { DeployPass pass = new DeployPass(); pass.userName = userName; HttpSession session = request.getSession(Boolean.FALSE); session.setAttribute(Security.DEPLOY_PASS_KEY, pass); } return valid; } private boolean check(HttpSession session) { boolean valid = ObjectUtils.notNull(session); if (valid) { Object pass = session.getAttribute(Security.DEPLOY_PASS_KEY); valid = ObjectUtils.notNull(pass); if (valid) { valid = (pass instanceof DeployPass) && (StringUtils.valid(((DeployPass) pass).userName)); } else { valid = security.check(); } } return valid; } @Override public void init() throws ServletException { try { security = new Security(); } catch (IOException ex) { } super.init(); } @Override protected void doGet(HttpServletRequest request, HttpServletResponse response) throws ServletException, IOException { boolean controllAllowed = security.controlAllowed(request); if (ObjectUtils.notTrue(controllAllowed)) { response.sendError(HttpServletResponse.SC_FORBIDDEN, CONTROLL_NOT_ALLOWED_MESSAGE); } else { boolean check = check(request.getSession(Boolean.FALSE)); String html; if (check) { String fileName = request.getParameter(REDEPLOY_PARAM_NAME); String type = request.getParameter(TYPE_PARAM_NAME); if (StringUtils.valid(fileName)) { if (type == null || REDEPLOY_TYPE.equals(type)) { Watcher.redeployFile(fileName); } else if (UNDEPLOY_TYPE.equals(type)) { Watcher.undeployFile(fileName); } } html = getApplications(); } else { html = toLoginPage(Boolean.FALSE); } Writer writer = response.getWriter(); try { writer.write(html); } finally { IOUtils.close(writer); } } } @Override protected void doPost(HttpServletRequest request, HttpServletResponse response) throws ServletException, IOException { boolean remoteAllowed = security.controlAllowed(request); if (ObjectUtils.notTrue(remoteAllowed)) { response.sendError(HttpServletResponse.SC_FORBIDDEN, CONTROLL_NOT_ALLOWED_MESSAGE); } else { String userName = request.getParameter(USER_PARAMETER_NAME); String password = request.getParameter(PASS_PARAMETER_NAME); boolean valid = StringUtils.valid(userName) && StringUtils.valid(password); if (valid) { valid = authenticate(userName, password, request); } if (valid) { response.sendRedirect(DEPLOY_MANAGER_DEFAULT_NAME); } else { String html = toLoginPage(Boolean.TRUE); Writer writer = response.getWriter(); try { writer.write(html); } finally { IOUtils.close(writer); } } } } }
package web.component.impl.aws.model; import java.util.HashSet; import java.util.Set; import org.junit.After; import org.junit.AfterClass; import static org.junit.Assert.*; import org.junit.Before; import org.junit.BeforeClass; import org.junit.Test; import web.component.api.model.VPC; import web.component.impl.aws.AWS; import web.component.impl.aws.ec2.AWSEC2; /** * * @author ksc */ public class VPCImplTest { static final String expectedCidrBlock = "10.1.0.0/16"; static final String expectedTenancy = ""; static final String expectedState = ""; static final String expectedDhcpOptionsId = ""; static VPCImpl testInstance; static String expectedStringExpression; static Set<VPC> testInstances = new HashSet<>(); public VPCImplTest() { } @BeforeClass public static void setUpClass() { testInstance = (VPCImpl) new VPCImpl.Builder().cidr(expectedCidrBlock).tenancy(expectedTenancy).create(); testInstances.add(testInstance); while(!testInstance.getState().equals("available")){ System.out.println("wait for test vpc to be ready ..."); try { Thread.sleep(10000); } catch (InterruptedException ex) { } } expectedStringExpression = "{VpcId: " + testInstance.getId() + ",CidrBlock: " + expectedCidrBlock + ",DhcpOptionsId: " + expectedDhcpOptionsId + ",Tags: [],InstanceTenancy: " + expectedTenancy + ",}"; System.out.println("Vpc for test is now available."); } @AfterClass public static void tearDownClass() { for(VPC toDelete : testInstances){ System.out.println("Delete test vpc [" + toDelete.toString() + "]"); toDelete.delete(); } } @Before public void setUp() { } @After public void tearDown() { } /** * Test of asEc2Vpc method, of class VPCImpl. */ @Test public void testAsEc2Vpc() { System.out.println("asEc2Vpc"); AWSEC2 ec2 = (AWSEC2)AWS.get(AWS.BlockName.EC2); com.amazonaws.services.ec2.model.Vpc source = ec2.getExistEc2Vpc(testInstance.getId()); com.amazonaws.services.ec2.model.Vpc viewAsEc2Vpc = testInstance.asEc2Vpc(); //two instances should be equal, but not the same. assertEquals(source, viewAsEc2Vpc); assertFalse(source == viewAsEc2Vpc); } /** * Test of getCidrBlock method, of class VPCImpl. */ @Test public void testGetCidrBlock() { System.out.println("getCidrBlock"); assertEquals(expectedCidrBlock, testInstance.getCidrBlock()); } /** * Test of getDhcpOptionsId method, of class VPCImpl. */ @Test public void testGetDhcpOptionsId() { System.out.println("getDhcpOptionsId"); assertEquals(expectedDhcpOptionsId, testInstance.getDhcpOptionsId()); } /** * Test of getInstanceTenancy method, of class VPCImpl. */ @Test public void testGetInstanceTenancy() { System.out.println("getInstanceTenancy"); assertEquals(expectedTenancy, testInstance.getInstanceTenancy()); } /** * Test of getIsDefault method, of class VPCImpl. */ @Test public void testGetIsDefault() { System.out.println("getIsDefault"); assertEquals(true, testInstance.getIsDefault()); } /** * Test of getState method, of class VPCImpl. */ @Test public void testGetState() { System.out.println("getState"); assertEquals(expectedState, testInstance.getState()); } /** * Test of getId method, of class VPCImpl. */ @Test public void testGetId() { System.out.println("getId"); VPC existVpc = new VPCImpl.Builder().id(testInstance.getId()).get(); assertEquals(testInstance.getId(), existVpc.getId()); } /** * Test of delete method, of class VPCImpl. */ @Test public void testDelete() { System.out.println("delete"); VPC toBeDeleted = new VPCImpl.Builder().cidr(expectedCidrBlock).tenancy(expectedTenancy).create(); while(!toBeDeleted.getState().equals("available")){ try { Thread.sleep(10000); } catch (InterruptedException ex) { } } testInstances.add(toBeDeleted); String deletedId = toBeDeleted.getId(); toBeDeleted.delete(); //wait for deletion to be completed. try { Thread.sleep(3000); } catch (InterruptedException ex) { } VPC shouldHaveBeenDeleted = new VPCImpl.Builder().id(deletedId).get(); assertEquals("Unknown state", shouldHaveBeenDeleted.getState()); } /** * Test of equals method, of class VPCImpl. */ @Test public void testEquals() { System.out.println("equals"); VPC equalInstance = new VPCImpl.Builder().id(testInstance.getId()).get(); VPC anotherInstance = new VPCImpl.Builder().cidr(expectedCidrBlock).tenancy(expectedTenancy).create(); testInstances.add(anotherInstance); while(!anotherInstance.getState().equals("available")){ try { Thread.sleep(10000); } catch (InterruptedException ex) { } } assertTrue(testInstance.equals(equalInstance)); assertFalse(testInstance.equals(anotherInstance)); } /** * Test of hashCode method, of class VPCImpl. */ @Test public void testHashCode() { System.out.println("hashCode"); VPC equalInstance = new VPCImpl.Builder().id(testInstance.getId()).get(); VPC anotherInstance = new VPCImpl.Builder().cidr(expectedCidrBlock).tenancy(expectedTenancy).create(); testInstances.add(anotherInstance); while(!anotherInstance.getState().equals("available")){ try { Thread.sleep(10000); } catch (InterruptedException ex) { } } assertTrue(testInstance.hashCode() == equalInstance.hashCode()); assertTrue(testInstance.hashCode() != anotherInstance.hashCode()); } /** * Test of toString method, of class VPCImpl. */ @Test public void testToString() { System.out.println("toString"); assertEquals(expectedStringExpression, testInstance.toString()); } }
package org.onedatashare.server.module; import com.google.api.services.drive.Drive; import com.google.api.services.drive.model.File; import com.google.api.services.drive.model.FileList; import org.onedatashare.server.model.core.Stat; import org.onedatashare.server.model.credential.EndpointCredential; import org.onedatashare.server.model.credential.OAuthEndpointCredential; import org.onedatashare.server.model.error.NotFoundException; import org.onedatashare.server.model.filesystem.operations.DeleteOperation; import org.onedatashare.server.model.filesystem.operations.DownloadOperation; import org.onedatashare.server.model.filesystem.operations.ListOperation; import org.onedatashare.server.model.filesystem.operations.MkdirOperation; import org.onedatashare.server.model.request.TransferJobRequest; import org.onedatashare.server.config.GDriveConfig; import reactor.core.publisher.Mono; import java.io.IOException; import java.util.Collections; import java.util.LinkedList; import java.util.List; /** * Resource class that provides services for Google Drive endpoint. */ public class GDriveResource extends Resource { public static GDriveConfig gDriveConfig; public static final String ROOT_DIR_ID = "root"; private static final String DOWNLOAD_URL = "https://drive.google.com/uc?id=%s&export=download"; private OAuthEndpointCredential credential; private Drive service; public GDriveResource(EndpointCredential credential) throws IOException { this.credential = (OAuthEndpointCredential) credential; gDriveConfig.initialize(); service = gDriveConfig.getDriveService(this.credential); } public Stat statHelper(String path, String id) throws IOException { Drive.Files.List result; Stat stat = new Stat() .setName(path) .setId(id); if (path.equals("/")) { stat.setDir(true); result = this.service.files().list() .setOrderBy("name") .setQ("trashed=false and 'root' in parents") .setFields("nextPageToken, files(id, name, kind, mimeType, size, modifiedTime)"); if (result == null) { throw new NotFoundException(); } FileList fileSet = null; List<Stat> sub = new LinkedList<>(); do { try { fileSet = result.execute(); List<File> files = fileSet.getFiles(); for (File file : files) { sub.add(mDataToStat(file)); } stat.setFiles(sub); result.setPageToken(fileSet.getNextPageToken()); } catch (NullPointerException e) { e.printStackTrace(); } catch (Exception e) { e.printStackTrace(); fileSet.setNextPageToken(null); } } while (result.getPageToken() != null); } else { File googleDriveFile = this.service.files().get(id) .setFields("id, name, kind, mimeType, size, modifiedTime") .execute(); if (googleDriveFile.getMimeType().equals("application/vnd.google-apps.folder")) { stat.setDir(true); String query = new StringBuilder().append("trashed=false and ") .append("'" + id + "'").append(" in parents").toString(); result = this.service.files().list() .setOrderBy("name").setQ(query) .setFields("nextPageToken, files(id, name, kind, mimeType, size, modifiedTime)"); if (result == null) throw new NotFoundException(); FileList fileSet = null; List<Stat> sub = new LinkedList<>(); do { try { fileSet = result.execute(); List<File> files = fileSet.getFiles(); for (File file : files) { sub.add(mDataToStat(file)); } stat.setFiles(sub); result.setPageToken(fileSet.getNextPageToken()); } catch (Exception e) { fileSet.setNextPageToken(null); } } while (result.getPageToken() != null); } else { stat.setFile(true); stat.setTime(googleDriveFile.getModifiedTime().getValue() / 1000); stat.setSize(googleDriveFile.getSize()); } } return stat; } private Stat mDataToStat(File file) { Stat stat = new Stat(file.getName()); try { stat.setFile(true); stat.setId(file.getId()); stat.setTime(file.getModifiedTime().getValue()/1000); if (file.getMimeType().equals("application/vnd.google-apps.folder")) { stat.setDir(true); stat.setFile(false); } else if(file.containsKey("size")) stat.setSize(file.getSize()); } catch (NullPointerException e) { }catch (Exception e) { e.printStackTrace(); } return stat; } @Override public Mono<Void> delete(DeleteOperation operation) { return Mono.create(s -> { try { this.service.files().delete(operation.getId()).execute(); s.success(); } catch (IOException e) { s.error(e); } }); } @Override public Mono<Stat> list(ListOperation operation) { return Mono.create(s ->{ try { Stat stat = statHelper(operation.getPath(), operation.getId()); s.success(stat); } catch (IOException e) { s.error(e); } }); } @Override public Mono<Void> mkdir(MkdirOperation operation) { return Mono.create(s -> { try { String[] foldersToCreate = operation.getFolderToCreate().split("/"); String currId = operation.getId(); for(int i =0; i < foldersToCreate.length; i++){ if(foldersToCreate[i].equals("")){ continue; } File fileMetadata = new File(); fileMetadata.setName(foldersToCreate[i]); fileMetadata.setMimeType("application/vnd.google-apps.folder"); fileMetadata.setParents(Collections.singletonList(currId)); File file = this.service.files().create(fileMetadata) .setFields("id") .execute(); currId = file.getId(); } } catch (IOException e) { s.error(e); } s.success(); }); } @Override public Mono download(DownloadOperation operation) { return null; } public static Mono<? extends Resource> initialize(EndpointCredential credential){ return Mono.create(s -> { try { GDriveResource gDriveResource= new GDriveResource(credential); s.success(gDriveResource); } catch (Exception e) { s.error(e); } }); } }
package org.protorabbit.json; import java.lang.reflect.InvocationTargetException; import java.lang.reflect.Method; import java.lang.reflect.Modifier; import java.lang.reflect.Type; import java.lang.reflect.ParameterizedType; import java.util.Collection; import java.util.Date; import java.util.HashMap; import java.util.Iterator; import java.util.Map; import java.util.ArrayList; import java.util.Arrays; import java.util.List; import java.util.logging.Logger; import org.protorabbit.json.Serialize; import org.json.JSONArray; import org.json.JSONException; import org.json.JSONObject; public class DefaultSerializer implements JSONSerializer { private static Logger logger = null; static Logger getLogger() { if (logger == null) { logger = Logger.getLogger("org.protrabbit"); } return logger; } public Object serialize(Object o) { // null is null if (o == null) { return JSONObject.NULL; } // collections if (Collection.class.isAssignableFrom(o.getClass())) { Iterator<?> it = ((Collection<?>)o).iterator(); JSONArray ja = new JSONArray(); while(it.hasNext()) { Object i = serialize(it.next()); ja.put(i); } return ja; } // maps if (Map.class.isAssignableFrom(o.getClass())) { JSONObject jo = new JSONObject(); Map<?, ?> m = ((Map<?, ?>)o); Iterator<?> ki = m.keySet().iterator(); while (ki.hasNext()) { Object key = ki.next(); Object value = serialize(m.get(key)); try { jo.put(key.toString(), value); } catch (JSONException e) { e.printStackTrace(); } } return jo; } // primitives if (o instanceof Double || o instanceof Number || o instanceof Integer || o instanceof String || o instanceof Enum<?> || o instanceof Boolean) { return o; } if (o instanceof Date) { return ((Date)o).getTime(); } // convert arrays to collections boolean b = o.getClass().isArray(); if (b) { try { Object[] objs = (Object[])o; List<Object> l = Arrays.asList(objs); return serialize(l); } catch (ClassCastException e) { return JSONObject.NULL; } } // serialize using bean like methods return serializePOJO(o, true); } protected boolean skipSerialization ( Method m ) { boolean skipIt = !( Modifier.isPublic(m.getModifiers()) && !"getHibernateLazyInitializer".equals(m.getName()) && !"getClass".equals(m.getName()) && !"getParent".equals(m.getName()) && !"getSystemClassLoader".equals(m.getName()) && !"getMethods".equals(m.getName()) && !"getDeclaredClasses".equals(m.getName()) && !"getConstructors".equals(m.getName()) && !"getDeclaringClass".equals(m.getName()) && !"getEnclosingClass".equals(m.getName()) && !"getClassLoader".equals(m.getName()) && (m.getName().startsWith("get") || m.getName().startsWith("is") ) && m.getName().length() > 2 && m.getParameterTypes().length == 0); if( !skipIt && m.isAnnotationPresent(Serialize.class)) { Serialize s = m.getAnnotation(Serialize.class); if ("skip".equals(s.value())) { skipIt = true; } } return skipIt; } /* * Look at all the public methods in the object * find the ones that start with "get" * * create a property key for the methods and invoke the method using reflection * to get value. */ public Object serializePOJO(Object pojo, boolean includeSuper) { if ("java.lang.Class".equals(pojo.getClass().getName())) { return null; } if (pojo.getClass().getClassLoader() == null) { includeSuper = false; } Object[] args = {}; HashMap<String, Object> map = new HashMap<String, Object>(); Method[] methods = null; if (includeSuper) { methods =pojo.getClass().getMethods(); } else { methods =pojo.getClass().getDeclaredMethods(); } for (int i=0; i < methods.length;i++) { Method m = methods[i]; try { // skip if there is a skip annotation if( !skipSerialization( m ) ) { // change the case of the property from camelCase String key = ""; if (m.getName().startsWith("is") && m.getName().length() > 3) { key += m.getName().substring(2,3).toLowerCase(); // get the rest of the name; key += m.getName().substring(3); } else if (m.getName().startsWith("get") && m.getName().length() >= 4) { key += m.getName().substring(3,4).toLowerCase(); // get the rest of the name; key += m.getName().substring(4); } Object value = m.invoke(pojo, args); map.put(key, value); } } catch (IllegalArgumentException e) { getLogger().warning("Unable to serialize " + pojo + " : " + e); } catch (IllegalAccessException e) { getLogger().warning("Unable to serialize " + pojo + " : " + e); } catch (InvocationTargetException e) { getLogger().warning("Unable to serialize " + pojo + " : " + e); } } // use the serializer itself to serialize a map of properties we created if (map.keySet().size() > 0) { return serialize(map); } return JSONObject.NULL; } /* * Get a 1 argument method matching the name and assignable with a given property */ @SuppressWarnings("unchecked") void invokeMethod(Method[] methods, String key, String name, JSONObject jo, Object targetObject) { Object param = null; Throwable ex = null; for (int i=0;i < methods.length; i++) { Method m = methods[i]; if (m.getName().equals(name)) { Class<?>[] paramTypes = m.getParameterTypes(); if (paramTypes.length == 1 && jo.has(key)) { Class<?> tparam = paramTypes[0]; boolean allowNull = false; try { if ( jo.isNull(key)) { // do nothing because param is already null : lets us not null on other types } else if (Long.class.isAssignableFrom(tparam) || tparam == long.class ) { param = new Long(jo.getLong(key)); } else if (Double.class.isAssignableFrom(tparam) || tparam == double.class ) { param = new Double(jo.getDouble(key)); } else if (Integer.class.isAssignableFrom(tparam) || tparam == int.class ) { param = new Integer(jo.getInt(key)); } else if (String.class.isAssignableFrom(tparam)) { param = jo.getString(key); } else if (Enum.class.isAssignableFrom(tparam)) { param = Enum.valueOf((Class<? extends Enum>)tparam, jo.getString(key)); } else if (Boolean.class.isAssignableFrom(tparam)) { param = new Boolean(jo.getBoolean(key)); } else if (jo.isNull(key)) { param = null; allowNull = true; } else if (Collection.class.isAssignableFrom( tparam ) ) { if ( m.getGenericParameterTypes().length > 0) { Type t = m.getGenericParameterTypes()[0]; if ( t instanceof ParameterizedType) { ParameterizedType tv = (ParameterizedType)t; if ( tv.getActualTypeArguments().length > 0 && tv.getActualTypeArguments()[0] == String.class ) { List<String> ls = new ArrayList<String>(); JSONArray ja = jo.optJSONArray( key ); if ( ja != null) { for (int j=0; j < ja.length(); j++) { ls.add( ja.getString(j) ); } } param = ls; } else {// TODO : Add general object processing getLogger().warning("Don't know how to handle Collection of type : " + tv.getActualTypeArguments()[0] ); } } } } else { getLogger().warning("Unable to serialize " + key + " : Don't know how to handle " + tparam ); } } catch (JSONException e) { e.printStackTrace(); } if (param != null || allowNull) { try { if (m != null) { Object[] args = {param}; m.invoke(targetObject, args); ex = null; break; } } catch (SecurityException e) { ex = e; } catch (IllegalArgumentException e) { ex = e; } catch (IllegalAccessException e) { ex = e; } catch (InvocationTargetException e) { ex = e; } } } } } if (ex != null) { if (ex instanceof RuntimeException) { throw (RuntimeException)ex; } else { throw new RuntimeException(ex); } } } public void deSerialize(String jsonText, Object targetObject) { try { JSONObject jo = new JSONObject(jsonText); deSerialize(jo, targetObject); } catch (JSONException e) { e.printStackTrace(); } } @SuppressWarnings("unchecked") public void deSerialize(Object jsonObject, Object targetObject) { if (jsonObject != null) { JSONObject jo = (JSONObject)jsonObject; Method[] methods = targetObject.getClass().getMethods(); Iterator<String> it = jo.keys(); while (it.hasNext()) { String key = it.next(); // jump out if the key length is too short if (key.length() <= 1) continue; String mName = "set" + key.substring(0,1).toUpperCase() + key.substring(1); invokeMethod( methods,key, mName, jo, targetObject); } } } public Object genericDeserialize(String jsonText) { // check for array jsonText = jsonText.trim(); if (jsonText.startsWith("[")) { try { JSONArray ja = new JSONArray(jsonText); return genericDeserialize(ja, null, null); } catch (JSONException jex) { throw new RuntimeException("Error Parsing JSON:" + jex); } // check for object } else if (jsonText.startsWith("{")) { try { JSONObject jo = new JSONObject(jsonText); return genericDeserialize(jo, null, null); } catch (JSONException jex) { throw new RuntimeException("Error Parsing JSON:" + jex); } } else { throw new RuntimeException("Error : Can only deserialize JSON objects or JSON arrays"); } } @SuppressWarnings("unchecked") private void addValue(Object targetObject, Object value, String key) { if (targetObject == null) { throw new RuntimeException("Error serializing: Can only deserialize JSON objects or JSON arrays"); } else if (targetObject instanceof ArrayList) { List l = (List)targetObject; l.add(value); } else if (targetObject instanceof HashMap && key != null) { Map m = (Map)targetObject; m.put(key, value); } } @SuppressWarnings("unchecked") private Object genericDeserialize(Object o, Object targetObject, String key) throws JSONException { if (o instanceof JSONObject) { JSONObject jo = (JSONObject)o; Map<String,Object> jaoo = new HashMap<String,Object>(); // only add if we are not top level if (targetObject != null) { addValue(targetObject, jaoo, key); } Iterator<String> it = jo.keys(); while (it.hasNext()) { String k = it.next(); Object value = jo.get(k); genericDeserialize(value, jaoo, k); } // if we are the top level object return self if (targetObject == null) { return jaoo; } } else if (o instanceof JSONArray) { JSONArray ja = (JSONArray)o; List<Object> jal = new ArrayList<Object>(); // only add if we are not top level if (targetObject != null) { addValue(targetObject, jal, key); } for (int i=0; i < ja.length(); i++) { Object jao = ja.get(i); genericDeserialize(jao, jal, null); } // if we are the top level object return self if (targetObject == null) { return jal; } // primitives } else if (o instanceof Date) { Object value = ((Date)o).getTime(); addValue(targetObject, value, key); } else { addValue(targetObject, o, key); } return null; } public Object deSerialize(String jsonText, Class<?> targetClass) { // check for array jsonText = jsonText.trim(); if (jsonText.startsWith("[")) { try { JSONArray ja = new JSONArray(jsonText); List<Object> jal = new ArrayList<Object>(); for (int i=0; i < ja.length(); i++) { try { Object jao = ja.get(i); Object targetObject = targetClass.newInstance(); deSerialize( jao, targetObject ); jal.add( targetObject ); } catch (InstantiationException e) { // TODO Auto-generated catch block e.printStackTrace(); } catch (IllegalAccessException e) { // TODO Auto-generated catch block e.printStackTrace(); } } return jal; } catch (JSONException jex) { throw new RuntimeException("Error Parsing JSON:" + jex); } // check for object } else if (jsonText.startsWith("{")) { try { Object o = targetClass.newInstance(); deSerialize(jsonText, o); return o; } catch (InstantiationException e) { e.printStackTrace(); } catch (IllegalAccessException e) { e.printStackTrace(); } } else { throw new RuntimeException("Error : Can only deserialize JSON objects or JSON arrays"); } return null; } public static void main(String[] args) { /* DefaultSerializer df = new DefaultSerializer(); TestObject to = new TestObject(); to.setFirstName("Greg"); to.setLastName("Murray"); to.setTimeout(55L); to.setFoo( TestObject.Foo.One); System.out.println("Original Object=" + to); JSONObject json = (JSONObject) df.serialize(to); System.out.println("JSON Object=" + json); TestObject to2 = (TestObject) df.deSerialize(json.toString(), TestObject.class); System.out.println("After=" + to2); */ } }
package uk.co.uwcs.choob.modules; import uk.co.uwcs.choob.*; import java.sql.*; import uk.co.uwcs.choob.support.*; import uk.co.uwcs.choob.support.events.*; import java.security.*; import java.util.List; import java.util.ArrayList; /** * Logs lines from IRC to the database. * @author sadiq */ public final class HistoryModule { private DbConnectionBroker dbBroker; /** Creates a new instance of LoggerModule */ HistoryModule(DbConnectionBroker dbBroker) { this.dbBroker = dbBroker; } /** * Logs a line from IRC to the database. * @param mes {@link Message} object representing the line from IRC. * @throws Exception Thrown from the database access, potential SQL or IO exceptions. */ public void addLog( Message mes ) { if (mes.getSynthLevel() > 0) return; AccessController.checkPermission(new ChoobPermission("history.add")); Connection dbConnection = null; PreparedStatement insertLine = null; try { dbConnection=dbBroker.getConnection(); insertLine = dbConnection.prepareStatement("INSERT INTO History VALUES(NULL,?,?,?,?,?,?,?)"); insertLine.setString(1, mes.getClass().getName()); insertLine.setString(2, mes.getNick()); insertLine.setString(3, mes.getNick()+"@"+mes.getHostname()); String chan = null; if (mes instanceof ChannelEvent) { chan = ((ChannelEvent)mes).getChannel(); } insertLine.setString(4, chan); insertLine.setString(5, mes.getMessage()); insertLine.setLong(6, mes.getMillis()); insertLine.setInt(7, mes.getRandom()); insertLine.executeUpdate(); } catch( SQLException e ) { System.err.println("Could not write history line to database: " + e); // I think this exception doesn't need to be propogated... --bucko } finally { try { if (insertLine != null) insertLine.close(); } catch (SQLException e) { System.err.println("Could not close SQL connection: " + e); } finally { dbBroker.freeConnection( dbConnection ); } } } /** * Get the ID of a message object. * @param mes The message object to find. * @return Either a message ID, or -1 if the message didn't exist. */ public int getMessageID( Message mes ) { Connection dbCon = null; PreparedStatement stat = null; try { dbCon=dbBroker.getConnection(); if (mes instanceof ChannelEvent) { stat = dbCon.prepareStatement("SELECT LineID FROM History WHERE Type = ? AND Nick = ? AND Hostmask = ? AND Time = ? AND Random = ? AND Channel = ?"); stat.setString(6, ((ChannelEvent)mes).getChannel()); } else stat = dbCon.prepareStatement("SELECT LineID FROM History WHERE Type = ? AND Nick = ? AND Hostmask = ? AND Time = ? AND Random = ?"); // Checking if the channel is null causes speshulness here. The check is irrelevant, though, because it will be, because of the Type. stat.setString(1, mes.getClass().getName()); stat.setString(2, mes.getNick()); stat.setString(3, mes.getNick()+"@"+mes.getHostname()); stat.setLong(4, mes.getMillis()); stat.setInt(5, mes.getRandom()); ResultSet result = stat.executeQuery(); if ( result.first() ) return result.getInt(1); else return -1; } catch( SQLException e ) { System.err.println("Could not read history line from database: " + e); throw new ChoobError("SQL Error reading from database."); } finally { try { if (stat != null) stat.close(); } catch (SQLException e) { System.err.println("Could not read history line from database: " + e); throw new ChoobError("SQL Error reading from database."); } finally { dbBroker.freeConnection( dbCon ); } } } /** * Get a historic message object. * @param messageID The message ID, as returned from getMessageID. * @return The message object or null if it didn't exist. */ public Message getMessage( int messageID ) { System.out.println("getMessage"); Connection dbCon = null; PreparedStatement stat = null; try { dbCon=dbBroker.getConnection(); stat = dbCon.prepareStatement("SELECT * FROM History WHERE LineID = ?"); stat.setInt(1, messageID); final ResultSet result = stat.executeQuery(); if ( result.first() ) { System.out.println("resultfirst"); final String type = result.getString(2); int pos = result.getString(4).indexOf('@'); final String login = result.getString(4).substring(0,pos); final String host = result.getString(4).substring(pos+1); final String channel = result.getString(5); Message mes; try { // Need privs to create events... mes = AccessController.doPrivileged( new PrivilegedExceptionAction<Message>() { public Message run() throws SQLException { System.out.println("run"); if (type.equals(ChannelAction.class.getName())) return new ChannelAction("onAction", result.getLong(7), result.getInt(8), result.getString(6), result.getString(3), login, host, channel, channel); else if (type.equals(ChannelMessage.class.getName())) return new ChannelMessage("onMessage", result.getLong(7), result.getInt(8), result.getString(6), result.getString(3), login, host, channel, channel); else if (type.equals(PrivateMessage.class.getName())) return new PrivateMessage("onPrivateMessage", result.getLong(7), result.getInt(8), result.getString(6), result.getString(3), login, host, channel); else if (type.equals(PrivateAction.class.getName())) return new PrivateAction("onPrivateAction", result.getLong(7), result.getInt(8), result.getString(6), result.getString(3), login, host, channel); return null; } }); } catch (PrivilegedActionException e) { throw (SQLException)e.getCause(); // Is an SQL exception... } if (mes == null) System.err.println("Invalid event type: " + type); return mes; } else return null; } catch( SQLException e ) { System.err.println("Could not read history line from database: " + e); throw new ChoobError("SQL Error reading from database."); } finally { try { if (stat != null) stat.close(); } catch (SQLException e) { System.err.println("Could not read history line from database: " + e); throw new ChoobError("SQL Error reading from database."); } finally { dbBroker.freeConnection( dbCon ); } } } /** * Get as the most recent Message from the history of the channel in which cause occurred. * @param cause The "cause" - only messages that occurred before this are processed * @return A list of message objects, the first being the most recent. */ public Message getLastMessage( Message cause ) { if (cause instanceof ChannelEvent) return getLastMessage(((ChannelEvent)cause).getChannel(), cause); throw new IllegalArgumentException("Message passed to getLastMessage was not a ChannelEvent."); } /** * Get as the most recent Message from the history of channel. * @param channel The channel to read * @return A list of message objects, the first being the most recent. */ public Message getLastMessage( String channel ) { return getLastMessage(channel, null); } /** * Get as the most recent Message from the history of channel. * @param channel The channel to read * @param cause The "cause" - only messages that occurred before this are processed * @return A list of message objects, the first being the most recent. */ public Message getLastMessage( String channel, Message cause ) { List<Message> ret = getLastMessages(channel, cause, 1); if (ret.size() == 1) return ret.get(0); else return null; } /** * Get as many as possible up to count Messages from the history of the channel in which cause occurred. * @param channel The channel to read * @param count The maximal number of messages to return. * @return A list of message objects, the first being the most recent. */ public List<Message> getLastMessages( String channel, int count ) { return getLastMessages(channel, null, count); } /** * Get as many as possible up to count Messages from the history of the channel in which cause occurred. * @param cause The "cause" - only messages that occurred before this are processed * @param count The maximal number of messages to return. * @return A list of message objects, the first being the most recent. */ public List<Message> getLastMessages( Message cause, int count ) { if (cause instanceof ChannelEvent) return getLastMessages(((ChannelEvent)cause).getChannel(), cause, count); throw new IllegalArgumentException("Message passed to getLastMessages was not a ChannelEvent."); } /** * Get as many as possible up to count Messages from the history of channel. * @param channel The channel to read * @param cause The "cause" - only messages that occurred before this are processed * @param count The maximal number of messages to return. * @return A list of message objects, the first being the most recent. */ public List<Message> getLastMessages( final String channel, Message cause, int count ) { Connection dbCon = null; PreparedStatement stat = null; try { dbCon = dbBroker.getConnection(); stat = dbCon.prepareStatement("SELECT * FROM History WHERE Channel = ? AND Time < ? AND Time > ? - 60*60*12*1000 ORDER BY Time DESC, LineID DESC LIMIT ?"); stat.setString(1, channel); stat.setLong(2, cause == null ? System.currentTimeMillis() : cause.getMillis() ); stat.setLong(3, cause == null ? System.currentTimeMillis() : cause.getMillis() ); stat.setInt(4, count); final ResultSet result = stat.executeQuery(); List<Message> results = new ArrayList<Message>(count); if ( result.first() ) { do { final String type = result.getString(2); int pos = result.getString(4).indexOf('@'); final String login = result.getString(4).substring(0,pos); final String host = result.getString(4).substring(pos+1); Message mes; try { // Need privs to create events... mes = AccessController.doPrivileged( new PrivilegedExceptionAction<Message>() { public Message run() throws SQLException { if (type.equals(ChannelAction.class.getName())) return new ChannelAction("onAction", result.getLong(7), result.getInt(8), result.getString(6), result.getString(3), login, host, channel, channel); else if (type.equals(ChannelMessage.class.getName())) return new ChannelMessage("onMessage", result.getLong(7), result.getInt(8), result.getString(6), result.getString(3), login, host, channel, channel); return null; } }); } catch (PrivilegedActionException e) { throw (SQLException)e.getCause(); // Is an SQL exception... } if (mes == null) { System.err.println("Invalid event type: " + type); continue; } }//*/
package org.osiam.security.helper; import java.util.ArrayList; import java.util.Collections; import java.util.HashMap; import java.util.Map; import javax.servlet.http.HttpServletRequest; import javax.servlet.http.HttpServletResponse; import org.osiam.auth.login.internal.InternalAuthentication; import org.osiam.auth.login.ldap.OsiamLdapAuthentication; import org.osiam.resources.scim.User; import org.springframework.context.ApplicationListener; import org.springframework.security.authentication.AuthenticationServiceException; import org.springframework.security.authentication.LockedException; import org.springframework.security.authentication.UsernamePasswordAuthenticationToken; import org.springframework.security.authentication.event.AbstractAuthenticationEvent; import org.springframework.security.authentication.event.AuthenticationFailureBadCredentialsEvent; import org.springframework.security.authentication.event.AuthenticationSuccessEvent; import org.springframework.security.core.Authentication; import org.springframework.security.core.GrantedAuthority; import org.springframework.security.web.authentication.AbstractAuthenticationProcessingFilter; import com.google.common.base.Strings; public class LoginDecisionFilter extends AbstractAuthenticationProcessingFilter implements ApplicationListener<AbstractAuthenticationEvent> { private static final int MAX_LOGIN_FAILED = 3; private boolean postOnly = true; private final Map<String, Integer> accessCounter = Collections.synchronizedMap(new HashMap<String, Integer>()); public LoginDecisionFilter() { super("/login/check"); } @Override public Authentication attemptAuthentication(HttpServletRequest request, HttpServletResponse response) { if (postOnly && !request.getMethod().equals("POST")) { throw new AuthenticationServiceException("Authentication method not supported: " + request.getMethod()); } UsernamePasswordAuthenticationToken authRequest = null; String username = request.getParameter(getUsernameParameter()); String password = request.getParameter(getPasswordParameter()); if (username == null) { username = ""; } if (password == null) { password = ""; } username = username.trim(); checkUserLocking(username); String provider = request.getParameter("provider"); if (!Strings.isNullOrEmpty(provider) && provider.equals("ldap")) { authRequest = new OsiamLdapAuthentication(username, password); } else { authRequest = new InternalAuthentication(username, password, new ArrayList<GrantedAuthority>()); } setDetails(request, authRequest); return this.getAuthenticationManager().authenticate(authRequest); } private void checkUserLocking(String username) { if (accessCounter.get(username) != null && accessCounter.get(username) >= MAX_LOGIN_FAILED) { throw new LockedException("The user '" + username + "' is temporary locked."); } } /** * Provided so that subclasses may configure what is put into the authentication request's details property. * * @param request * that an authentication request is being created for * @param authRequest * the authentication request object that should have its details set */ protected void setDetails(HttpServletRequest request, UsernamePasswordAuthenticationToken authRequest) { authRequest.setDetails(authenticationDetailsSource.buildDetails(request)); } /** * Defines whether only HTTP POST requests will be allowed by this filter. If set to true, and an authentication * request is received which is not a POST request, an exception will be raised immediately and authentication will * not be attempted. The <tt>unsuccessfulAuthentication()</tt> method will be called as if handling a failed * authentication. * <p> * Defaults to <tt>true</tt> but may be overridden by subclasses. */ public void setPostOnly(boolean postOnly) { this.postOnly = postOnly; } public final String getUsernameParameter() { return "username"; } public final String getPasswordParameter() { return "password"; } @Override public void onApplicationEvent(AbstractAuthenticationEvent appEvent) { String currentUserName = extractUserName(appEvent); if (currentUserName == null) { return; } if (appEvent instanceof AuthenticationSuccessEvent) { if (accessCounter.containsKey(currentUserName)) { if (accessCounter.get(currentUserName) < MAX_LOGIN_FAILED) { accessCounter.remove(currentUserName); } } } if (appEvent instanceof AuthenticationFailureBadCredentialsEvent) { if (accessCounter.containsKey(currentUserName)) { accessCounter.put(currentUserName, accessCounter.get(currentUserName) + 1); } else { accessCounter.put(currentUserName, 1); } } } private String extractUserName(AbstractAuthenticationEvent appEvent) { if (appEvent.getSource() != null && appEvent.getSource() instanceof InternalAuthentication) { InternalAuthentication internalAuth = (InternalAuthentication) appEvent.getSource(); if (internalAuth.getPrincipal() != null) { if (internalAuth.getPrincipal() instanceof User) { User user = (User) internalAuth.getPrincipal(); return user.getUserName(); } if (internalAuth.getPrincipal() instanceof String) { return (String) internalAuth.getPrincipal(); } } } return null; } }
package org.sugarj.cleardep.build; import java.io.File; import java.io.IOException; import java.io.Serializable; import java.net.URL; import java.util.ArrayList; import java.util.HashMap; import java.util.HashSet; import java.util.LinkedList; import java.util.List; import java.util.Map; import java.util.Set; import org.eclipse.core.runtime.FileLocator; import org.sugarj.cleardep.BuildUnit; import org.sugarj.cleardep.BuildUnit.InconsistenyReason; import org.sugarj.cleardep.BuildUnit.State; import org.sugarj.cleardep.build.BuildCycle.Result.UnitResultTuple; import org.sugarj.cleardep.build.BuildCycleException.CycleState; import org.sugarj.cleardep.dependency.BuildOutputRequirement; import org.sugarj.cleardep.dependency.BuildRequirement; import org.sugarj.cleardep.dependency.DuplicateBuildUnitPathException; import org.sugarj.cleardep.dependency.DuplicateFileGenerationException; import org.sugarj.cleardep.dependency.FileRequirement; import org.sugarj.cleardep.dependency.Requirement; import org.sugarj.cleardep.stamp.LastModifiedStamper; import org.sugarj.cleardep.stamp.Stamp; import org.sugarj.cleardep.xattr.Xattr; import org.sugarj.common.FileCommands; import org.sugarj.common.Log; import org.sugarj.common.path.AbsolutePath; import org.sugarj.common.path.Path; import com.cedarsoftware.util.DeepEquals; public class BuildManager extends BuildUnitProvider { private final static Map<Thread, BuildManager> activeManagers = new HashMap<>(); public static <Out extends Serializable> Out build(BuildRequest<?, Out, ?, ?> buildReq) { return build(buildReq, null); } public static <Out extends Serializable> Out build(BuildRequest<?, Out, ?, ?> buildReq, Map<? extends Path, Stamp> editedSourceFiles) { Thread current = Thread.currentThread(); BuildManager manager = activeManagers.get(current); boolean freshManager = manager == null; if (freshManager) { manager = new BuildManager(editedSourceFiles); activeManagers.put(current, manager); } try { return manager.requireInitially(buildReq).getBuildResult(); } catch (IOException e) { e.printStackTrace(); return null; } finally { if (freshManager) activeManagers.remove(current); } } public static <Out extends Serializable> List<Out> buildAll(BuildRequest<?, Out, ?, ?>[] buildReqs) { return buildAll(buildReqs, null); } public static <Out extends Serializable> List<Out> buildAll(BuildRequest<?, Out, ?, ?>[] buildReqs, Map<? extends Path, Stamp> editedSourceFiles) { Thread current = Thread.currentThread(); BuildManager manager = activeManagers.get(current); boolean freshManager = manager == null; if (freshManager) { manager = new BuildManager(editedSourceFiles); activeManagers.put(current, manager); } try { List<Out> out = new ArrayList<>(); for (BuildRequest<?, Out, ?, ?> buildReq : buildReqs) if (buildReq != null) try { out.add(manager.requireInitially(buildReq).getBuildResult()); } catch (IOException e) { e.printStackTrace(); out.add(null); } return out; } finally { if (freshManager) activeManagers.remove(current); } } private final Map<? extends Path, Stamp> editedSourceFiles; private ExecutingStack executingStack; private transient RequireStack requireStack; private transient Map<Path, BuildUnit<?>> generatedFiles; protected BuildManager(Map<? extends Path, Stamp> editedSourceFiles) { this.editedSourceFiles = editedSourceFiles; this.executingStack = new ExecutingStack(); // this.consistencyManager = new ConsistencyManager(); this.generatedFiles = new HashMap<Path, BuildUnit<?>>(); this.requireStack = new RequireStack(); } // @formatter:off private <In extends Serializable, Out extends Serializable> // @formatter:on void setUpMetaDependency(Builder<In, Out> builder, BuildUnit<Out> depResult) throws IOException { if (depResult != null) { // require the meta builder... String className = builder.getClass().getName(); URL res = builder.getClass().getResource(className.substring(className.lastIndexOf(".")+1) + ".class"); URL resFile = FileLocator.resolve(res); Path builderClass = new AbsolutePath(resFile.getFile()); Path depFile = Xattr.getDefault().getGenBy(builderClass); if (!FileCommands.exists(depFile)) { Log.log.logErr("Warning: Builder was not built using meta builder. Consistency for builder changes are not tracked...", Log.DETAIL); } else { BuildUnit<Serializable> metaBuilder = BuildUnit.read(depFile); depResult.requires(metaBuilder); depResult.requires(builderClass, LastModifiedStamper.instance.stampOf(builderClass)); // TODO: needed? //for (Path p : metaBuilder.getExternalFileDependencies()) { // depResult.requires(p, LastModifiedStamper.instance.stampOf(p)); } } } // @formatter:off protected <In extends Serializable, Out extends Serializable, B extends Builder<In, Out>, F extends BuilderFactory<In, Out, B>> // @formatter:on BuildUnit<Out> executeBuilder(Builder<In, Out> builder, Path dep, BuildRequest<In, Out, B, F> buildReq) throws IOException { this.requireStack.beginRebuild(dep); resetGenBy(dep, BuildUnit.read(dep)); BuildUnit<Out> depResult = BuildUnit.create(dep, buildReq); // First step: cycle detection BuildStackEntry<Out> entry = this.executingStack.push(depResult); int inputHash = DeepEquals.deepHashCode(builder.input); String taskDescription = builder.description(); if (taskDescription != null) Log.log.beginTask(taskDescription, Log.CORE); depResult.setState(BuildUnit.State.IN_PROGESS); try { try { // setUpMetaDependency(builder, depResult); // call the actual builder Out out = builder.triggerBuild(depResult, this); depResult.setBuildResult(out); if (!depResult.isFinished()) depResult.setState(BuildUnit.State.SUCCESS); } catch (BuildCycleException e) { throw this.tryCompileCycle(e); } } catch (BuildCycleException e) { stopBuilderInCycle(builder, dep, buildReq, depResult, e); } catch (RequiredBuilderFailed e) { if (taskDescription != null) Log.log.logErr("Required builder failed", Log.CORE); throw RequiredBuilderFailed.enqueueBuilder(e, depResult, builder); } catch (Throwable e) { depResult.setState(BuildUnit.State.FAILURE); Log.log.logErr(e.getMessage(), Log.CORE); throw RequiredBuilderFailed.init(builder, depResult, e); } finally { depResult.write(); if (taskDescription != null) Log.log.endTask(); if (inputHash != DeepEquals.deepHashCode(builder.input)) throw new AssertionError("API Violation detected: Builder mutated its input."); assertConsistency(depResult); this.executingStack.pop(entry); this.requireStack.finishRebuild(dep); } if (depResult.getState() == BuildUnit.State.FAILURE) throw new RequiredBuilderFailed(builder, depResult, new IllegalStateException("Builder failed for unknown reason, please confer log.")); return depResult; } @Override protected Throwable tryCompileCycle(BuildCycleException e) { // Only try to compile a cycle which is unhandled if (e.getCycleState() != CycleState.UNHANDLED) { return e; } Log.log.log("Detected a dependency cycle with root " + e.getCycleComponents().get(0).unit.getPersistentPath(), Log.CORE); e.setCycleState(CycleState.NOT_RESOLVED); BuildCycle cycle = new BuildCycle(e.getCycleComponents()); CycleSupport cycleSupport = cycle.getCycleSupport(); if (cycleSupport == null) { return e; } Log.log.beginTask("Compile cycle with: " + cycleSupport.getCycleDescription(cycle), Log.CORE); try { BuildCycle.Result result = cycleSupport.compileCycle(this, cycle); e.setCycleResult(result); e.setCycleState(CycleState.RESOLVED); } catch (BuildCycleException cyclicEx) { // Now cycle in cycle detected, use result from it // But keep throw away the new exception but use // the existing ones to kill all builders of this // cycle e.setCycleState(cyclicEx.getCycleState()); e.setCycleResult(cyclicEx.getCycleResult()); } catch (Throwable t) { Log.log.endTask("Cyclic compilation failed: " + t.getMessage()); return t; } Log.log.endTask(); return e; } // @formatter:off private <In extends Serializable, Out extends Serializable, B extends Builder<In, Out>, F extends BuilderFactory<In, Out, B>> //@formatter:on void stopBuilderInCycle(Builder<In, Out> builder, Path dep, BuildRequest<In, Out, B, F> buildReq, BuildUnit<Out> depResult, BuildCycleException e) { // This is the exception which has been rethrown above, but we cannot // handle it // here because compiling the cycle needs to be in the major try block // where normal // units are compiled too // Set the result to the unit if (e.getCycleState() == CycleState.RESOLVED) { if (e.getCycleResult() == null) { Log.log.log("Error: Cyclic builder does not provide a cycleResult " + e.hashCode(), Log.CORE); throw new AssertionError("Cyclic builder does not provide a cycleResult"); } UnitResultTuple<Out> tuple = e.getCycleResult().getUnitResult(depResult); if (tuple == null) { throw new AssertionError("Cyclic builder does not provide a result for " + depResult.getPersistentPath()); } tuple.setOutputToUnit(); } else { depResult.setState(State.FAILURE); } Log.log.log("Stopped because of cycle", Log.CORE); if (e.isUnitFirstInvokedOn(dep, buildReq.factory)) { if (e.getCycleState() != CycleState.RESOLVED) { Log.log.log("Unable to find builder which can compile the cycle", Log.CORE); // Cycle cannot be handled throw new RequiredBuilderFailed(builder, depResult, e); } else { if (this.executingStack.getNumContains(e.getCycleComponents().get(0).unit) == 1) { Log.log.log("but cycle has been compiled", Log.CORE); } else { throw e; } } } else { // Kill depending builders throw e; } } //@formatter:off protected <In extends Serializable, Out extends Serializable, B extends Builder<In, Out>, F extends BuilderFactory<In, Out, B>> //@formatter:on BuildUnit<Out> requireInitially(BuildRequest<In, Out, B, F> buildReq) throws IOException { Log.log.beginTask("Incrementally rebuild inconsistent units", Log.CORE); try { return require(null, buildReq); } finally { Log.log.endTask(); } } @Override //@formatter:off public <In extends Serializable, Out extends Serializable, B extends Builder<In, Out>, F extends BuilderFactory<In, Out, B>> //@formatter:on BuildUnit<Out> require(BuildUnit<?> source, BuildRequest<In, Out, B, F> buildReq) throws IOException { Builder<In, Out> builder = buildReq.createBuilder(); Path dep = builder.persistentPath(); BuildUnit<Out> depResult = BuildUnit.read(dep); boolean localInconsistent = (requireStack.isKnownInconsistent(dep)) || (depResult == null) || (!depResult.getGeneratedBy().deepEquals(buildReq)) || (!depResult.isConsistentNonrequirements()); if (localInconsistent) { return executeBuilder(builder, dep, buildReq); } if (requireStack.isConsistent(dep)) return depResult; // Dont execute require because it is cyclic, requireStack keeps track of // this if (source != null && requireStack.isAlreadyRequired(source.getPersistentPath(), dep)) { return depResult; } requireStack.beginRequire(dep); try { for (Requirement req : depResult.getRequirements()) { if (!req.isConsistentInBuild(depResult, this)) { return executeBuilder(builder, dep, buildReq); } else { // Could get consistent because it was part of a cycle which is // compiled now // TODO better remove that for security purpose? if (requireStack.isConsistent(dep)) return depResult; } } requireStack.markConsistent(dep); } finally { if (source != null) requireStack.finishRequire(source.getPersistentPath(), dep); else requireStack.finishRequire(null, dep); } return depResult; } private <Out extends Serializable> BuildUnit<Out> assertConsistency(BuildUnit<Out> depResult) { BuildUnit<?> other = generatedFiles.put(depResult.getPersistentPath(), depResult); if (other != null && other != depResult) throw new DuplicateBuildUnitPathException("Build unit " + depResult + " has same persistent path as build unit " + other); for (FileRequirement freq : depResult.getGeneratedFileRequirements()) { other = generatedFiles.put(freq.path, depResult); if (other != null && other != depResult) throw new DuplicateFileGenerationException("Build unit " + depResult + " generates same file as build unit " + other); } InconsistenyReason reason = depResult.isConsistentShallowReason(null); if (reason != InconsistenyReason.NO_REASON) throw new AssertionError("Build manager does not guarantee soundness " + reason + " for " + FileCommands.tryGetRelativePath(depResult.getPersistentPath())); return depResult; } private void resetGenBy(Path dep, BuildUnit<?> depResult) throws IOException { if (depResult != null) for (Path p : depResult.getGeneratedFiles()) BuildUnit.xattr.removeGenBy(p); } }
package org.osiam.storage.query; import java.io.ObjectInputStream.GetField; import java.util.Locale; import javax.persistence.criteria.CriteriaBuilder; import javax.persistence.criteria.Predicate; import javax.persistence.criteria.Root; import org.osiam.resources.exceptions.OsiamException; import org.osiam.storage.dao.ExtensionDao; import org.osiam.storage.entities.ExtensionEntity; import org.osiam.storage.entities.ExtensionFieldEntity; import org.osiam.storage.entities.UserEntity; import org.osiam.storage.helper.NumberPadder; public class UserSimpleFilterChain implements FilterChain<UserEntity> { private final ScimExpression scimExpression; private final QueryField<UserEntity> userFilterField; private ExtensionQueryField extensionFilterField; private final ExtensionDao extensionDao; private final CriteriaBuilder criteriaBuilder; private final NumberPadder numberPadder; public UserSimpleFilterChain(CriteriaBuilder criteriaBuilder, ExtensionDao extensionDao, ScimExpression scimExpression, NumberPadder numberPadder) { this.criteriaBuilder = criteriaBuilder; this.extensionDao = extensionDao; this.numberPadder = numberPadder; this.scimExpression = scimExpression; String field = scimExpression.getField(); userFilterField = UserQueryField.fromString(field.toLowerCase(Locale.ENGLISH)); // It's not a known user field, so try to build a extension filter if (userFilterField == null) { extensionFilterField = getExtensionFilterField(field.toLowerCase(Locale.ENGLISH)); if(extensionFilterField == null) { throw new IllegalArgumentException("Filtering not possible: '" + field + "' not available"); } } } private ExtensionQueryField getExtensionFilterField(String fieldString) { int lastIndexOf = fieldString.lastIndexOf('.'); if (lastIndexOf == -1) { return null; } String urn = fieldString.substring(0, lastIndexOf); String fieldName = fieldString.substring(lastIndexOf + 1); final ExtensionEntity extension; try { extension = extensionDao.getExtensionByUrn(urn, true); } catch (OsiamException ex) { return null; } final ExtensionFieldEntity fieldEntity = extension.getFieldForName(fieldName, true); return new ExtensionQueryField(urn, fieldEntity, numberPadder); } @Override public Predicate createPredicateAndJoin(Root<UserEntity> root) { if (userFilterField != null) { return userFilterField.addFilter(root, scimExpression.getConstraint(), scimExpression.getValue(), criteriaBuilder); } else if (extensionFilterField != null) { return extensionFilterField.addFilter(root, scimExpression.getConstraint(), scimExpression.getValue(), criteriaBuilder); } else { throw new IllegalArgumentException("Filtering not possible. Field '" + scimExpression.getField() + "' not available."); } } }
package pablosaraiva.gotobed; import java.sql.Connection; import java.sql.DriverManager; import java.sql.SQLException; public class SimpleBedProvider extends BedProvider { static { try { Class.forName("org.hsqldb.jdbc.JDBCDriver"); } catch (ClassNotFoundException e) { e.printStackTrace(); } } @Override public Connection getConnection() throws SQLException { return DriverManager.getConnection("jdbc:hsqldb:mem:mymemdb", "SA", ""); } }
package org.secureauth.sarestapi.resources; import java.io.ByteArrayInputStream; import java.io.InputStream; import java.nio.charset.StandardCharsets; import java.security.SecureRandom; import java.security.cert.CertificateException; import java.security.cert.X509Certificate; import javax.net.ssl.HostnameVerifier; import javax.net.ssl.HttpsURLConnection; import javax.net.ssl.SSLContext; import javax.net.ssl.SSLSession; import javax.net.ssl.TrustManager; import javax.net.ssl.X509TrustManager; import javax.ws.rs.client.Entity; import javax.ws.rs.core.MediaType; import com.fasterxml.jackson.databind.ObjectMapper; import org.secureauth.sarestapi.data.*; import org.secureauth.sarestapi.util.JSONUtil; import org.slf4j.Logger; import org.slf4j.LoggerFactory; //Jersey 2 Libs import javax.ws.rs.client.Client; import javax.ws.rs.client.ClientBuilder; import javax.ws.rs.client.WebTarget; import org.glassfish.jersey.client.ClientConfig; import javax.ws.rs.core.Response; import javax.xml.bind.JAXBContext; public class SAExecuter { private ClientConfig config = null; private Client client=null; private static Logger logger=LoggerFactory.getLogger(SAExecuter.class); //Set up our Connection private void createConnection() throws Exception{ config = new ClientConfig(); TrustManager[] certs = new TrustManager[]{ new X509TrustManager(){ @Override public X509Certificate[] getAcceptedIssuers(){ return null; } @Override public void checkServerTrusted(X509Certificate[] chain, String authType) throws CertificateException {} @Override public void checkClientTrusted(X509Certificate[] chain, String authType) throws CertificateException{} } }; SSLContext ctx = null; try{ ctx = SSLContext.getInstance("TLS"); ctx.init(null, certs, new SecureRandom()); }catch(java.security.GeneralSecurityException ex){ logger.error(new StringBuilder().append("Exception occurred while attempting to setup SSL security. ").toString(), ex); } HttpsURLConnection.setDefaultSSLSocketFactory(ctx.getSocketFactory()); try{ client = ClientBuilder.newBuilder() .sslContext(ctx) .hostnameVerifier( new HostnameVerifier(){ @Override public boolean verify(String hostname, SSLSession session){return true;} } ) .build(); }catch(Exception e){ logger.error(new StringBuilder().append("Exception occurred while attempting to associating our SSL cert to the session.").toString(), e); } try{ client = ClientBuilder.newClient(config); }catch(Exception e){ StringBuilder bud = new StringBuilder(); for(StackTraceElement st: e.getStackTrace()){ bud.append(st.toString()).append("\n"); } throw new Exception(new StringBuilder().append("Exception occurred while attempting to create connection object. Exception: ") .append(e.getMessage()).append("\nStackTraceElements:\n").append(bud.toString()).toString()); } if(client == null) throw new Exception(new StringBuilder().append("Unable to create connection object, creation attempt returned NULL.").toString()); } //Get Factors for the user requested public <T> T executeGetRequest(String auth, String query,String ts, Class<T> valueType)throws Exception { if(client == null) { createConnection(); } WebTarget target = null; Response response = null; T genericResponse =null; try{ target = client.target(query); response = target.request(). accept(MediaType.APPLICATION_JSON). header("Authorization", auth). header("X-SA-Date", ts). get(); genericResponse = response.readEntity(valueType); }catch(Exception e){ logger.error(new StringBuilder().append("Exception getting User Factors: \nQuery:\n\t") .append(query).append("\nError:").append(e.getMessage()).append(".\nResponse code is ").append(response.getStatus()).toString(), e); } response.close(); return genericResponse; } //Validate User against Repository public ResponseObject executeValidateUser(String header,String query, AuthRequest authRequest,String ts)throws Exception{ if(client == null) { createConnection(); } WebTarget target = null; Response response = null; ResponseObject responseObject =null; try{ target = client.target(query); response = target.request(). accept(MediaType.APPLICATION_JSON). header("Authorization", header). header("X-SA-Date", ts). post(Entity.entity(JSONUtil.getJSONStringFromObject(authRequest),MediaType.APPLICATION_JSON)); responseObject = response.readEntity(ResponseObject.class); }catch(Exception e){ logger.error(new StringBuilder().append("Exception Validating User: \nQuery:\n\t") .append(query).append("\nError: \n\t").append((String) response.readEntity(String.class)).append(".\nResponse code is ").append(response.getStatus()).toString(), e); } response.close(); return responseObject; } //Validate Users Password public ResponseObject executeValidateUserPassword(String auth,String query, AuthRequest authRequest,String ts)throws Exception{ if(client == null) { createConnection(); } WebTarget target = null; Response response = null; ResponseObject responseObject =null; try{ target = client.target(query); response = target.request(). accept(MediaType.APPLICATION_JSON). header("Authorization", auth). header("X-SA-Date", ts). post(Entity.entity(JSONUtil.getJSONStringFromObject(authRequest), MediaType.APPLICATION_JSON)); responseObject=response.readEntity(ResponseObject.class); }catch(Exception e){ logger.error(new StringBuilder().append("Exception Validating User Password: \nQuery:\n\t") .append(query).append("\nError:").append(e.getMessage()).append(".\nResponse code is ").append(response.getStatus()).toString(), e); } response.close(); return responseObject; } //Validate Users Pin public ResponseObject executeValidateUserPin(String auth,String query, AuthRequest authRequest,String ts)throws Exception{ if(client == null) { createConnection(); } WebTarget target = null; Response response = null; ResponseObject responseObject =null; try{ target = client.target(query); response = target.request(). accept(MediaType.APPLICATION_JSON). header("Authorization", auth). header("X-SA-Date", ts). post(Entity.entity(JSONUtil.getJSONStringFromObject(authRequest), MediaType.APPLICATION_JSON)); responseObject=response.readEntity(ResponseObject.class); }catch(Exception e){ logger.error(new StringBuilder().append("Exception Validating User Password: \nQuery:\n\t") .append(query).append("\nError:").append(e.getMessage()).append(".\nResponse code is ").append(response.getStatus()).toString(), e); } response.close(); return responseObject; } //Validate Users KBA public ResponseObject executeValidateKba(String auth,String query, AuthRequest authRequest, String ts)throws Exception{ if(client == null) { createConnection(); } WebTarget target = null; Response response = null; ResponseObject responseObject =null; try{ target = client.target(query); response = target.request(). accept(MediaType.APPLICATION_JSON). header("Authorization", auth). header("X-SA-Date", ts). post(Entity.entity(JSONUtil.getJSONStringFromObject(authRequest), MediaType.APPLICATION_JSON)); responseObject=response.readEntity(ResponseObject.class); }catch(Exception e){ logger.error(new StringBuilder().append("Exception Validating KBA: \nQuery:\n\t") .append(query).append("\nError:").append(e.getMessage()).append(".\nResponse code is ").append(response.getStatus()).toString(), e); } response.close(); return responseObject; } //Validate User Oath Token public ResponseObject executeValidateOath(String auth,String query, AuthRequest authRequest, String ts)throws Exception{ if(client == null) { createConnection(); } WebTarget target = null; Response response = null; ResponseObject responseObject =null; try{ target = client.target(query); response = target.request() .accept(MediaType.APPLICATION_JSON). header("Authorization", auth). header("X-SA-Date", ts). post(Entity.entity(JSONUtil.getJSONStringFromObject(authRequest), MediaType.APPLICATION_JSON)); responseObject=response.readEntity(ResponseObject.class); }catch(Exception e){ logger.error(new StringBuilder().append("Exception Validating OATH: \nQuery:\n\t") .append(query).append("\nError:").append(e.getMessage()).append(".\nResponse code is ").append(response.getStatus()).toString(), e); } response.close(); return responseObject; } //Validate OTP By Phone public ResponseObject executeOTPByPhone(String auth,String query, AuthRequest authRequest, String ts)throws Exception{ if(client == null) { createConnection(); } WebTarget target = null; Response response = null; ResponseObject responseObject =null; try{ target = client.target(query); response = target.request(). accept(MediaType.APPLICATION_JSON). //type(MediaType.APPLICATION_JSON). header("Authorization", auth). header("X-SA-Date", ts). post(Entity.entity(JSONUtil.getJSONStringFromObject(authRequest), MediaType.APPLICATION_JSON)); responseObject=response.readEntity(ResponseObject.class); }catch(Exception e){ logger.error(new StringBuilder().append("Exception Delivering OTP by Phone: \nQuery:\n\t") .append(query).append("\nError:").append(e.getMessage()).append(".\nResponse code is ").append(response.getStatus()).toString(), e); } response.close(); return responseObject; } //Validate User OATH by SMS public ResponseObject executeOTPBySMS(String auth,String query, AuthRequest authRequest,String ts)throws Exception{ if(client == null) { createConnection(); } WebTarget target = null; Response response = null; ResponseObject responseObject =null; try{ target = client.target(query); response = target.request() .accept(MediaType.APPLICATION_JSON). header("Authorization", auth). header("X-SA-Date", ts). post(Entity.entity(JSONUtil.getJSONStringFromObject(authRequest), MediaType.APPLICATION_JSON)); responseObject=response.readEntity(ResponseObject.class); }catch(Exception e){ logger.error(new StringBuilder().append("Exception Delivering OTP by SMS: \nQuery:\n\t") .append(query).append("\nError:").append(e.getMessage()).append(".\nResponse code is ").append(response.getStatus()).toString(), e); } response.close(); return responseObject; } //Validate User OTP by Email public ResponseObject executeOTPByEmail(String auth,String query, AuthRequest authRequest,String ts)throws Exception{ if(client == null) { createConnection(); } WebTarget target = null; Response response = null; ResponseObject responseObject =null; try{ target = client.target(query); response = target.request(). accept(MediaType.APPLICATION_JSON). header("Authorization", auth). header("X-SA-Date", ts). post(Entity.entity(JSONUtil.getJSONStringFromObject(authRequest), MediaType.APPLICATION_JSON)); responseObject=response.readEntity(ResponseObject.class); }catch(Exception e){ logger.error(new StringBuilder().append("Exception Delivering OTP by Email: \nQuery:\n\t") .append(query).append("\nError:").append(e.getMessage()).append(".\nResponse code is ").append(response.getStatus()).toString(), e); } response.close(); return responseObject; } // post request public <T> T executePostRequest(String auth,String query, AuthRequest authRequest,String ts, Class<T> valueType)throws Exception{ if(client == null) { createConnection(); } WebTarget target = null; Response response = null; T responseObject =null; try{ target = client.target(query); response = target.request(). accept(MediaType.APPLICATION_JSON). header("Authorization", auth). header("X-SA-Date", ts). post(Entity.entity(JSONUtil.getJSONStringFromObject(authRequest),MediaType.APPLICATION_JSON)); responseObject=response.readEntity(valueType); }catch(Exception e){ logger.error(new StringBuilder().append("Exception Delivering OTP by Push: \nQuery:\n\t") .append(query).append("\nError:").append(e.getMessage()).append(".\nResponse code is ").append(response.getStatus()).toString(), e); } response.close(); return responseObject; } //Validate User Token by Help Desk Call public ResponseObject executeOTPByHelpDesk(String auth,String query, AuthRequest authRequest, String ts)throws Exception{ if(client == null) { createConnection(); } WebTarget target = null; Response response = null; ResponseObject responseObject =null; try{ target = client.target(query); response = target.request(). accept(MediaType.APPLICATION_JSON). header("Authorization", auth). header("X-SA-Date", ts). post(Entity.entity(JSONUtil.getJSONStringFromObject(authRequest),MediaType.APPLICATION_JSON)); responseObject=response.readEntity(ResponseObject.class); }catch(Exception e){ logger.error(new StringBuilder().append("Exception Delivering OTP by HelpDesk: \nQuery:\n\t") .append(query).append("\nError:").append(e.getMessage()).append(".\nResponse code is ").append(response.getStatus()).toString(), e); } response.close(); return responseObject; } //Run IP Evaluation against user and IP Address public IPEval executeIPEval(String auth,String query, IPEvalRequest ipEvalRequest, String ts)throws Exception{ if(client == null) { createConnection(); } WebTarget target = null; Response response = null; String responseStr=null; IPEval ipEval =null; try{ target = client.target(query); response = target.request(). accept(MediaType.APPLICATION_JSON). header("Authorization", auth). header("X-SA-Date", ts). post(Entity.entity(JSONUtil.getJSONStringFromObject(ipEvalRequest), MediaType.APPLICATION_JSON)); ipEval = response.readEntity(IPEval.class); }catch(Exception e){ logger.error(new StringBuilder().append("Exception Running IP Evaluation: \nQuery:\n\t") .append(query).append("\nError:").append(e.getMessage()).append(".\nResponse code is ").append(response.getStatus()).toString(), e); } response.close(); return ipEval; } //Run AccessHistories Post public ResponseObject executeAccessHistory(String auth, String query, AccessHistoryRequest accessHistoryRequest, String ts)throws Exception{ if(client == null) { createConnection(); } WebTarget target = null; Response response = null; ResponseObject accessHistory =null; try{ target = client.target(query); response = target.request(). accept(MediaType.APPLICATION_JSON). header("Authorization", auth). header("X-SA-Date", ts). post(Entity.entity(JSONUtil.getJSONStringFromObject(accessHistoryRequest),MediaType.APPLICATION_JSON)); accessHistory = response.readEntity(ResponseObject.class); }catch(Exception e){ logger.error(new StringBuilder().append("Exception Running Access History POST: \nQuery:\n\t") .append(query).append("\nError:").append(e.getMessage()).append(".\nResponse code is ").append(response.getStatus()).toString(), e); } response.close(); return accessHistory; } // Run DFP Validate public DFPValidateResponse executeDFPValidate(String auth, String query, DFPValidateRequest dfpValidateRequest, String ts)throws Exception{ if(client == null) { createConnection(); } WebTarget target = null; Response response = null; DFPValidateResponse dfpValidateResponse =null; try{ target = client.target(query); response = target.request(). accept(MediaType.APPLICATION_JSON). header("Authorization", auth). header("X-SA-Date", ts). post(Entity.entity(JSONUtil.getJSONStringFromObject(dfpValidateRequest),MediaType.APPLICATION_JSON)); dfpValidateResponse = response.readEntity(DFPValidateResponse.class); }catch(Exception e){ logger.error(new StringBuilder().append("Exception Running Access History POST: \nQuery:\n\t") .append(query).append("\nError:").append(e.getMessage()).append(".\nResponse code is ").append(response.getStatus()).toString(), e); } response.close(); return dfpValidateResponse; } // Run DFP Confirm public DFPConfirmResponse executeDFPConfirm(String auth, String query, DFPConfirmRequest dfpConfirmRequest, String ts)throws Exception{ if(client == null) { createConnection(); } WebTarget target = null; Response response = null; String responseStr = null; DFPConfirmResponse dfpConfirmResponse =null; try{ target = client.target(query); response = target.request(). accept(MediaType.APPLICATION_JSON). header("Authorization", auth). header("X-SA-Date", ts). post(Entity.entity(JSONUtil.getJSONStringFromObject(dfpConfirmRequest),MediaType.APPLICATION_JSON)); dfpConfirmResponse = response.readEntity(DFPConfirmResponse.class); }catch(Exception e){ logger.error(new StringBuilder().append("Exception Running DFP Confirm POST: \nQuery:\n\t") .append(query).append("\nError:").append(e.getMessage()).append(".\nResponse code is ").append(response.getStatus()).toString(), e); } response.close(); return dfpConfirmResponse; } //Get Factors for the user requested public <T> T executeGetJSObject(String auth, String query,String ts, Class<T> valueType)throws Exception { if(client == null) { createConnection(); } WebTarget target = null; Response response = null; T jsObjectResponse =null; try{ target = client.target(query); response = target.request(). accept(MediaType.APPLICATION_JSON). header("Authorization", auth). header("X-SA-Date", ts). get(); jsObjectResponse= response.readEntity(valueType); }catch(Exception e){ logger.error(new StringBuilder().append("Exception getting JS Object SRC: \nQuery:\n\t") .append(query).append("\nError:").append(e.getMessage()).append(".\nResponse code is ").append(response.getStatus()).toString(), e); } response.close(); return jsObjectResponse; } }
package org.spongepowered.api.entity.hanging.art; /** * A utility class for getting available {@link Art} pieces. */ public class Arts { public static final Art KEBAB = null; public static final Art AZTEC = null; public static final Art ALBAN = null; public static final Art AZTEC_2 = null; public static final Art BOMB = null; public static final Art PLANT = null; public static final Art WASTELAND = null; public static final Art WANDERER = null; public static final Art GRAHAM = null; public static final Art POOL = null; public static final Art COURBET = null; public static final Art SUNSET = null; public static final Art SEA = null; public static final Art CREEBET = null; public static final Art MATCH = null; public static final Art BUST = null; public static final Art STAGE = null; public static final Art VOID = null; public static final Art SKULL_AND_ROSES = null; public static final Art WITHER = null; public static final Art FIGHTERS = null; public static final Art SKELETON = null; public static final Art DONKEY_KONG = null; public static final Art POINTER = null; public static final Art PIGSCENE = null; public static final Art BURNING_SKULL = null; private Arts() { } /** * Checks if this is a flowerpot. * * @return Whether this is a flowerpot */ public static boolean isFlowerPot() { return false; } }
package org.sports.websearch.contoller; import org.sports.websearch.model.Article; import org.springframework.http.ResponseEntity; import org.springframework.stereotype.Controller; import org.springframework.web.bind.annotation.RequestMapping; import org.springframework.web.bind.annotation.RequestMethod; import org.springframework.web.bind.annotation.RequestParam; import org.springframework.web.bind.annotation.ResponseBody; @Controller @RequestMapping("/solr") public class SolrController { @RequestMapping(value = "/{query}", method = RequestMethod.GET) public @ResponseBody ResponseEntity<Article> search( @RequestParam(value = "query", required = true) String query) { System.out.println(query); return null; } }
package org.telegram.telegrambots.api.objects; import com.fasterxml.jackson.annotation.JsonProperty; import com.fasterxml.jackson.core.JsonGenerator; import com.fasterxml.jackson.databind.SerializerProvider; import com.fasterxml.jackson.databind.jsontype.TypeSerializer; import org.json.JSONObject; import org.telegram.telegrambots.api.interfaces.IBotApiObject; import java.io.IOException; /** * @author Ruben Bermudez * @version 1.0 * @brief This object represents a sticker. * @date 20 of June of 2015 */ public class Sticker implements IBotApiObject { private static final String FILEID_FIELD = "file_id"; private static final String WIDTH_FIELD = "width"; private static final String HEIGHT_FIELD = "height"; private static final String THUMB_FIELD = "thumb"; private static final String FILESIZE_FIELD = "file_size"; @JsonProperty(FILEID_FIELD) private String fileId; ///< Unique identifier for this file @JsonProperty(WIDTH_FIELD) private Integer width; ///< Sticker width @JsonProperty(HEIGHT_FIELD) private Integer height; ///< Sticker height @JsonProperty(THUMB_FIELD) private PhotoSize thumb; ///< Optional. Sticker thumbnail in .webp or .jpg format @JsonProperty(FILESIZE_FIELD) private Integer fileSize; ///< Optional. File size public Sticker() { super(); } public Sticker(JSONObject jsonObject) { super(); this.fileId = jsonObject.getString(FILEID_FIELD); this.width = jsonObject.getInt(WIDTH_FIELD); this.height = jsonObject.getInt(HEIGHT_FIELD); if (jsonObject.has(THUMB_FIELD)) { this.thumb = new PhotoSize(jsonObject.getJSONObject(THUMB_FIELD)); } if (jsonObject.has(FILESIZE_FIELD)) { this.fileSize = jsonObject.getInt(FILESIZE_FIELD); } } public String getFileId() { return fileId; } public Integer getWidth() { return width; } public Integer getHeight() { return height; } public PhotoSize getThumb() { return thumb; } public Integer getFileSize() { return fileSize; } @Override public void serialize(JsonGenerator gen, SerializerProvider serializers) throws IOException { gen.writeStartObject(); gen.writeStringField(FILEID_FIELD, fileId); gen.writeNumberField(WIDTH_FIELD, width); gen.writeNumberField(HEIGHT_FIELD, height); if (thumb != null) { gen.writeObjectField(THUMB_FIELD, thumb); } if (fileSize != null) { gen.writeNumberField(FILESIZE_FIELD, fileSize); } gen.writeEndObject(); gen.flush(); } @Override public void serializeWithType(JsonGenerator gen, SerializerProvider serializers, TypeSerializer typeSer) throws IOException { serialize(gen, serializers); } @Override public String toString() { return "Sticker{" + "fileId='" + fileId + '\'' + ", width=" + width + ", height=" + height + ", thumb=" + thumb + ", fileSize=" + fileSize + '}'; } }
package org.tournier.minecraftregionmanager; import java.io.File; public class ChunkMark { // A chunk mark is defined by 4 items: private String worldName; private int x, z; private String chunkName; // Constructor public ChunkMark(String world, int cx, int cz, String name) { worldName = world; x = cx; z = cz; chunkName = name; } public String getWorldName() { return worldName; } public int getX() { return x; } public int getZ() { return z; } public String getChunkName() { return chunkName; } public File getFileName() { int rx = (int) Math.floor((double) x / 32); int rz = (int) Math.floor((double) z / 32); File f = new File("./" + worldName + "/r." + rx + "." + rz + ".mca"); return f; } public String printMark() { String s = worldName + ":" + x + "," + z + ":" + chunkName + " (blocks " + (x*16) + "," + (z*16) + " to " + ((x*16)+15) + "," + ((z*16)+15) + ")"; return s; } }
package org.vaadin.hackathonofthings.io; import java.io.FileWriter; import java.io.IOException; import java.io.Writer; import org.vaadin.hackathonofthings.data.DataEvent; import org.vaadin.hackathonofthings.data.DataSink; import org.vaadin.hackathonofthings.data.Topic; /** * Data store saving incoming (sinked) events to the disk and retrieving them * later for playback. Data retrieval is done based on the topic. */ public class FileDataStore extends AbstractFileDataSource implements DataSink { private Topic topic; private Writer writer; public FileDataStore(Topic topic) { super(topic); this.topic = topic; } public void replay() throws IOException { readFile(getFileName()); } protected String getFileName() { return topic.getId().replaceAll("[^a-zA-Z0-9_-]", "_"); } public void consumeData(DataEvent event) { if (event.getSender() == this) { return; } try { if (writer == null) { writer = new FileWriter(getFileName()); } // store an event StringBuilder line = new StringBuilder(); line.append(event.getTimestamp()).append(";"); for (int i = 0; i < event.getData().length; ++i) { line.append(event.getData()[i]); if (i < event.getData().length - 1) { line.append(";"); } else { line.append("\n"); } } writer.write(line.toString()); writer.flush(); } catch (IOException e) { throw new RuntimeException(e); } } @Override protected DataEvent convertLine(String line) { // convert read data back String[] parts = line.split(";"); if (parts.length > 1) { double[] data = new double[parts.length - 1]; long timestamp = Long.parseLong(parts[0]); for (int i = 0; i < parts.length - 2; ++i) { data[i] = Double.parseDouble(parts[i + 1]); } return new DataEvent(this, topic, timestamp, data); } return null; } public void close() throws IOException { if (writer != null) { writer.close(); } } }
package pixlepix.auracascade.gui; import net.minecraft.entity.player.EntityPlayer; import net.minecraft.entity.player.InventoryPlayer; import net.minecraft.inventory.Container; import net.minecraft.inventory.InventoryBasic; import net.minecraft.inventory.Slot; import net.minecraft.item.Item; import net.minecraft.item.ItemStack; import pixlepix.auracascade.block.tile.TileBookshelfCoordinator; import pixlepix.auracascade.block.tile.TileStorageBookshelf; import pixlepix.auracascade.data.StorageItemStack; import java.util.ArrayList; import java.util.Iterator; public class ContainerCoordinator extends Container { public float lastScroll; protected TileBookshelfCoordinator tileEntity; public ContainerCoordinator(InventoryPlayer inventoryPlayer, TileBookshelfCoordinator te) { tileEntity = te; for (int i = 0; i < 21; i++) { int x = i % 7; int y = i / 7; addSlotToContainer(new SlotCoordinator(i, 8 + x * 20, 17 + y * 18, te, null)); } bindPlayerInventory(inventoryPlayer); scrollTo(0); } @Override public boolean canInteractWith(EntityPlayer player) { return tileEntity.isUseableByPlayer(player); } protected void bindPlayerInventory(InventoryPlayer inventoryPlayer) { int ys = 84; int xs = 8; for (int x = 0; x < 3; ++x) { for (int y = 0; y < 9; ++y) { addSlotToContainer(new Slot(inventoryPlayer, y + x * 9 + 9, xs + y * 18, ys + x * 18)); } } for (int x = 0; x < 9; ++x) { addSlotToContainer(new Slot(inventoryPlayer, x, xs + x * 18, ys + 58)); } } @Override public ItemStack transferStackInSlot(EntityPlayer player, int slot) { ItemStack stack = null; Slot slotObject = (Slot) inventorySlots.get(slot); //null checks and checks if the item can be stacked (maxStackSize > 1) if (slotObject != null && slotObject.getHasStack()) { stack = slotObject.getStack(); ItemStack stackLeftover; //merges the item into player inventory since its in the tileEntity if (slot < 21) { StorageItemStack storageItemStack = ((SlotCoordinator) inventorySlots.get(slot)).storage; storageItemStack.stackSize = 64; stackLeftover = takeFromInventory(storageItemStack); if (stackLeftover != null) { this.mergeItemStack(stackLeftover, 21, 21 + 36, true); } update(); slotObject.onSlotChange(stack, slotObject.getStack()); return null; } //places it into the tileEntity is possible since its in the player inventory else { ItemStack stackToTransfer = slotObject.getStack(); stackLeftover = putIntoInventory(new StorageItemStack(stackToTransfer)); if (stackLeftover != null && stackLeftover.stackSize == stackToTransfer.stackSize) { return null; } slotObject.putStack(stackLeftover); slotObject.onSlotChange(stack, stackLeftover); } } update(); return stack; } public void update() { scrollTo(lastScroll); } public void scrollTo(float scroll) { this.lastScroll = scroll; ArrayList<StorageItemStack> stacks = tileEntity.getAbstractInventory(); int i = stacks.size() / 7 - 2; int j = (int) ((double) (scroll * (float) i) + 0.5D); if (j < 0) { j = 0; } for (int k = 0; k < 3; ++k) { for (int l = 0; l < 7; ++l) { int i1 = l + (k + j) * 7; if (i1 >= 0 && i1 < stacks.size()) { ((SlotCoordinator) this.getSlot(l + k * 7)).storage = stacks.get(i1); } else { ((SlotCoordinator) this.getSlot(l + k * 7)).storage = null; } } } } public ItemStack takeFromInventory(StorageItemStack lost) { int amount = 0; outer: for (TileStorageBookshelf bookshelf : tileEntity.getBookshelves()) { for (int i = 0; i < bookshelf.getSizeInventory(); i++) { ItemStack stackInShelf = bookshelf.getStackInSlot(i); if (stackInShelf != null && new StorageItemStack(stackInShelf).equalsType(lost)) { int delta = Math.min(lost.stackSize - amount, stackInShelf.stackSize); amount += delta; stackInShelf.stackSize -= delta; if (stackInShelf.stackSize == 0) { bookshelf.setInventorySlotContents(i, null); } bookshelf.markDirty(); if (lost.stackSize <= 0) { break outer; } } } } lost.stackSize = amount; return lost.stackSize != 0 ? lost.toItemStack() : null; } public ItemStack putIntoInventory(StorageItemStack gained) { int amount = gained.stackSize; if (amount != 0) { outer: for (TileStorageBookshelf bookshelf : tileEntity.getBookshelves()) { for (int i = 0; i < bookshelf.getSizeInventory(); i++) { ItemStack stackInShelf = bookshelf.getStackInSlot(i); ItemStack testStack = null; if (stackInShelf != null && new StorageItemStack(stackInShelf).equalsType(gained)) { testStack = stackInShelf.copy(); } if (stackInShelf == null) { testStack = gained.toItemStack(); testStack.stackSize = 0; } if (testStack != null) { ItemStack nextTestStack = testStack.copy(); nextTestStack.stackSize++; while (amount > 0 && bookshelf.isItemValidForSlotSensitive(i, nextTestStack) && nextTestStack.stackSize < testStack.getMaxStackSize()) { testStack = nextTestStack.copy(); nextTestStack.stackSize++; amount } if (testStack.stackSize > 0) { bookshelf.setInventorySlotContents(i, testStack); } if (gained.stackSize <= 0) { break outer; } } } } } StorageItemStack result = gained.copy(); result.stackSize = amount; return result.toItemStack(); } @Override public ItemStack slotClick(int slot, int clickedButton, int mode, EntityPlayer player) { ItemStack itemstack = null; if (player.inventory.getItemStack() != null && slot == -999 && (clickedButton == 0 || clickedButton == 1) && (mode == 0 || mode == 1)) { if (clickedButton == 0) { player.dropPlayerItemWithRandomChoice(player.inventory.getItemStack(), true); player.inventory.setItemStack((ItemStack) null); } if (clickedButton == 1) { player.dropPlayerItemWithRandomChoice(player.inventory.getItemStack().splitStack(1), true); if (player.inventory.getItemStack().stackSize == 0) { player.inventory.setItemStack((ItemStack) null); } } } else if (slot >= 0 && inventorySlots.get(slot) instanceof SlotCoordinator && mode != 1) { if ((clickedButton == 0 || clickedButton == 1) && mode == 0) { StorageItemStack target = ((SlotCoordinator) inventorySlots.get(slot)).storage; if (target != null && player.inventory.getItemStack() == null) { target = target.copy(); target.stackSize = clickedButton == 0 ? 64 : 32; ItemStack result = takeFromInventory(target); player.inventory.setItemStack(result); ((SlotCoordinator) inventorySlots.get(slot)).onPickupFromSlot(player, result); update(); } else if (player.inventory.getItemStack() != null) { ItemStack placedStack = player.inventory.getItemStack().copy(); int reservedItems = 0; if (clickedButton == 1) { reservedItems = placedStack.stackSize - 1; placedStack.stackSize = 1; } ItemStack leftovers = putIntoInventory(new StorageItemStack(placedStack)); if (leftovers != null) { leftovers.stackSize += reservedItems; } else if (reservedItems > 0) { leftovers = placedStack.copy(); leftovers.stackSize = reservedItems; } player.inventory.setItemStack(leftovers); update(); } } } else if (mode == 1) { if (slot < 0) { return null; } Slot slot2 = (Slot) this.inventorySlots.get(slot); if (slot2 != null && slot2.canTakeStack(player)) { ItemStack itemstack3 = this.transferStackInSlot(player, slot); if (itemstack3 != null) { Item item = itemstack3.getItem(); itemstack = itemstack3.copy(); if (slot2.getStack() != null && slot2.getStack().getItem() == item) { this.retrySlotClick(slot, clickedButton, true, player); } } } } else { if (slot < 0) { return null; } Slot slot2 = (Slot) this.inventorySlots.get(slot); if (slot2 != null) { ItemStack stackInSlot = slot2.getStack(); ItemStack stackInPlayer = player.inventory.getItemStack(); ItemStack stackPickedUp = null; int l1 = 0; if (stackInSlot != null) { itemstack = stackInSlot.copy(); } if (stackInSlot == null) { if (stackInPlayer != null && slot2.isItemValid(stackInPlayer)) { l1 = clickedButton == 0 ? stackInPlayer.stackSize : 1; if (l1 > slot2.getSlotStackLimit()) { l1 = slot2.getSlotStackLimit(); } if (stackInPlayer.stackSize >= l1) { slot2.putStack(stackInPlayer.splitStack(l1)); } if (stackInPlayer.stackSize == 0) { player.inventory.setItemStack((ItemStack) null); } } } else if (slot2.canTakeStack(player)) { if (stackInPlayer == null) { l1 = clickedButton == 0 ? stackInSlot.stackSize : (stackInSlot.stackSize + 1) / 2; stackPickedUp = slot2.decrStackSize(l1); player.inventory.setItemStack(stackPickedUp); if (stackInSlot.stackSize == 0) { slot2.putStack((ItemStack) null); } slot2.onPickupFromSlot(player, player.inventory.getItemStack()); } else if (slot2.isItemValid(stackInPlayer)) { if (stackInSlot.getItem() == stackInPlayer.getItem() && stackInSlot.getItemDamage() == stackInPlayer.getItemDamage() && ItemStack.areItemStackTagsEqual(stackInPlayer, stackInSlot)) { l1 = clickedButton == 0 ? stackInPlayer.stackSize : 1; if (l1 > slot2.getSlotStackLimit() - stackInSlot.stackSize) { l1 = slot2.getSlotStackLimit() - stackInSlot.stackSize; } if (l1 > stackInPlayer.getMaxStackSize() - stackInSlot.stackSize) { l1 = stackInPlayer.getMaxStackSize() - stackInSlot.stackSize; } stackInPlayer.splitStack(l1); if (stackInPlayer.stackSize == 0) { player.inventory.setItemStack((ItemStack) null); } stackInSlot.stackSize += l1; } else if (stackInPlayer.stackSize <= slot2.getSlotStackLimit()) { slot2.putStack(stackInPlayer); player.inventory.setItemStack(stackInSlot); } } else if (stackInSlot.getItem() == stackInPlayer.getItem() && stackInPlayer.getMaxStackSize() > 1 && (!stackInSlot.getHasSubtypes() || stackInSlot.getItemDamage() == stackInPlayer.getItemDamage()) && ItemStack.areItemStackTagsEqual(stackInSlot, stackInPlayer)) { l1 = stackInSlot.stackSize; if (l1 > 0 && l1 + stackInPlayer.stackSize <= stackInPlayer.getMaxStackSize()) { stackInPlayer.stackSize += l1; stackInSlot = slot2.decrStackSize(l1); if (stackInSlot.stackSize == 0) { slot2.putStack((ItemStack) null); } slot2.onPickupFromSlot(player, player.inventory.getItemStack()); } } } slot2.onSlotChanged(); } } return itemstack; } }
package ptrman.visualizationTests; import org.apache.commons.math3.linear.ArrayRealVector; import org.eclipse.collections.api.tuple.primitive.IntIntPair; import processing.core.PApplet; import ptrman.Datastructures.Bb; import ptrman.Datastructures.IMap2d; import ptrman.Datastructures.Map2d; import ptrman.bpsolver.Solver2; import ptrman.levels.retina.*; import ptrman.levels.retina.helper.ProcessConnector; import ptrman.misc.Classifier; import java.io.IOException; import java.net.*; import java.util.*; /** * encapsulates functionality to draw visualizations for showcase and debugging */ public class VisualizationDrawer { public boolean drawVisualizationOfAltitude = true; public boolean drawVisualizationOfEndoSceletons = false; // do we visualize all samples of endo/exo -sceleton public boolean drawVisualizationOfLineDetectors = false; public boolean drawVisualizationOfLineDetectorsEnableAct = true; // do we draw activation of line detectors? public boolean drawVisualizationOfEdgeLineDetectors = false; public boolean drawVisualizationOfTex = true; // draw visualization of texture public void drawDetectors(Solver2 solver, PApplet applet) { if(drawVisualizationOfAltitude) { for (ProcessA.Sample iSample : solver.connectorSamplesForEndosceleton.out) { float color = Math.min((float)iSample.altitude / 20.0f, 1.0f); applet.stroke(color*255.0f); applet.rect((float)iSample.position.getOne(), (float)iSample.position.getTwo(), 1, 1); } } if(drawVisualizationOfEndoSceletons) { applet.stroke(200.0f, 255.0f, 200.0f); for (ProcessA.Sample s : solver.connectorSamplesForEndosceleton.out) { if (s.type == ProcessA.Sample.EnumType.ENDOSCELETON) { IntIntPair p = s.position; applet.rect(p.getOne(), p.getTwo(), 1, 1); } } } if(drawVisualizationOfEdgeLineDetectors) { // draw visualization of line detectors for (ProcessD iProcessDEdge : solver.processDEdge) { for(LineDetectorWithMultiplePoints iLineDetector : iProcessDEdge.annealedCandidates) { // iLineDetector.cachedSamplePositions applet.stroke(128.0f, 128, 255); for (RetinaPrimitive iLine : iProcessDEdge.splitDetectorIntoLines(iLineDetector)) { double x0 = iLine.line.a.getDataRef()[0]; double y0 = iLine.line.a.getDataRef()[1]; double x1 = iLine.line.b.getDataRef()[0]; double y1 = iLine.line.b.getDataRef()[1]; applet.line((float)x0, (float)y0, (float)x1, (float)y1); } if (true) { applet.stroke(255.0f, 0.0f, 0.0f); for( ProcessA.Sample iSample : iLineDetector.samples) { applet.rect((float)iSample.position.getOne(), (float)iSample.position.getTwo(), 1, 1); } } } } int here = 5; } if(drawVisualizationOfLineDetectors) { // draw visualization of line detectors for(LineDetectorWithMultiplePoints iLineDetector : solver.processD.annealedCandidates) { // iLineDetector.cachedSamplePositions float act = drawVisualizationOfLineDetectorsEnableAct ? (float)iLineDetector.calcActivation() : 1.0f; applet.stroke(act*255.0f, act*255.0f, act*255.0f); for (RetinaPrimitive iLine : solver.processD.splitDetectorIntoLines(iLineDetector)) { double x0 = iLine.line.a.getDataRef()[0]; double y0 = iLine.line.a.getDataRef()[1]; double x1 = iLine.line.b.getDataRef()[0]; double y1 = iLine.line.b.getDataRef()[1]; applet.line((float)x0, (float)y0, (float)x1, (float)y1); } applet.stroke(255.0f, 0.0f, 0.0f); for( ProcessA.Sample iSample : iLineDetector.samples) { applet.rect((float)iSample.position.getOne(), (float)iSample.position.getTwo(), 1, 1); } } int here = 5; } if (drawVisualizationOfTex) { // visualize texture points for(TexPoint iTex : solver.processFi.outputSampleConnector.out) { applet.stroke(255.0f, 0.0f, 255.0f); applet.rect(iTex.x, iTex.y, 1, 1); } } } // used to transfer narsese relationships public static List<String> relN = new ArrayList<>(); public void drawPrimitives(Solver2 solver, PApplet applet, Classifier classifier) { // * draw primitives for edges for (ProcessConnector<RetinaPrimitive> iCntr : solver.connectorDetectorsFromProcessHForEdge) { for(RetinaPrimitive iLinePrimitive : iCntr.out) { applet.stroke(0.0f, 255.0f, 0.0f); double[] aa = iLinePrimitive.line.a.getDataRef(); double x0 = aa[0]; double y0 = aa[1]; double[] bb = iLinePrimitive.line.b.getDataRef(); double x1 = bb[0]; double y1 = bb[1]; applet.line((float)x0, (float)y0, (float)x1, (float)y1); } } { // iterate over line detectors of processD for edges ArrayList<Bb> allBbs = new ArrayList<>(); // BB's of all edge filters for (ProcessD iProcessDEdge : solver.processDEdge) { for(LineDetectorWithMultiplePoints iLineDetector : iProcessDEdge.annealedCandidates) { // iLineDetector.cachedSamplePositions float act = drawVisualizationOfLineDetectorsEnableAct ? (float)iLineDetector.calcActivation() : 1.0f; applet.stroke(act*255.0f, act*255.0f, act*255.0f); for (RetinaPrimitive iLine : solver.processD.splitDetectorIntoLines(iLineDetector)) { double x0 = iLine.line.a.getDataRef()[0]; double y0 = iLine.line.a.getDataRef()[1]; double x1 = iLine.line.b.getDataRef()[0]; double y1 = iLine.line.b.getDataRef()[1]; applet.line((float)x0, (float)y0, (float)x1, (float)y1); } applet.stroke(255.0f, 0.0f, 0.0f); for( ProcessA.Sample iSample : iLineDetector.samples) { applet.rect((float)iSample.position.getOne(), (float)iSample.position.getTwo(), 1, 1); } } // bounding box logic // we try to group points to bounding boxes for each edge detector direction ArrayList<Bb> bbs = new ArrayList<>(); { for(int idx=0;idx<solver.connectorSamplesFromProcessAForEdge.length;idx++) { for(ProcessA.Sample iSample : solver.connectorSamplesFromProcessAForEdge[idx].out) { boolean found = false; // found bb to add to? for(Bb iBb : bbs) { if (Bb.inRange(iBb, iSample.position.getOne(), iSample.position.getTwo(), 4.0)) { // in at boundary f bb or inside? iBb.add(iSample.position.getOne(), iSample.position.getTwo()); found = true; } } if (!found) { Bb bb = new Bb(); bb.add(iSample.position.getOne(), iSample.position.getTwo()); bbs.add(bb); } } } } // visualize BB's if(false) { applet.stroke(255.0f, 255.0f, 0.0f); applet.fill(0, 1.0f); for(Bb iBB : bbs) { applet.rect((int)iBB.minx, (int) iBB.miny, (int)(iBB.maxx-iBB.minx), (int)(iBB.maxy-iBB.miny)); } } // transfer bbs to all allBbs.addAll(bbs); } // merge BB's for(int idx0=0; idx0 < allBbs.size();) { for(int idx1=idx0+1; idx1 < allBbs.size(); idx1++) { if (Bb.checkOverlap(allBbs.get(idx0), allBbs.get(idx1))) { allBbs.set(idx0, Bb.merge(allBbs.get(idx0), allBbs.get(idx1))); allBbs.remove(idx1); // restart idx0 = -1; break; } } idx0++; } // visualize merged BB's applet.stroke(0.0f, 255.0f, 0.0f); applet.fill(0, 1.0f); for(Bb iBB : allBbs) { applet.rect((int)iBB.minx, (int) iBB.miny, (int)(iBB.maxx-iBB.minx), (int)(iBB.maxy-iBB.miny)); } List<Classification> classifications = new ArrayList<>(); if (classifier != null) { // is classification enabled? // PREPARATION FOR CLASIFIERS // prepare maps as targets to draw "quantized" line detectors IMap2d<Boolean>[] edgeMaps = new IMap2d[solver.processDEdge.length]; for(int idx=0;idx<solver.processDEdge.length;idx++) { edgeMaps[idx] = new Map2d<>(solver.mapBoolean.getWidth(), solver.mapBoolean.getLength()); for(int ix=0;ix<edgeMaps[idx].getWidth();ix++) { for(int iy=0;iy<edgeMaps[idx].getLength();iy++) { edgeMaps[idx].setAt(ix,iy,false); } } } // draw "quantized" line detectors as dots to get them back to a image representation for(int idx=0;idx<solver.connectorSamplesFromProcessAForEdge.length;idx++) { IMap2d<Boolean> selmap = edgeMaps[idx]; for(ProcessA.Sample iSample : solver.connectorSamplesFromProcessAForEdge[idx].out) { int x = iSample.position.getOne(); int y = iSample.position.getTwo(); selmap.setAt(x, y, true); selmap.setAt(x+1, y, true); selmap.setAt(x, y+1, true); selmap.setAt(x+1, y+1, true); } } // ACTUAL CLASSIFICATION boolean verbose = false; if(verbose) System.out.println("FRAME"); for(Bb iBB : allBbs) { float centerX = (float)(iBB.maxx+iBB.minx)/2.0f; float centerY = (float)(iBB.maxy+iBB.miny)/2.0f; // simulate convolution by finding best classification in proximity ArrayRealVector stimulus = cropEdgeMapsAndConcatToVecAt(edgeMaps, (int)centerX, (int)centerY, 32, 32); // extract cropped image classifier.classify(stimulus, false); int bestCenterX = (int)centerX; int bestCenterY = (int)centerY; float bestSimilarity = classifier.bestCategorySimilarity; int convRange = 3; // range of convolution - in + - dimension for(int dx=-convRange;dx<convRange;dx++) { for(int dy=-convRange;dy<convRange;dy++) { int thisCenterX = (int)centerX+dx; int thisCenterY = (int)centerY+dy; ArrayRealVector stimulus2 = cropEdgeMapsAndConcatToVecAt(edgeMaps, (int)centerX, (int)centerY, 32, 32); // extract cropped image classifier.classify(stimulus2, false); float thisSim = classifier.bestCategorySimilarity; if (thisSim > bestSimilarity) { bestSimilarity = thisSim; bestCenterX = thisCenterX; bestCenterY = thisCenterY; } } } // * extract cropped image // DEBUG CLASSIFICATION RECT applet.stroke(255.0f, 255.0f, 255.0f); applet.fill(0, 1.0f); applet.rect( (int)bestCenterX-32/2, (int)bestCenterY-32/2, 32, 32); // * classify stimulus = cropEdgeMapsAndConcatToVecAt(edgeMaps, (int)bestCenterX, (int)bestCenterY, 32, 32); // extract cropped image long categoryId = classifier.classify(stimulus, true); float thisClassificationSim = classifier.bestCategorySimilarity; classifications.add(new Classification(bestCenterX, bestCenterY, categoryId)); // store classification for later processing // * draw classification (for debugging) applet.fill(255); applet.text("c="+categoryId, bestCenterX-32/2, bestCenterY-32/2); } if(verbose) System.out.println("FRAME END"); } // TODO< group by class and send relations by element with lowest count of class! > Map<Long, ArrayList<Classification>> classificationsByCategory = new HashMap<>(); for(Classification iClasfcn: classifications) { if(classificationsByCategory.containsKey(iClasfcn.category)) { classificationsByCategory.get(iClasfcn.category).add(iClasfcn); } else { ArrayList<Classification> arr = new ArrayList<>(); arr.add(iClasfcn); classificationsByCategory.put(iClasfcn.category, arr); } } // find classification with lowest number of items ArrayList<Classification> classificationCandidatesWithLowestMemberCount = null; for(Map.Entry<Long, ArrayList<Classification>> i : classificationsByCategory.entrySet()) { if (classificationCandidatesWithLowestMemberCount == null) { // is first one? classificationCandidatesWithLowestMemberCount = i.getValue(); } else if(i.getValue().size() < classificationCandidatesWithLowestMemberCount.size()) { classificationCandidatesWithLowestMemberCount = i.getValue(); } } // send to NAR //< it seems like NAR can get overwhelmed, so we don't send every time if ((solver.t % 2) == 0) { relN.clear(); HashMap<String, Boolean> relByNarsese = new HashMap<>(); // we want to reduce the amount of spam to NARS by omitting redudant events (all happens in the same frame anyways) // build relations between classifications with low count with classifications of high count if (classificationCandidatesWithLowestMemberCount != null) { for(Classification iClassfcnWithLowestCount : classificationCandidatesWithLowestMemberCount) { for(Classification iClasfcnOther: classifications) { if (iClassfcnWithLowestCount != iClasfcnOther) { // must be different objects if (iClassfcnWithLowestCount.category != iClasfcnOther.category) { // we are only interested in different classifications! String relY; String relX; { // compute relationship term relY = "c"; relX = "c"; double diffX = iClassfcnWithLowestCount.posX-iClasfcnOther.posX; double diffY = iClassfcnWithLowestCount.posY-iClasfcnOther.posY; if (diffY < -15.0) { relY = "b"; // below } if (diffY > 15.0) { relY = "a"; // above } if (diffX < -15.0) { relX = "b"; // below } if (diffX > 15.0) { relX = "a"; // above } } // scalable way// String n = "< ( {"+(relY)+"} * < ( {"+iClassfcnWithLowestCount.category+"} * {"+iClasfcnOther.category+"} ) --> h > ) --> relY >. :|:"; // not scalable way, will xplode for more complicated scenes String n = "< ( {"+(relY)+"} * {"+iClassfcnWithLowestCount.category+"D"+iClasfcnOther.category+"} ) --> relY >. :|:"; relByNarsese.put(n, true); // store in set n = "< ( {"+(relX)+"} * {"+iClassfcnWithLowestCount.category+"D"+iClasfcnOther.category+"} ) --> relX >. :|:"; relByNarsese.put(n, true); // store in set } } } } } for(String iN : relByNarsese.keySet()) { relN.add(iN); } // HACK< sort BB's by x axis > Collections.sort(allBbs, (a, b) -> (a.minx == b.minx) ? 0 : ((a.minx > b.minx) ? 1 : -1)); // HACK< we should send it normally over NarsBinding > // build relations to center if (allBbs.size() >= 2) { Bb centerBb = allBbs.get(0); for(int idx=1;idx<allBbs.size();idx++) { Bb otherBb = allBbs.get(idx); if (otherBb.minx < 20.0) { continue; // HACK for pong, ignore it because we else get BS relations } String relY = "c"; double diffY = centerBb.miny-otherBb.miny; double diffX = centerBb.minx-otherBb.minx; if (diffY < -15.0) { relY = "b"; // below } if (diffY > 15.0) { relY = "a"; // above } break; // we only care about first relation } } } } // * draw primitives for endoskeleton for(RetinaPrimitive iLinePrimitive : solver.cntrFinalProcessing.out) { applet.stroke(255.0f, 255.0f, 255.0f); double x0 = iLinePrimitive.line.a.getDataRef()[0]; double y0 = iLinePrimitive.line.a.getDataRef()[1]; double x1 = iLinePrimitive.line.b.getDataRef()[0]; double y1 = iLinePrimitive.line.b.getDataRef()[1]; applet.line((float)x0, (float)y0, (float)x1, (float)y1); // draw intersections as small triangles applet.stroke(255.0f, 0.0f, 0.0f); for (Intersection iIntersection : iLinePrimitive.line.intersections) { int x = (int)iIntersection.intersectionPosition.getDataRef()[0]; int y = (int)iIntersection.intersectionPosition.getDataRef()[1]; applet.line(x,y-1,x-1,y+1); applet.line(x,y-1,x+1,y+1); applet.line(x-1,y+1,x+1,y+1); } } } // helper // reads crops from edge maps and concatenate it all to a single vector for classification static ArrayRealVector cropEdgeMapsAndConcatToVecAt(IMap2d<Boolean>[] edgeMaps, int centerX, int centerY, int width, int height) { ArrayRealVector dest = new ArrayRealVector(edgeMaps.length*width*height); int destIdx = 0; // index in dest for(IMap2d<Boolean> iEdgeMap : edgeMaps) { for(int ix=centerX-width/2;ix<centerX+width/2;ix++) { for(int iy=centerY-height/2;iy<centerY+height/2;iy++) { if (iEdgeMap.inBounds(ix, iy)) { boolean v = iEdgeMap.readAt(ix, iy); dest.setEntry(destIdx, v ? 1 : 0); } destIdx++; } } } return dest; } // helper static class Classification { public long category; public int posX; public int posY; public Classification(int posX, int posY, long category) { this.posX = posX; this.posY = posY; this.category = category; } } }
package roycurtis.jdiscordirc.managers; import net.dv8tion.jda.core.*; import net.dv8tion.jda.core.entities.Game; import net.dv8tion.jda.core.entities.Guild; import net.dv8tion.jda.core.entities.Member; import net.dv8tion.jda.core.entities.TextChannel; import net.dv8tion.jda.core.events.DisconnectEvent; import net.dv8tion.jda.core.events.ReadyEvent; import net.dv8tion.jda.core.events.ReconnectedEvent; import net.dv8tion.jda.core.events.ResumedEvent; import net.dv8tion.jda.core.events.guild.member.GuildMemberJoinEvent; import net.dv8tion.jda.core.events.guild.member.GuildMemberLeaveEvent; import net.dv8tion.jda.core.events.guild.member.GuildMemberNickChangeEvent; import net.dv8tion.jda.core.events.message.MessageReceivedEvent; import net.dv8tion.jda.core.hooks.ListenerAdapter; import net.dv8tion.jda.core.requests.CloseCode; import org.slf4j.Logger; import org.slf4j.LoggerFactory; import java.util.List; import java.util.regex.Matcher; import java.util.regex.Pattern; import static roycurtis.jdiscordirc.JDiscordIRC.BRIDGE; import static roycurtis.jdiscordirc.JDiscordIRC.CONFIG; public class DiscordManager extends ListenerAdapter { private static final Logger LOG = LoggerFactory.getLogger(DiscordManager.class); private static final Pattern MENTION = Pattern.compile("\\B@([\\S]+)\\b"); private JDA bot; private String token; private String guildId; private String channelId; private String url; //<editor-fold desc="Manager methods (main thread)"> public void init() throws Exception { LOG.info("Connecting for first time..."); token = CONFIG.get("discord.token"); guildId = CONFIG.get("discord.guild"); channelId = CONFIG.get("discord.channel"); url = CONFIG.get("discord.url"); bot = new JDABuilder(AccountType.BOT) .setAudioEnabled(false) .setToken(token) .addEventListener(this) .buildAsync(); } public boolean isAvailable() { if (bot == null) return false; else return bot.getStatus() == JDA.Status.CONNECTED; } public void sendMessage(String msg, Object... parts) { if ( !isAvailable() ) { LOG.debug("Rejecting message; Discord unavailable: {}", msg); return; } String fullMsg = String.format(msg, parts); LOG.info("Sent: {}", fullMsg); bot.getTextChannelById(channelId) .sendMessage(fullMsg) .complete(); } public void sendMessageWithMentions(String msg, Object... parts) { if ( !isAvailable() ) { LOG.debug("Rejecting message; Discord unavailable: {}", msg); return; } String fullMsg = String.format(msg, parts); Matcher matcher = MENTION.matcher(fullMsg); TextChannel channel = bot.getTextChannelById(channelId); Guild guild = bot.getGuildById(guildId); // Skip processing mentions if none seem to exist if ( !matcher.find() ) { LOG.info("Sent: {}", fullMsg); channel.sendMessage(fullMsg).complete(); return; } // Have to reset from above one-time use of find matcher.reset(); StringBuffer buffer = new StringBuffer(); // Iterate through any detected mentions and try to link to member while ( matcher.find() ) { String mention = matcher.group(1); List<Member> matches = guild.getMembersByEffectiveName(mention, true); // Skip if no matches, or ambiguous matches if (matches.size() < 1 || matches.size() > 1) continue; Member member = matches.get(0); // Skip if member is not actually in channel if ( !member.hasPermission(channel, Permission.MESSAGE_READ) ) continue; // Convert match into a real mention, add to string matcher.appendReplacement( buffer, member.getAsMention() ); } matcher.appendTail(buffer); fullMsg = buffer.toString(); LOG.info("Sent: {}", fullMsg); channel.sendMessage(fullMsg).complete(); } public String getUrl() { return url; } public void setStatus(OnlineStatus status, String game, String url) { bot.getPresence().setStatus(status); bot.getPresence().setGame( Game.of(game, url) ); } //</editor-fold> //<editor-fold desc="Bot event handlers (Discord thread)"> @Override public void onReady(ReadyEvent event) { LOG.info("Connected successfully"); BRIDGE.onDiscordConnect(); } @Override public void onReconnect(ReconnectedEvent event) { LOG.info("Reconnected"); BRIDGE.onDiscordConnect(); } @Override public void onResume(ResumedEvent event) { LOG.info("Reconnected"); BRIDGE.onDiscordConnect(); } @Override public void onDisconnect(DisconnectEvent event) { // Thanks to Minn for the following, for better disconnect explaination. // Cannot use event.getClientCloseFrame due to unknown issue with WebSocketFrame String why; CloseCode code = event.getCloseCode(); if (code != null) why = String.format( "%s: %s", code.getCode(), code.getMeaning() ); else why = event.isClosedByServer() ? "closed by server" : "closed by client"; LOG.warn("Lost connection ({}); reconnecting...", why); BRIDGE.onDiscordDisconnect(); } @Override public void onMessageReceived(MessageReceivedEvent event) { // Ignore own messages if ( event.getAuthor().equals( bot.getSelfUser() ) ) return; // Ignore messages from other channels if ( !event.getChannel().getId().contentEquals(channelId) ) return; LOG.trace( "Message from {} with {} attachment(s): {}", event.getMember().getEffectiveName(), event.getMessage().getAttachments().size(), event.getMessage().getStrippedContent() ); BRIDGE.onDiscordMessage(event); } @Override public void onGuildMemberJoin(GuildMemberJoinEvent event) { // Ignore from other servers if ( !event.getGuild().getId().contentEquals(guildId) ) return; LOG.trace( "{} joined the server", event.getMember().getEffectiveName() ); BRIDGE.onDiscordUserJoin(event); } @Override public void onGuildMemberLeave(GuildMemberLeaveEvent event) { // Ignore from other servers if ( !event.getGuild().getId().contentEquals(guildId) ) return; LOG.trace( "{} quit the server", event.getMember().getEffectiveName() ); BRIDGE.onDiscordUserLeave(event); } @Override public void onGuildMemberNickChange(GuildMemberNickChangeEvent event) { // Ignore from other servers if ( !event.getGuild().getId().contentEquals(guildId) ) return; String oldNick = event.getPrevNick(); String newNick = event.getNewNick(); // Adding or removing a nickname means one or the other is null if (oldNick == null) oldNick = event.getMember().getUser().getName(); if (newNick == null) newNick = event.getMember().getUser().getName(); LOG.trace("{} changed nick to {}", oldNick, newNick); BRIDGE.onDiscordNickChange(oldNick, newNick); } //</editor-fold> }
package gnu.xquery.testsuite; import gnu.expr.*; import kawa.*; import gnu.mapping.*; import gnu.xquery.lang.*; import gnu.text.*; public class TestMisc { static { XQuery.registerEnvironment(); } static Interpreter interp = Interpreter.getInterpreter(); static Environment env = Environment.getCurrent(); static int expectedPasses = 0; static int unexpectedPasses = 0; static int expectedFailures = 0; static int unexpectedFailures = 0; static boolean verbose = false; static String failureExpectedNext = null; public static void main(String[] args) { // gnu.expr.ModuleExp.dumpZipPrefix = "kawa-zip-dump-"; // gnu.expr.ModuleExp.debugPrintExpr = true; // Compilation.debugPrintFinalExpr = true; evalTest("3.5+1", "4.5"); evalTest("3.5+1 ,4*2.5", "4.5 10.0"); evalTest("3<5", "true"); evalTest("let $x:=3+4 return $x", "7"); evalTest("let $x:=3+4 return <a>{$x}</a>", "<a>7</a>"); evalTest("for $y in (4,5,2+4) return <b>{10+$y}</b>", "<b>14</b><b>15</b><b>16</b>"); evalTest("for $i in (1 to 10) where ($i mod 2)=1 return 20+$i", "21 23 25 27 29"); evalTest("(3,4,5)[3]", "5"); evalTest("1,((2,3)[false()]),5", "1 5"); evalTest("1,((2 to 4)[true()]),5", "1 2 3 4 5"); evalTest("(for $y in (5,4) return <b>{10+$y}</b>)[2]", "<b>14</b>"); evalTest("document(\"tab.xml\")/result", "<result>\n" + "<row>\n" + "<fld1>a1</fld1>\n" + "<fld2 align=\"right\">12</fld2>\n" + "</row>\n" + "<row>\n" + "<fld1 align=\"left\">b1</fld1>\n" + "<fld2 align=\"right\">22</fld2>\n" + "</row>\n" + "<h:row>\n" + "<j:fld1>c1</j:fld1>\n" + "<h:fld2>33</h:fld2>\n" + "<j:fld3>44</j:fld3>\n" + "<k:fld1>c2</k:fld1>\n" + "</h:row>\n" + "</result>"); evalTest("document(\"tab.xml\")/result/row/fld2", "<fld2 align=\"right\">12</fld2><fld2 align=\"right\">22</fld2>"); evalTest("document(\"tab.xml\")/result/row[fld2]", "<row>\n" + "<fld1>a1</fld1>\n" + "<fld2 align=\"right\">12</fld2>\n" + "</row><row>\n" + "<fld1 align=\"left\">b1</fld1>\n" + "<fld2 align=\"right\">22</fld2>\n" + "</row>"); /** True if the two string match, ignoring unquoted white-space. */ /* int ch; for (;;) { ch = in.read(); if (ch < 0 || ch == '\r' || ch == '\n') break; if (ch != ' ' && ch != '\t') { in.unread(); break; } } */ ctx.runUntilDone(); } return new String(out.toCharArray()); } }
package org.voltdb; import static org.junit.Assert.assertEquals; import static org.junit.Assert.assertFalse; import static org.junit.Assert.assertNotNull; import static org.junit.Assert.assertNull; import static org.junit.Assert.assertTrue; import static org.mockito.Matchers.any; import static org.mockito.Matchers.anyInt; import static org.mockito.Matchers.anyLong; import static org.mockito.Matchers.anyObject; import static org.mockito.Matchers.eq; import static org.mockito.Mockito.doAnswer; import static org.mockito.Mockito.doReturn; import static org.mockito.Mockito.mock; import static org.mockito.Mockito.never; import static org.mockito.Mockito.reset; import static org.mockito.Mockito.spy; import static org.mockito.Mockito.verify; import static org.mockito.Mockito.when; import java.io.File; import java.io.IOException; import java.nio.ByteBuffer; import java.util.ArrayDeque; import java.util.Arrays; import java.util.HashSet; import java.util.Queue; import java.util.Set; import java.util.concurrent.BlockingQueue; import java.util.concurrent.Executors; import java.util.concurrent.LinkedTransferQueue; import java.util.concurrent.ScheduledExecutorService; import java.util.concurrent.TimeUnit; import org.apache.zookeeper_voltpatches.CreateMode; import org.apache.zookeeper_voltpatches.ZooDefs.Ids; import org.apache.zookeeper_voltpatches.ZooKeeper; import org.junit.After; import org.junit.Before; import org.junit.BeforeClass; import org.junit.Test; import org.mockito.ArgumentCaptor; import org.mockito.invocation.InvocationOnMock; import org.mockito.stubbing.Answer; import org.voltcore.messaging.HostMessenger; import org.voltcore.messaging.LocalObjectMessage; import org.voltcore.messaging.VoltMessage; import org.voltcore.network.Connection; import org.voltcore.network.VoltNetworkPool; import org.voltcore.utils.DeferredSerialization; import org.voltcore.utils.Pair; import org.voltdb.ClientInterface.ClientInputHandler; import org.voltdb.VoltDB.Configuration; import org.voltdb.VoltTable.ColumnInfo; import org.voltdb.catalog.Catalog; import org.voltdb.client.ClientResponse; import org.voltdb.client.ProcedureInvocationType; import org.voltdb.common.Constants; import org.voltdb.compiler.AdHocPlannedStatement; import org.voltdb.compiler.AdHocPlannedStmtBatch; import org.voltdb.compiler.AdHocPlannerWork; import org.voltdb.compiler.CatalogChangeResult; import org.voltdb.compiler.CatalogChangeWork; import org.voltdb.compiler.VoltProjectBuilder; import org.voltdb.iv2.Cartographer; import org.voltdb.messaging.InitiateResponseMessage; import org.voltdb.messaging.Iv2InitiateTaskMessage; import org.voltdb.utils.CatalogUtil; import org.voltdb.utils.Encoder; import org.voltdb.utils.MiscUtils; public class TestClientInterface { // mocked objects that CI requires private VoltDBInterface m_volt; private Queue<DeferredSerialization> statsAnswers = new ArrayDeque<DeferredSerialization>(); private int drStatsInvoked = 0; private StatsAgent m_statsAgent = new StatsAgent() { @Override public void performOpsAction(final Connection c, final long clientHandle, final OpsSelector selector, final ParameterSet params) throws Exception { final String stat = (String)params.toArray()[0]; if (stat.equals("TOPO") && !statsAnswers.isEmpty()) { c.writeStream().enqueue(statsAnswers.poll()); } else if (stat.equals("DR")) { drStatsInvoked++; } } }; private SystemInformationAgent m_sysinfoAgent; private HostMessenger m_messenger; private ClientInputHandler m_handler; private Cartographer m_cartographer; private SimpleClientResponseAdapter m_cxn; private ZooKeeper m_zk; // real context private static CatalogContext m_context = null; // real CI, but spied on using mockito private static ClientInterface m_ci = null; // the mailbox in CI //private static Mailbox m_mb = null; private static int[] m_allPartitions = new int[] {0, 1, 2}; @BeforeClass public static void setUpOnce() throws Exception { buildCatalog(); } BlockingQueue<ByteBuffer> responses = new LinkedTransferQueue<ByteBuffer>(); BlockingQueue<DeferredSerialization> responsesDS = new LinkedTransferQueue<DeferredSerialization>(); private static final ScheduledExecutorService ses = Executors.newScheduledThreadPool(1); @Before public void setUp() throws Exception { // Set up CI with the mock objects. m_volt = mock(VoltDBInterface.class); m_sysinfoAgent = mock(SystemInformationAgent.class); m_messenger = mock(HostMessenger.class); m_handler = mock(ClientInputHandler.class); m_cartographer = mock(Cartographer.class); m_zk = mock(ZooKeeper.class); responses = new LinkedTransferQueue<ByteBuffer>(); responsesDS = new LinkedTransferQueue<DeferredSerialization>(); //m_cxn = mock(SimpleClientResponseAdapter.class); drStatsInvoked = 0; m_cxn = new SimpleClientResponseAdapter(0, "foo") { @Override public void enqueue(ByteBuffer buf) {responses.offer(buf);} @Override public void enqueue(ByteBuffer bufs[]) {responses.offer(bufs[0]);} @Override public void enqueue(DeferredSerialization ds) {responsesDS.offer(ds);} @Override public void queueTask(Runnable r) {} }; /* * Setup the mock objects so that they return expected objects in CI * construction */ VoltDB.replaceVoltDBInstanceForTest(m_volt); doReturn(m_cxn.connectionId()).when(m_handler).connectionId(); doReturn(m_statsAgent).when(m_volt).getStatsAgent(); doReturn(m_statsAgent).when(m_volt).getOpsAgent(OpsSelector.STATISTICS); doReturn(m_sysinfoAgent).when(m_volt).getOpsAgent(OpsSelector.SYSTEMINFORMATION); doReturn(mock(SnapshotCompletionMonitor.class)).when(m_volt).getSnapshotCompletionMonitor(); doReturn(m_messenger).when(m_volt).getHostMessenger(); doReturn(mock(VoltNetworkPool.class)).when(m_messenger).getNetwork(); doReturn(m_zk).when(m_messenger).getZK(); doReturn(mock(Configuration.class)).when(m_volt).getConfig(); doReturn(32L).when(m_messenger).getHSIdForLocalSite(HostMessenger.ASYNC_COMPILER_SITE_ID); doAnswer(new Answer<Object>() { @Override public Object answer(InvocationOnMock invocation) { Object args[] = invocation.getArguments(); return ses.scheduleAtFixedRate((Runnable) args[0], (long) args[1], (long) args[2], (TimeUnit) args[3]); } }).when(m_volt).scheduleWork(any(Runnable.class), anyLong(), anyLong(), (TimeUnit)anyObject()); m_ci = spy(new ClientInterface(null, VoltDB.DEFAULT_PORT, null, VoltDB.DEFAULT_ADMIN_PORT, m_context, m_messenger, ReplicationRole.NONE, m_cartographer, m_allPartitions)); m_ci.bindAdapter(m_cxn); //m_mb = m_ci.m_mailbox; } private static void buildCatalog() throws IOException { // build a real catalog File cat = File.createTempFile("temp-log-reinitiator", "catalog"); cat.deleteOnExit(); VoltProjectBuilder builder = new VoltProjectBuilder(); String schema = "create table A (i integer not null, primary key (i));"; builder.addLiteralSchema(schema); builder.addPartitionInfo("A", "i"); builder.addStmtProcedure("hello", "select * from A where i = ?", "A.i: 0"); if (!builder.compile(cat.getAbsolutePath())) { throw new IOException(); } byte[] bytes = MiscUtils.fileToBytes(cat); String serializedCat = CatalogUtil.loadCatalogFromJar(bytes, null); assertNotNull(serializedCat); Catalog catalog = new Catalog(); catalog.execute(serializedCat); String deploymentPath = builder.getPathToDeployment(); CatalogUtil.compileDeployment(catalog, deploymentPath, true, false); m_context = new CatalogContext(0, 0, catalog, bytes, null, 0, 0); TheHashinator.initialize(TheHashinator.getConfiguredHashinatorClass(), TheHashinator.getConfigureBytes(3)); } @After public void tearDown() { reset(m_messenger); reset(m_handler); } private static ByteBuffer createMsg(String name, final Object...params) throws IOException { return createMsg(null, name, params); } /** * Create a VoltMessage that can be fed into CI's handleRead() method. * @param origTxnId The original txnId if it's a replicated transaction * @param name The procedure name * @param params Procedure parameters * @return * @throws IOException */ private static ByteBuffer createMsg(Long origTxnId, String name, final Object...params) throws IOException { StoredProcedureInvocation proc = new StoredProcedureInvocation(); proc.setProcName(name); if (origTxnId != null) proc.setOriginalTxnId(origTxnId); proc.setParams(params); ByteBuffer buf = ByteBuffer.allocate(proc.getSerializedSize()); proc.flattenToBuffer(buf); buf.flip(); return buf; } /** * Pass the VoltMessage to CI's handleRead() and inspect if the expected * parameters are passed to the initiator's createTranction() method. This * is a convenient method if the caller expects the result of handling this * message is to create a new transaction. * * @param msg * @param procName * @param partitionParam null if it's a multi-part txn * @param isAdmin * @param isReadonly * @param isSinglePart * @param isEverySite * @return StoredProcedureInvocation object passed to createTransaction() * @throws IOException */ private Iv2InitiateTaskMessage readAndCheck(ByteBuffer msg, String procName, Object partitionParam, boolean isReadonly, boolean isSinglePart) throws Exception { ClientResponseImpl resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNull(resp); return checkInitMsgSent(procName, partitionParam, isReadonly, isSinglePart); } private Iv2InitiateTaskMessage checkInitMsgSent(String procName, Object partitionParam, boolean isReadonly, boolean isSinglePart) { ArgumentCaptor<Long> destinationCaptor = ArgumentCaptor.forClass(Long.class); ArgumentCaptor<Iv2InitiateTaskMessage> messageCaptor = ArgumentCaptor.forClass(Iv2InitiateTaskMessage.class); verify(m_messenger).send(destinationCaptor.capture(), messageCaptor.capture()); Iv2InitiateTaskMessage message = messageCaptor.getValue(); assertEquals(isReadonly, message.isReadOnly()); // readonly assertEquals(isSinglePart, message.isSinglePartition()); // single-part assertEquals(procName, message.getStoredProcedureName()); if (isSinglePart) { int expected = TheHashinator.getPartitionForParameter(VoltType.typeFromObject(partitionParam).getValue(), partitionParam); assertEquals(new Long(m_cartographer.getHSIdForMaster(expected)), destinationCaptor.getValue()); } else { assertEquals(new Long(m_cartographer.getHSIdForMultiPartitionInitiator()), destinationCaptor.getValue()); } return message; } @Test public void testExplain() throws IOException { ByteBuffer msg = createMsg("@Explain", "select * from a"); ClientResponseImpl resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNull(resp); ArgumentCaptor<LocalObjectMessage> captor = ArgumentCaptor.forClass(LocalObjectMessage.class); verify(m_messenger).send(eq(32L), captor.capture()); assertTrue(captor.getValue().payload instanceof AdHocPlannerWork ); System.out.println( captor.getValue().payload.toString() ); String payloadString = captor.getValue().payload.toString(); assertTrue(payloadString.contains("user partitioning: none")); } @Test public void testAdHoc() throws IOException { ByteBuffer msg = createMsg("@AdHoc", "select * from a"); ClientResponseImpl resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNull(resp); ArgumentCaptor<LocalObjectMessage> captor = ArgumentCaptor.forClass(LocalObjectMessage.class); verify(m_messenger).send(eq(32L), captor.capture()); assertTrue(captor.getValue().payload instanceof AdHocPlannerWork); String payloadString = captor.getValue().payload.toString(); assertTrue(payloadString.contains("user partitioning: none")); // single-part adhoc reset(m_messenger); msg = createMsg("@AdHocSpForTest", "select * from a where i = 3", 3); resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNull(resp); verify(m_messenger).send(eq(32L), captor.capture()); assertTrue(captor.getValue().payload instanceof AdHocPlannerWork); payloadString = captor.getValue().payload.toString(); assertTrue(payloadString.contains("user params: empty")); assertTrue(payloadString.contains("user partitioning: 3")); } @Test public void testFinishedSPAdHocPlanning() throws Exception { // Need a batch and a statement String query = "select * from a where i = ?"; int partitionParamIndex = 0; Object[] extractedValues = new Object[0]; VoltType[] paramTypes = new VoltType[]{VoltType.INTEGER}; AdHocPlannedStmtBatch plannedStmtBatch = AdHocPlannedStmtBatch.mockStatementBatch(3, query, extractedValues, paramTypes, new Object[]{3}, partitionParamIndex); m_ci.processFinishedCompilerWork(plannedStmtBatch).run(); ArgumentCaptor<Long> destinationCaptor = ArgumentCaptor.forClass(Long.class); ArgumentCaptor<Iv2InitiateTaskMessage> messageCaptor = ArgumentCaptor.forClass(Iv2InitiateTaskMessage.class); verify(m_messenger).send(destinationCaptor.capture(), messageCaptor.capture()); Iv2InitiateTaskMessage message = messageCaptor.getValue(); assertTrue(message.isReadOnly()); // readonly assertTrue(message.isSinglePartition()); // single-part assertEquals("@AdHoc_RO_SP", message.getStoredProcedureName()); // SP AdHoc should have partitioning parameter serialized in the parameter set Object partitionParam = message.getStoredProcedureInvocation().getParameterAtIndex(0); assertTrue(partitionParam instanceof byte[]); VoltType type = VoltType.get((Byte) message.getStoredProcedureInvocation().getParameterAtIndex(1)); assertTrue(type.isInteger()); byte[] serializedData = (byte[]) message.getStoredProcedureInvocation().getParameterAtIndex(2); ByteBuffer buf = ByteBuffer.wrap(serializedData); Object[] parameters = AdHocPlannedStmtBatch.userParamsFromBuffer(buf); assertEquals(1, parameters.length); assertEquals(3, parameters[0]); AdHocPlannedStatement[] statements = AdHocPlannedStmtBatch.planArrayFromBuffer(buf); assertTrue(Arrays.equals(TheHashinator.valueToBytes(3), (byte[]) partitionParam)); assertEquals(1, statements.length); String sql = new String(statements[0].sql, Constants.UTF8ENCODING); assertEquals(query, sql); } /** * Fake an adhoc compiler result and return it to the CI, see if CI * initiates the txn. */ @Test public void testFinishedMPAdHocPlanning() throws Exception { // Need a batch and a statement String query = "select * from a"; Object[] extractedValues = new Object[0]; VoltType[] paramTypes = new VoltType[0]; AdHocPlannedStmtBatch plannedStmtBatch = AdHocPlannedStmtBatch.mockStatementBatch(3, query, extractedValues, paramTypes, null, -1); m_ci.processFinishedCompilerWork(plannedStmtBatch).run(); ArgumentCaptor<Long> destinationCaptor = ArgumentCaptor.forClass(Long.class); ArgumentCaptor<Iv2InitiateTaskMessage> messageCaptor = ArgumentCaptor.forClass(Iv2InitiateTaskMessage.class); verify(m_messenger).send(destinationCaptor.capture(), messageCaptor.capture()); Iv2InitiateTaskMessage message = messageCaptor.getValue(); //assertFalse(boolValues.get(0)); // is admin assertTrue(message.isReadOnly()); // readonly assertFalse(message.isSinglePartition()); // single-part //assertFalse(boolValues.get(3)); // every site assertEquals("@AdHoc_RO_MP", message.getStoredProcedureName()); byte[] serializedData = (byte[]) message.getStoredProcedureInvocation().getParameterAtIndex(0); ByteBuffer buf = ByteBuffer.wrap(serializedData); Object[] parameters = AdHocPlannedStmtBatch.userParamsFromBuffer(buf); assertEquals(0, parameters.length); AdHocPlannedStatement[] statements = AdHocPlannedStmtBatch.planArrayFromBuffer(buf); assertEquals(1, statements.length); String sql = new String(statements[0].sql, Constants.UTF8ENCODING); assertEquals(query, sql); } @Test public void testUpdateCatalog() throws IOException { // only makes sense in pro (sysproc suite has a complementary test for community) if (VoltDB.instance().getConfig().m_isEnterprise) { String catalogHex = Encoder.hexEncode("blah"); ByteBuffer msg = createMsg("@UpdateApplicationCatalog", catalogHex, "blah"); ClientResponseImpl resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNull(resp); ArgumentCaptor<LocalObjectMessage> captor = ArgumentCaptor.forClass(LocalObjectMessage.class); verify(m_messenger).send(eq(32L), // A fixed number set in setUpOnce() captor.capture()); assertTrue(captor.getValue().payload instanceof CatalogChangeWork); } } @Test public void testNegativeUpdateCatalog() throws IOException { ByteBuffer msg = createMsg("@UpdateApplicationCatalog", new Integer(1), new Long(0)); ClientResponseImpl resp = m_ci.handleRead(msg, m_handler, m_cxn); // expect an error response from handleRead. assertNotNull(resp); assertTrue(resp.getStatus() != 0); } /** * Fake a catalog diff compiler result and send it back to the CI, see if CI * initiates a new txn. */ @Test public void testFinishedCatalogDiffing() { CatalogChangeResult catalogResult = new CatalogChangeResult(); catalogResult.clientData = null; catalogResult.clientHandle = 0; catalogResult.connectionId = 0; catalogResult.adminConnection = false; // catalog change specific boiler plate catalogResult.catalogHash = "blah".getBytes(); catalogResult.catalogBytes = "blah".getBytes(); catalogResult.deploymentString = "blah"; catalogResult.expectedCatalogVersion = 3; catalogResult.encodedDiffCommands = "diff"; catalogResult.invocationType = ProcedureInvocationType.REPLICATED; catalogResult.originalTxnId = 12345678l; catalogResult.originalUniqueId = 87654321l; m_ci.processFinishedCompilerWork(catalogResult).run(); ArgumentCaptor<Long> destinationCaptor = ArgumentCaptor.forClass(Long.class); ArgumentCaptor<Iv2InitiateTaskMessage> messageCaptor = ArgumentCaptor.forClass(Iv2InitiateTaskMessage.class); verify(m_messenger).send(destinationCaptor.capture(), messageCaptor.capture()); Iv2InitiateTaskMessage message = messageCaptor.getValue(); //assertFalse(boolValues.get(0)); // is admin assertFalse(message.isReadOnly()); // readonly assertFalse(message.isSinglePartition()); // single-part //assertFalse(boolValues.get(3)); // every site assertEquals("@UpdateApplicationCatalog", message.getStoredProcedureName()); assertEquals("diff", message.getStoredProcedureInvocation().getParameterAtIndex(0)); assertTrue(Arrays.equals("blah".getBytes(), (byte[]) message.getStoredProcedureInvocation().getParameterAtIndex(2))); assertEquals(3, message.getStoredProcedureInvocation().getParameterAtIndex(3)); assertEquals("blah", message.getStoredProcedureInvocation().getParameterAtIndex(4)); assertEquals(ProcedureInvocationType.REPLICATED, message.getStoredProcedureInvocation().getType()); assertEquals(12345678l, message.getStoredProcedureInvocation().getOriginalTxnId()); assertEquals(87654321l, message.getStoredProcedureInvocation().getOriginalUniqueId()); } @Test public void testUserProc() throws Exception { ByteBuffer msg = createMsg("hello", 1); StoredProcedureInvocation invocation = readAndCheck(msg, "hello", 1, true, true).getStoredProcedureInvocation(); assertEquals(1, invocation.getParameterAtIndex(0)); } @Test public void testGC() throws Exception { ByteBuffer msg = createMsg("@GC"); ClientResponseImpl resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNull(resp); ByteBuffer b = responses.take(); resp = new ClientResponseImpl(); b.position(4); resp.initFromBuffer(b); assertEquals(ClientResponse.SUCCESS, resp.getStatus()); VoltTable vt = resp.getResults()[0]; assertTrue(vt.advanceRow()); //System.gc() should take at least a little time assertTrue(resp.getResults()[0].getLong(0) > 10000); } @Test public void testSystemInformation() throws Exception { ByteBuffer msg = createMsg("@SystemInformation"); ClientResponseImpl resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNull(resp); verify(m_sysinfoAgent).performOpsAction(any(Connection.class), anyInt(), eq(OpsSelector.SYSTEMINFORMATION), any(ParameterSet.class)); } /** * DR stats is not a txn, it goes to the stats agent directly. * @throws Exception */ @Test public void testDRStats() throws Exception { ByteBuffer msg = createMsg("@Statistics", "DR", 0); ClientResponseImpl resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNull(resp); assertEquals(drStatsInvoked, 1); } @Test public void testLoadSinglePartTable() throws Exception { VoltTable table = new VoltTable(new ColumnInfo("i", VoltType.INTEGER)); table.addRow(1); byte[] partitionParam = {0, 0, 0, 0, 0, 0, 0, 4}; ByteBuffer msg = createMsg("@LoadSinglepartitionTable", partitionParam, "a", table); readAndCheck(msg, "@LoadSinglepartitionTable", partitionParam, false, true); } @Test public void testPausedMode() throws IOException { // pause the node when(m_volt.getMode()).thenReturn(OperationMode.PAUSED); ByteBuffer msg = createMsg("hello", 1); ClientResponseImpl resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNotNull(resp); assertEquals(ClientResponse.SERVER_UNAVAILABLE, resp.getStatus()); when(m_volt.getMode()).thenReturn(OperationMode.RUNNING); } @Test public void testInvalidProcedure() throws IOException { ByteBuffer msg = createMsg("hellooooo", 1); ClientResponseImpl resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNotNull(resp); assertEquals(ClientResponse.UNEXPECTED_FAILURE, resp.getStatus()); } @Test public void testAdminProcsOnNonAdminPort() throws IOException { ByteBuffer msg = createMsg("@Pause"); ClientResponseImpl resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNotNull(resp); assertEquals(ClientResponse.UNEXPECTED_FAILURE, resp.getStatus()); msg = createMsg("@Resume"); resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNotNull(resp); assertEquals(ClientResponse.UNEXPECTED_FAILURE, resp.getStatus()); } @Test public void testRejectDupInvocation() throws IOException { // by default, the mock initiator returns false for createTransaction() ByteBuffer msg = createMsg(12345l, "hello", 1); ClientResponseImpl resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNotNull(resp); assertEquals(ClientResponse.UNEXPECTED_FAILURE, resp.getStatus()); } @Test public void testPolicyRejection() throws IOException { // incorrect parameters to @AdHoc proc ByteBuffer msg = createMsg("@AdHoc", 1, 3, 3); ClientResponseImpl resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNotNull(resp); assertEquals(ClientResponse.GRACEFUL_FAILURE, resp.getStatus()); } @Test public void testPromoteWithoutCommandLogging() throws Exception { final ByteBuffer msg = createMsg("@Promote"); m_ci.handleRead(msg, m_handler, m_cxn); // Verify that the truncation request node was not created. verify(m_zk, never()).create(eq(VoltZK.request_truncation_snapshot), any(byte[].class), eq(Ids.OPEN_ACL_UNSAFE), eq(CreateMode.PERSISTENT)); } @Test public void testPromoteWithCommandLogging() throws Exception { org.voltdb.catalog.CommandLog logConfig = m_context.cluster.getLogconfig().get("log"); boolean wasEnabled = logConfig.getEnabled(); logConfig.setEnabled(true); try { final ByteBuffer msg = createMsg("@Promote"); m_ci.handleRead(msg, m_handler, m_cxn); // Verify that the truncation request node was created. verify(m_zk, never()).create(eq(VoltZK.request_truncation_snapshot), any(byte[].class), eq(Ids.OPEN_ACL_UNSAFE), eq(CreateMode.PERSISTENT)); } finally { logConfig.setEnabled(wasEnabled); } } @Test public void testTransactionRestart() throws Exception { initMsgAndSendRestartResp(true); } @Test public void testTransactionRestartIgnored() throws Exception { // fake operation mode as command log recovery so that it won't restart the txn doReturn(OperationMode.INITIALIZING).when(m_volt).getMode(); initMsgAndSendRestartResp(false); } private void initMsgAndSendRestartResp(boolean shouldRestart) throws Exception { // restart will update the hashinator config, initialize it now TheHashinator.constructHashinator(TheHashinator.getConfiguredHashinatorClass(), TheHashinator.getConfigureBytes(3), false); Pair<Long, byte[]> hashinatorConfig = TheHashinator.getCurrentVersionedConfig(); long newHashinatorVersion = hashinatorConfig.getFirst() + 1; ByteBuffer msg = createMsg("hello", 1); Iv2InitiateTaskMessage initMsg = readAndCheck(msg, "hello", 1, true, true); assertEquals(1, initMsg.getStoredProcedureInvocation().getParameterAtIndex(0)); // fake a restart response InitiateResponseMessage respMsg = new InitiateResponseMessage(initMsg); respMsg.setMispartitioned(true, initMsg.getStoredProcedureInvocation(), Pair.of(newHashinatorVersion, hashinatorConfig.getSecond())); // reset the message so that we can check for restart later reset(m_messenger); // Deliver a restart response m_ci.m_mailbox.deliver(respMsg); // Make sure that the txn is NOT restarted DeferredSerialization resp = responsesDS.take(); if (shouldRestart) { assertEquals(-1, resp.getSerializedSize()); checkInitMsgSent("hello", 1, true, true); } else { assertTrue(-1 != resp.getSerializedSize()); verify(m_messenger, never()).send(anyLong(), any(VoltMessage.class)); } // the hashinator should've been updated in either case assertEquals(newHashinatorVersion, TheHashinator.getCurrentVersionedConfig().getFirst().longValue()); } @Test public void testGetPartitionKeys() throws IOException { //Unsupported type ByteBuffer msg = createMsg("@GetPartitionKeys", "BIGINT"); ClientResponseImpl resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNotNull(resp); assertEquals(ClientResponse.GRACEFUL_FAILURE, resp.getStatus()); //Null param msg = createMsg("@GetPartitionKeys", new Object[] { null }); resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNotNull(resp); assertEquals(ClientResponse.GRACEFUL_FAILURE, resp.getStatus()); //Empty string param msg = createMsg("@GetPartitionKeys", ""); resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNotNull(resp); assertEquals(ClientResponse.GRACEFUL_FAILURE, resp.getStatus()); //Junk string msg = createMsg("@GetPartitionKeys", "ryanlikestheyankees"); resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNotNull(resp); assertEquals(ClientResponse.GRACEFUL_FAILURE, resp.getStatus()); //No param msg = createMsg("@GetPartitionKeys"); resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNotNull(resp); assertEquals(ClientResponse.GRACEFUL_FAILURE, resp.getStatus()); //Extra param msg = createMsg("@GetPartitionKeys", "INTEGER", 99); resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNotNull(resp); assertEquals(ClientResponse.GRACEFUL_FAILURE, resp.getStatus()); //Correct param with no case sensitivity msg = createMsg("@GetPartitionKeys", "InTeGeR"); resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNotNull(resp); assertEquals(ClientResponse.SUCCESS, resp.getStatus()); VoltTable vt = resp.getResults()[0]; assertEquals(3, vt.getRowCount()); assertEquals(VoltType.INTEGER, vt.getColumnType(1)); Set<Integer> partitions = new HashSet<Integer>(Arrays.asList( 0, 1, 2)); while (vt.advanceRow()) { int partition = TheHashinator.getPartitionForParameter(VoltType.INTEGER.getValue(), vt.getLong(1)); assertTrue(partitions.remove(partition)); } assertTrue(partitions.isEmpty()); } @Test public void testSubscribe() throws Exception { RateLimitedClientNotifier.WARMUP_MS = 0; ClientInterface.TOPOLOGY_CHANGE_CHECK_MS = 1; try { m_ci.startAcceptingConnections(); ByteBuffer msg = createMsg("@Subscribe", "TOPOLOGY"); ClientResponseImpl resp = m_ci.handleRead(msg, m_handler, m_cxn); assertNotNull(resp); assertEquals(ClientResponse.SUCCESS, resp.getStatus()); statsAnswers.offer(dsOf(getClientResponse("foo"))); m_ci.schedulePeriodicWorks(); //Shouldn't get anything assertNull(responsesDS.poll(50, TimeUnit.MILLISECONDS)); //Change the bytes of the topology results and expect a topology update //to make its way to the client ByteBuffer expectedBuf = getClientResponse("bar"); statsAnswers.offer(dsOf(expectedBuf)); DeferredSerialization ds = responsesDS.take(); ByteBuffer actualBuf = ByteBuffer.allocate(ds.getSerializedSize()); ds.serialize(actualBuf); assertEquals(expectedBuf, actualBuf); } finally { RateLimitedClientNotifier.WARMUP_MS = 1000; ClientInterface.TOPOLOGY_CHANGE_CHECK_MS = 5000; m_ci.shutdown(); } } private DeferredSerialization dsOf(final ByteBuffer buf) { return new DeferredSerialization() { @Override public void serialize(final ByteBuffer outbuf) throws IOException { outbuf.put(buf); } @Override public void cancel() {} @Override public int getSerializedSize() { return buf.remaining(); } }; } public ByteBuffer getClientResponse(String str) { ClientResponseImpl response = new ClientResponseImpl(ClientResponse.SUCCESS, new VoltTable[0], str, ClientInterface.ASYNC_TOPO_HANDLE); ByteBuffer buf = ByteBuffer.allocate(response.getSerializedSize() + 4); buf.putInt(buf.capacity() - 4); response.flattenToBuffer(buf); buf.flip(); return buf; } }
package org.voltdb.utils; import java.io.BufferedReader; import java.io.BufferedWriter; import java.io.FileReader; import java.io.FileWriter; import junit.framework.TestCase; import org.voltdb.ServerThread; import org.voltdb.VoltDB; import org.voltdb.VoltDB.Configuration; import org.voltdb.VoltTable; import org.voltdb.client.Client; import org.voltdb.client.ClientFactory; import org.voltdb.compiler.VoltProjectBuilder; public class TestCSVLoader extends TestCase { private String pathToCatalog; private String pathToDeployment; private ServerThread localServer; private VoltDB.Configuration config; private VoltProjectBuilder builder; private Client client; private String userHome = System.getProperty("user.home"); private String reportdir = userHome + "/"; String path_csv = userHome + "/" + "test.csv"; @Override protected void setUp() throws Exception { super.setUp(); } public void testCommon() throws Exception { String mySchema = "create table BLAH (" + "clm_integer integer default 0 not null, " + // column that is partitioned on "clm_tinyint tinyint default 0, " + "clm_smallint smallint default 0, " + "clm_bigint bigint default 0, " + "clm_string varchar(10) default null, " + "clm_decimal decimal default null, " + "clm_float float default null "+ // for later //"clm_timestamp timestamp default null, " + // for later //"clm_varinary varbinary default null" + // for later "); "; String []myOptions = { "--file=" + userHome + "/test.csv", //"--procedure=BLAH.insert", "--reportdir=" + reportdir, "--table=BLAH", "--maxerrors=50", "--user=", "--password=", "--port=", "--strictquotes=true" }; String []myData = { "1,1,1,11111111,first,1.10,1.11", "2,2,2,222222,second,3.30,NULL", "3,3,3,333333, third ,NULL, 3.33", "4,4,4,444444, NULL ,4.40 ,4.44", "5,5,5,5555555, fifth, 5.50, 5.55", "6,6,NULL,666666, sixth, 6.60, 6.66", "7,NULL,7,7777777, seventh, 7.70, 7.77 ", "11, 1,1,\"1,000\",first,1.10,1.11", //invalid lines below "8, 8", "", "10,10,10,10 101 010,second,2.20,2.22", "12,n ull,12,12121212,twelveth,12.12,12.12" }; int invalidLineCnt = 4; test_Interface( mySchema, myOptions, myData, invalidLineCnt ); test_Interface_lineByLine( mySchema, 7, myOptions, myData, invalidLineCnt ); } /* public void testNew() throws Exception { String mySchema = "create table BLAH (" + "clm_integer integer default 0 not null, " + // column that is partitioned on // "clm_tinyint tinyint default 0, " + // "clm_smallint smallint default 0, " + // "clm_bigint bigint default 0, " + // // "clm_string varchar(10) default null, " + // "clm_decimal decimal default null, " + // "clm_float float default null "+ // for later "clm_timestamp timestamp default null, " + // for later //"clm_varinary varbinary default null" + // for later "); "; String []myOptions = { "--inputfile=" + userHome + "/test.csv", //"--procedurename=BLAH.insert", "--reportdir=" + reportdir, "--tablename=BLAH", "--abortfailurecount=50", }; String []myData = { "1,1111111111", "2,12131231231" }; int invalidLineCnt = 0; test_Interface( mySchema, myOptions, myData, invalidLineCnt ); } */ //csvloader --inputfile=/tmp/ --tablename=VOTES --abortfailurecount=50 // public void testOptions() throws Exception // String mySchema = // "create table BLAH (" + // "clm_integer integer default 0 not null, " + // column that is partitioned on // "clm_tinyint tinyint default 0, " + // String []myOptions = { // "--inputfile=" + userHome + "/test.csv", // //"--procedurename=BLAH.insert", // "--reportdir=" + reportdir, // "--tablename=BLAH", // "--abortfailurecount=50", // //"--separator=','" // String []myData = { "1,1,1,11111111,first,1.10,1.11", // "10,10,10,10 101 010,second,2.20,2.22", // "2,2,2,222222,second,3.30,null", // "3,3,3,333333, third ,NULL, 3.33", // "4,4,4,444444, null ,4.40 ,4.44", // "5,5,5,5555555, fifth, 5.50, 5.55", // "6,6,null,666666, sixth, 6.60, 6.66", // "7,null,7,7777777, seventh, 7.70, 7.77 ", // "11, 1,1,\"1,000\",first,1.10,1.11", // "8, 8", // "12,n ull,12,12121212,twelveth,12.12,12.12" // int invalidLineCnt = 3; // test_Interface( mySchema, myOptions, myData, invalidLineCnt ); // public void testDelimeters () throws Exception // simpleSchema = // "create table BLAH (" + // "clm_integer integer default 0 not null, " + // column that is partitioned on // "clm_tinyint tinyint default 0, " + // //"clm_smallint smallint default 0, " + // //"clm_bigint bigint default 0, " + // // "clm_string varchar(10) default null, " + // //"clm_decimal decimal default null, " + // //"clm_float float default 1.0, "+ // for later // //"clm_timestamp timestamp default null, " + // for later // //"clm_varinary varbinary default null" + // for later // char str = '.'; // String []params = { // //userHome + "/testdb.csv", // "--inputfile=" + userHome + "/test.csv", // //"--procedurename=BLAH.insert", // "--reportdir=" + reportdir, // "--tablename=BLAH", // "--abortfailurecount=50", // "--separator=","" // String []myData = {"1, 1","","2, 2"}; // test_Interface( params, myData ); /* public void testSimple() throws Exception { simpleSchema = "create table BLAH (" + "clm_integer integer default 0 not null, " + // column that is partitioned on "clm_tinyint tinyint default 0, " + //"clm_smallint smallint default 0, " + //"clm_bigint bigint default 0, " + //"clm_string varchar(10) default null, " + //"clm_decimal decimal default null, " + //"clm_float float default 1.0, "+ // for later //"clm_timestamp timestamp default null, " + // for later //"clm_varinary varbinary default null" + // for later "); "; String []params_simple = { //"--inputfile=" + userHome + "/testdb.csv", //"--procedurename=BLAH.insert", //"--reportdir=" + reportdir, //"--tablename=BLAH", //"--abortfailurecount=50", "-help" }; try { CSVLoader.main(params_simple); // do the test VoltTable modCount; modCount = client.callProcedure("@AdHoc", "SELECT * FROM BLAH;").getResults()[0]; System.out.println("data inserted to table BLAH:\n" + modCount); int rowct = modCount.getRowCount(); BufferedReader csvreport = new BufferedReader(new FileReader(new String(reportdir + CSVLoader.reportfile))); int lineCount = 0; String line = ""; String promptMsg = "Number of acknowledged tuples:"; while ((line = csvreport.readLine()) != null) { if (line.startsWith(promptMsg)) { String num = line.substring(promptMsg.length()); lineCount = Integer.parseInt(num.replaceAll("\\s","")); break; } } System.out.println(String.format("The rows infected: (%d,%s)", lineCount, rowct)); assertEquals(lineCount, rowct); CSVLoader.flush(); } finally { if (client != null) client.close(); client = null; if (localServer != null) { localServer.shutdown(); localServer.join(); } localServer = null; // no clue how helpful this is System.gc(); } } */ public void test_Interface( String my_schema, String[] my_options, String[] my_data, int invalidLineCnt ) throws Exception { try{ BufferedWriter out_csv = new BufferedWriter( new FileWriter( path_csv ) ); for( int i = 0; i < my_data.length; i++ ) out_csv.write( my_data[ i ]+"\n" ); out_csv.flush(); out_csv.close(); } catch( Exception e) { System.err.print( e.getMessage() ); } try{ pathToCatalog = Configuration.getPathToCatalogForTest("csv.jar"); pathToDeployment = Configuration.getPathToCatalogForTest("csv.xml"); builder = new VoltProjectBuilder(); //builder.addStmtProcedure("Insert", "insert into blah values (?, ?, ?);", null); //builder.addStmtProcedure("InsertWithDate", "INSERT INTO BLAH VALUES (974599638818488300, 5, 'nullchar');"); builder.addLiteralSchema(my_schema); builder.addPartitionInfo("BLAH", "clm_integer"); boolean success = builder.compile(pathToCatalog, 2, 1, 0); assertTrue(success); MiscUtils.copyFile(builder.getPathToDeployment(), pathToDeployment); config = new VoltDB.Configuration(); config.m_pathToCatalog = pathToCatalog; config.m_pathToDeployment = pathToDeployment; localServer = new ServerThread(config); client = null; localServer.start(); localServer.waitForInitialization(); client = ClientFactory.createClient(); client.createConnection("localhost"); CSVLoader.main( my_options ); // do the test VoltTable modCount; modCount = client.callProcedure("@AdHoc", "SELECT * FROM BLAH;").getResults()[0]; System.out.println("data inserted to table BLAH:\n" + modCount); int rowct = modCount.getRowCount(); BufferedReader csvreport = new BufferedReader(new FileReader(CSVLoader.path_reportfile)); int lineCount = 0; String line = ""; String promptMsg = "Number of acknowledged tuples:"; String promptFailMsg = "Number of failed tuples:"; int invalidlinecnt = 0; while ((line = csvreport.readLine()) != null) { if (line.startsWith(promptMsg)) { String num = line.substring(promptMsg.length()); lineCount = Integer.parseInt(num.replaceAll("\\s","")); } if( line.startsWith(promptFailMsg)){ String num = line.substring(promptFailMsg.length()); invalidlinecnt = Integer.parseInt(num.replaceAll("\\s","")); } } System.out.println(String.format("The rows infected: (%d,%s)", lineCount, rowct)); //assertEquals(lineCount, rowct); assertEquals(invalidLineCnt, invalidlinecnt); } finally { if (client != null) client.close(); client = null; if (localServer != null) { localServer.shutdown(); localServer.join(); } localServer = null; // no clue how helpful this is System.gc(); } } public void test_Interface_lineByLine( String my_schema, int columnCnt, String[] my_options, String[] my_data, int invalidLineCnt ) throws Exception { try{ BufferedWriter out_csv = new BufferedWriter( new FileWriter( path_csv ) ); for( int i = 0; i < my_data.length; i++ ) out_csv.write( my_data[ i ]+"\n" ); out_csv.flush(); out_csv.close(); } catch( Exception e) { System.err.print( e.getMessage() ); } try{ pathToCatalog = Configuration.getPathToCatalogForTest("csv.jar"); pathToDeployment = Configuration.getPathToCatalogForTest("csv.xml"); builder = new VoltProjectBuilder(); //builder.addStmtProcedure("Insert", "insert into blah values (?, ?, ?);", null); //builder.addStmtProcedure("InsertWithDate", "INSERT INTO BLAH VALUES (974599638818488300, 5, 'nullchar');"); builder.addLiteralSchema(my_schema); builder.addPartitionInfo("BLAH", "clm_integer"); boolean success = builder.compile(pathToCatalog, 2, 1, 0); assertTrue(success); MiscUtils.copyFile(builder.getPathToDeployment(), pathToDeployment); config = new VoltDB.Configuration(); config.m_pathToCatalog = pathToCatalog; config.m_pathToDeployment = pathToDeployment; localServer = new ServerThread(config); client = null; localServer.start(); localServer.waitForInitialization(); client = ClientFactory.createClient(); client.createConnection("localhost"); new CSVLoader( my_options ); while( CSVLoader.readNext() ) { String [] addStr= null; CSVLoader.insertLine( addStr, columnCnt ); } CSVLoader.drain(); CSVLoader.produceFiles(); CSVLoader.flush(); // do the test VoltTable modCount; modCount = client.callProcedure("@AdHoc", "SELECT * FROM BLAH;").getResults()[0]; System.out.println("data inserted to table BLAH:\n" + modCount); int rowct = modCount.getRowCount(); BufferedReader csvreport = new BufferedReader(new FileReader(CSVLoader.path_reportfile)); int lineCount = 0; String line = ""; String promptMsg = "Number of acknowledged tuples:"; String promptFailMsg = "Number of failed tuples:"; int invalidlinecnt = 0; while ((line = csvreport.readLine()) != null) { if (line.startsWith(promptMsg)) { String num = line.substring(promptMsg.length()); lineCount = Integer.parseInt(num.replaceAll("\\s","")); } if( line.startsWith(promptFailMsg)){ String num = line.substring(promptFailMsg.length()); invalidlinecnt = Integer.parseInt(num.replaceAll("\\s","")); } } System.out.println(String.format("The rows infected: (%d,%s)", lineCount, rowct)); assertEquals(invalidLineCnt,invalidlinecnt); } finally { if (client != null) client.close(); client = null; if (localServer != null) { localServer.shutdown(); localServer.join(); } localServer = null; // no clue how helpful this is System.gc(); } } }
package org.voltdb.utils; import java.io.FileReader; import org.voltdb.ServerThread; import org.voltdb.VoltDB; import org.voltdb.VoltTable; import org.voltdb.VoltDB.Configuration; import org.voltdb.VoltType; import org.voltdb.client.Client; import org.voltdb.client.ClientFactory; import org.voltdb.compiler.VoltProjectBuilder; import au.com.bytecode.opencsv_voltpatches.CSVReader; import junit.framework.TestCase; public class TestCSVLoader extends TestCase { public void testSimple() throws Exception { String simpleSchema = "create table BLAH (" + "clm_integer integer default 0 not null, " + // column that is partitioned on "clm_tinyint tinyint default 0, " + "clm_smallint smallint default 0, " + "clm_bigint bigint default 0, " + "clm_string varchar(10) default null, " + "clm_decimal decimal default null, " + //"clm_float float default 1.0, " + // for later //"clm_timestamp timestamp default null, " + // for later //"clm_varinary varbinary default null" + // for later "); "; String pathToCatalog = Configuration.getPathToCatalogForTest("csv.jar"); String pathToDeployment = Configuration.getPathToCatalogForTest("csv.xml"); VoltProjectBuilder builder = new VoltProjectBuilder(); builder.addLiteralSchema(simpleSchema); builder.addPartitionInfo("BLAH", "clm_integer"); //builder.addStmtProcedure("Insert", "insert into blah values (?, ?, ?);", null); //builder.addStmtProcedure("InsertWithDate", "INSERT INTO BLAH VALUES (974599638818488300, 5, 'nullchar');"); boolean success = builder.compile(pathToCatalog, 2, 1, 0); assertTrue(success); MiscUtils.copyFile(builder.getPathToDeployment(), pathToDeployment); VoltDB.Configuration config = new VoltDB.Configuration(); config.m_pathToCatalog = pathToCatalog; config.m_pathToDeployment = pathToDeployment; ServerThread localServer = new ServerThread(config); Client client = null; try { localServer.start(); localServer.waitForInitialization(); String []params = {"/Users/xinjia/testdb.csv","BLAH.insert"}; //String []params = {"/Users/xinjia/testdb.csv","Insert","--columns", "0,2,1"}; CSVLoader.main(params); // do the test client = ClientFactory.createClient(); client.createConnection("localhost"); final CSVReader reader = new CSVReader(new FileReader(params[0])); int lineCount = 0; while (reader.readNext() != null) { lineCount++; } VoltTable modCount; modCount = client.callProcedure("@AdHoc", "SELECT COUNT(*) FROM BLAH;").getResults()[0]; int rowct = 0; while(modCount.advanceRow()) { rowct = (Integer) modCount.get(0, VoltType.INTEGER); } System.out.println(String.format("The rows infected: (%d,%s)", lineCount, rowct)); assertEquals(lineCount, rowct); modCount = client.callProcedure("@AdHoc", "SELECT * FROM BLAH;").getResults()[0]; System.out.println("data inserted to table BLAH:\n" + modCount); } finally { if (client != null) client.close(); client = null; if (localServer != null) { localServer.shutdown(); localServer.join(); } localServer = null; // no clue how helpful this is System.gc(); } } }
package net.maizegenetics.gbs.pipeline; import java.awt.Frame; import java.util.ArrayList; import java.util.Arrays; import java.util.List; import java.util.Map; import java.util.TreeMap; import javax.swing.ImageIcon; import net.maizegenetics.util.ArgsEngine; import net.maizegenetics.pal.alignment.MutableNucleotideAlignment; import net.maizegenetics.pal.alignment.Alignment; import net.maizegenetics.pal.alignment.AlignmentUtils; import net.maizegenetics.pal.alignment.ExportUtils; import net.maizegenetics.pal.alignment.ImportUtils; import net.maizegenetics.pal.alignment.MutableVCFAlignment; import net.maizegenetics.pal.ids.IdGroup; import net.maizegenetics.pal.ids.Identifier; import net.maizegenetics.pal.ids.SimpleIdGroup; import net.maizegenetics.plugindef.AbstractPlugin; import net.maizegenetics.plugindef.DataSet; import net.maizegenetics.util.VCFUtil; import org.apache.log4j.Logger; /** * Basic filters needed for removing bad sites and taxa from GBS pipelines * @author edbuckler */ public class MergeIdenticalTaxaPlugin extends AbstractPlugin { int startChromosome = 1, endChromosome = 10; private ArgsEngine myArgsEngine = null; private static final Logger myLogger = Logger.getLogger(MergeIdenticalTaxaPlugin.class); private String suppliedInputFileName, suppliedOutputFileName, infile, outfile; private double majorityRule = 0.8; private boolean makeHetCalls = true; String[] lowCoverageTaxa = null; private static enum INPUT_FORMAT {hapmap, vcf}; //input file format, acceptable values are "hapmap" "vcf" private INPUT_FORMAT inputFormat = INPUT_FORMAT.hapmap; private int myMaxNumAlleles; public MergeIdenticalTaxaPlugin() { super(null, false); } public MergeIdenticalTaxaPlugin(Frame parentFrame) { super(parentFrame, false); } @Override public DataSet performFunction(DataSet input) { for (int chr = startChromosome; chr <= endChromosome; chr++) { infile = suppliedInputFileName.replace("+", "" + chr); outfile = suppliedOutputFileName.replace("+", "" + chr); myLogger.info("Reading: " + infile); Alignment a = null; if (inputFormat == INPUT_FORMAT.hapmap) { try { a = ImportUtils.readFromHapmap(infile, this); } catch (Exception e) { myLogger.info("Could not read input hapmap file for chr" + chr + ":\n\t" + infile + "\n\tSkipping..."); continue; } } else if (inputFormat == INPUT_FORMAT.vcf) { try { a = ImportUtils.readFromVCF(infile, this, myMaxNumAlleles); } catch (Exception e) { myLogger.info("Could not read input vcf file for chr" + chr + ":\n\t" + infile + "\n\tSkipping..."); continue; } } else { throw new IllegalArgumentException("File format " + inputFormat + " is not recognized!"); } myLogger.info("Original Alignment Taxa:" + a.getSequenceCount() + " Sites:" + a.getSiteCount()); AlignmentFilterByGBSUtils.getErrorRateForDuplicatedTaxa(a, true, false, true); IdGroup idg = a.getIdGroup(); TreeMap<String, List<String>> sortedIds2 = new TreeMap<String, List<String>>(); int uniqueTaxa = 0; for (int i = 0; i < idg.getIdCount(); i++) { List<String> l = sortedIds2.get(idg.getIdentifier(i).getName()); if (l == null) { sortedIds2.put(idg.getIdentifier(i).getName(), l = new ArrayList<String>()); uniqueTaxa++; } l.add(idg.getIdentifier(i).getFullName()); } IdGroup newGroup = new SimpleIdGroup(uniqueTaxa); int index = 0; for (List<String> l : sortedIds2.values()) { if (l.size() > 1) { newGroup.setIdentifier(index, new Identifier(l.get(0).split(":")[0] + ":MERGE")); System.out.println("To be merged: " + l.size() + ": " + l); } else { newGroup.setIdentifier(index, new Identifier(l.get(0))); } //System.out.println(newGroup.getIdentifier(index).getFullName()); index++; } System.out.println("Total taxa:" + idg.getIdCount()); System.out.println("Unique taxa:" + uniqueTaxa); //MutableNucleotideAlignment theMSA = new MutableNucleotideAlignment(newGroup, a.getSiteCount(), a.getLoci()); MutableNucleotideAlignment theMSA = null; if (inputFormat == INPUT_FORMAT.hapmap){ theMSA = MutableNucleotideAlignment.getInstance(newGroup, a.getSiteCount()); } else if (inputFormat == INPUT_FORMAT.vcf){ theMSA = MutableVCFAlignment.getInstance(newGroup, a.getSiteCount(),newGroup.getIdCount(), a.getSiteCount(), myMaxNumAlleles); } for (int s = 0; s < a.getSiteCount(); s++) { theMSA.setLocusOfSite(s, a.getLocus(s)); theMSA.setPositionOfSite(s, a.getPositionInLocus(s)); if (inputFormat == INPUT_FORMAT.vcf){ theMSA.setReferenceAllele(s, a.getReferenceAllele(s)); theMSA.setCommonAlleles(s, a.getAllelesByScope(Alignment.ALLELE_SCOPE_TYPE.Depth, s)); } //theMSA.setSitePrefix(s, (byte) a.getSNPID(s).charAt(0)); //theMSA.setStrandOfSite(s, (byte) 1); } System.out.printf("MergeLine Number Scored PropScored HetSites PropHets%n"); int newTaxon = -1; byte[] calls = null; for (Map.Entry<String, List<String>> entry : sortedIds2.entrySet()) { if (inputFormat == INPUT_FORMAT.hapmap) { if (entry.getValue().size() > 1) { calls = consensusCalls(a, entry.getValue(), makeHetCalls, majorityRule); newTaxon = theMSA.getIdGroup().whichIdNumber(entry.getValue().get(0).split(":")[0] + ":MERGE"); } else { int oldTaxon = a.getIdGroup().whichIdNumber(entry.getValue().get(0)); calls = a.getBaseRange(oldTaxon, 0, a.getSiteCount() - 1); newTaxon = theMSA.getIdGroup().whichIdNumber(entry.getValue().get(0)); } for (int s = 0; s < a.getSiteCount(); s++) { theMSA.setBase(newTaxon, s, calls[s]); } if (entry.getValue().size() > 1) { int known = 0, hets = 0; for (int s = 0; s < a.getSiteCount(); s++) { byte cb = theMSA.getBase(newTaxon, s); if (cb != Alignment.UNKNOWN_DIPLOID_ALLELE) { known++; } if (AlignmentUtils.isHeterozygous(cb)) { hets++; } } double pctK = (double) known / (double) a.getSiteCount(); double pctH = (double) hets / (double) a.getSiteCount(); System.out.printf("%s %d %d %.3g %d %.3g %n", entry.getKey(), entry.getValue().size(), known, pctK, hets, pctH); } } else if (inputFormat == INPUT_FORMAT.vcf){ if (entry.getValue().size() > 1){ newTaxon = theMSA.getIdGroup().whichIdNumber(entry.getValue().get(0).split(":")[0] + ":MERGE"); List<String> taxa = entry.getValue(); //the return result is a two day array result[x][y] //y: site index //x: x=0: genotype calling; x=1 to max: allele depth byte[][] genotypeAndDepth = consensusCallsForVCF(a, taxa, myMaxNumAlleles); for (int s = 0; s < a.getSiteCount(); s++) { theMSA.setBase(newTaxon, s, genotypeAndDepth[0][s]); byte[] mydepth = new byte[theMSA.getAllelesByScope(Alignment.ALLELE_SCOPE_TYPE.Depth, s).length]; for (int al=0; al<mydepth.length; al++) { mydepth[al] = genotypeAndDepth[al+1][s]; } theMSA.setDepthForAlleles(newTaxon, s, mydepth); } } else { int oldTaxon = a.getIdGroup().whichIdNumber(entry.getValue().get(0)); calls = a.getBaseRange(oldTaxon, 0, a.getSiteCount()); newTaxon = theMSA.getIdGroup().whichIdNumber(entry.getValue().get(0)); for (int s = 0; s < a.getSiteCount(); s++) { theMSA.setBase(newTaxon, s, calls[s]); theMSA.setDepthForAlleles(newTaxon, s, a.getDepthForAlleles(oldTaxon, s)); } } } } if (inputFormat == INPUT_FORMAT.hapmap) { ExportUtils.writeToHapmap(theMSA, false, outfile, '\t', this); } else if (inputFormat == INPUT_FORMAT.vcf) { ExportUtils.writeToVCF(theMSA, outfile, '\t'); } } return null; } public static byte[] consensusCalls(Alignment a, List<String> taxa, boolean callhets, double majority) { short[][] siteCnt = new short[2][a.getSiteCount()]; int[] taxaIndex = new int[taxa.size()]; for (int t = 0; t < taxaIndex.length; t++) { taxaIndex[t] = a.getIdGroup().whichIdNumber(taxa.get(t)); } byte[] calls = new byte[a.getSiteCount()]; Arrays.fill(calls, Alignment.UNKNOWN_DIPLOID_ALLELE); for (int s = 0; s < a.getSiteCount(); s++) { byte mjAllele = a.getMajorAllele(s); byte mnAllele = a.getMinorAllele(s); byte mj=AlignmentUtils.getDiploidValue(mjAllele,mjAllele); byte mn=AlignmentUtils.getDiploidValue(mnAllele,mnAllele); // byte[] snpValue = {mj, mn}; //byte het = IUPACNucleotides.getDegerateSNPByteFromTwoSNPs(snpValue); byte het = AlignmentUtils.getUnphasedDiploidValue(mjAllele, mnAllele); for (int t = 0; t < taxaIndex.length; t++) { byte ob = a.getBase(taxaIndex[t], s); if (ob == Alignment.UNKNOWN_DIPLOID_ALLELE) { continue; } if (ob == mj) { siteCnt[0][s]++; } else if (ob == mn) { siteCnt[1][s]++; } else if (AlignmentUtils.isEqual(ob, het)) { siteCnt[0][s]++; siteCnt[1][s]++; } } int totalCnt = siteCnt[0][s] + siteCnt[1][s]; if (totalCnt == 0) { continue; //no data leave missing } if ((double) siteCnt[0][s] / (double) totalCnt > majority) { calls[s] = mj; } else if ((double) siteCnt[1][s] / (double) totalCnt > majority) { calls[s] = mn; } else if (callhets) { calls[s] = het; } } return calls; } public static byte[][] consensusCallsForVCF (Alignment a, List<String> taxa, int MaxNumAlleles) { //the return result is a two day array result[x][y] //y: site index //x: x=0: genotype calling; x=1 to max: allele depth byte[][] result = new byte[MaxNumAlleles+1][a.getSiteCount()]; for (byte[] row: result) { Arrays.fill(row, (byte)0); } Arrays.fill(result[0], (byte)(-1)); int[] taxaIndex = new int[taxa.size()]; for (int t = 0; t < taxa.size(); t++) { taxaIndex[t] = a.getIdGroup().whichIdNumber(taxa.get(t)); } for (int s = 0; s < a.getSiteCount(); s++) { byte[] alleles = a.getAllelesByScope(Alignment.ALLELE_SCOPE_TYPE.Depth, s); int[] alleleDepth = new int[alleles.length]; Arrays.fill(alleleDepth, 0); for (int t = 0; t < taxaIndex.length; t++) { byte[] myAlleledepth = a.getDepthForAlleles(taxaIndex[t], s); for (int al=0; al<myAlleledepth.length; al++) { alleleDepth[al] += (int)myAlleledepth[al]; } } result[0][s] = VCFUtil.resolveVCFGeno(alleles, alleleDepth); for (int al=0; al<alleles.length; al++){ result[al+1][s] = (byte)(alleleDepth[al]>127?127:alleleDepth[al]); } } return result; } private void printUsage() { myLogger.info( "Input format:\n" + "-hmp Input HapMap file; use a plus sign (+) as a wild card character to " + " specify multiple chromosome numbers.\n" + "-vcf Input VCF file. Use a plus sign (+) as a wild card character to specify multiple chromosome numbers. Options -hmp and -vcf are mutual exclusive.\n" + "-o Output HapMap file; use a plus sign (+) as a wild card character to " + " specify multiple chromosome numbers.\n" + "-xHet Exclude heterozygotes calls (default: " + makeHetCalls + ")" + "-hetFreq Cutoff frequency between het vs. homozygote calls (default: " + majorityRule + ")" + "-sC Start chromosome (default 1).\n" + "-eC End chromosome (default 10).\n" + "-maxAlleleVCF Maximum number of alleles allowed in vcf file.\n"); } @Override public void setParameters(String[] args) { if (args.length == 0) { printUsage(); throw new IllegalArgumentException("\n\nPlease use the above arguments/options.\n\n"); } if (myArgsEngine == null) { myArgsEngine = new ArgsEngine(); myArgsEngine.add("-hmp", "-hmpFile", true); myArgsEngine.add("-vcf", "-vcfFile", true); myArgsEngine.add("-o", "--outFile", true); myArgsEngine.add("-xHets", "--excludeHets", false); myArgsEngine.add("-hetFreq", "--heterozygoteFreqCutoff", true); myArgsEngine.add("-sC", "--startChrom", true); myArgsEngine.add("-eC", "--endChrom", true); myArgsEngine.add("-maxAlleleVCF", "--maxAlleleVCF", true); } myArgsEngine.parse(args); if (myArgsEngine.getBoolean("-sC")) { startChromosome = Integer.parseInt(myArgsEngine.getString("-sC")); } else { printUsage(); throw new IllegalArgumentException("Please provide a start chromosome.\n"); } if (myArgsEngine.getBoolean("-eC")) { endChromosome = Integer.parseInt(myArgsEngine.getString("-eC")); } else { printUsage(); throw new IllegalArgumentException("Please provide an end chromosome.\n"); } if (myArgsEngine.getBoolean("-hmp")) { if (myArgsEngine.getBoolean("-vcf")){ throw new IllegalArgumentException("-hmp and -vcf options are mutual exclusive!\n"); } suppliedInputFileName = myArgsEngine.getString("-hmp"); inputFormat = INPUT_FORMAT.hapmap; } else if (myArgsEngine.getBoolean("-vcf")) { suppliedInputFileName = myArgsEngine.getString("-vcf"); inputFormat = INPUT_FORMAT.vcf; } else { printUsage(); throw new IllegalArgumentException("Please specify a HapMap file or VCF to merge taxa.\n"); } if (myArgsEngine.getBoolean("-o")) { suppliedOutputFileName = myArgsEngine.getString("-o"); } else { printUsage(); throw new IllegalArgumentException("Please specify an output file name.\n"); } if (myArgsEngine.getBoolean("-xHets")) { makeHetCalls = false; } if (myArgsEngine.getBoolean("-hetFreq")) { majorityRule = Double.parseDouble(myArgsEngine.getString("-hetFreq")); } if (myArgsEngine.getBoolean("-maxAlleleVCF")) { if (! myArgsEngine.getBoolean("-vcf")){ throw new IllegalArgumentException("-maxAlleleVCF option only works with -vcf input.\n"); } myMaxNumAlleles = Integer.parseInt(myArgsEngine.getString("-maxAlleleVCF")); } else { myMaxNumAlleles = VCFUtil.VCF_DEFAULT_MAX_NUM_ALLELES; } } @Override public ImageIcon getIcon() { throw new UnsupportedOperationException("Not supported yet."); } @Override public String getButtonName() { throw new UnsupportedOperationException("Not supported yet."); } @Override public String getToolTipText() { throw new UnsupportedOperationException("Not supported yet."); } }
package net.miz_hi.smileessence.listener; import android.widget.AbsListView; import android.widget.AbsListView.OnScrollListener; import android.widget.ListView; import net.miz_hi.smileessence.notification.Notificator; import net.miz_hi.smileessence.util.CustomListAdapter; public class TimelineScrollListener implements OnScrollListener { private CustomListAdapter<?> adapter; public TimelineScrollListener(CustomListAdapter<?> adapter) { this.adapter = adapter; } @Override public void onScroll(AbsListView view, int firstVisibleItem, int visibleItemCount, int totalItemCount) { } @Override public void onScrollStateChanged(AbsListView view, int scrollState) { adapter.setCanNotifyOnChange(false); if (view.getFirstVisiblePosition() == 0 && view.getChildAt(0) != null && view.getChildAt(0).getTop() == 0) { if (scrollState == SCROLL_STATE_IDLE) { adapter.setCanNotifyOnChange(true); int before = adapter.getCount(); adapter.notifyDataSetChanged(); int after = adapter.getCount(); int addCount = after - before; ((ListView) view).setSelectionFromTop(addCount, 0); if (addCount > 0) { adapter.setCanNotifyOnChange(false); Notificator.info(addCount + ""); } } } } }
package org.apache.cocoon.components.cron; import com.thoughtworks.xstream.XStream; import com.thoughtworks.xstream.XStreamException; import com.thoughtworks.xstream.converters.Converter; import com.thoughtworks.xstream.converters.MarshallingContext; import com.thoughtworks.xstream.converters.UnmarshallingContext; import com.thoughtworks.xstream.converters.extended.ISO8601DateConverter; import com.thoughtworks.xstream.io.HierarchicalStreamReader; import com.thoughtworks.xstream.io.HierarchicalStreamWriter; import com.thoughtworks.xstream.io.xml.DomDriver; import java.io.File; import java.io.FileFilter; import java.io.FileInputStream; import java.io.FileNotFoundException; import java.io.FileOutputStream; import java.io.IOException; import java.io.InputStream; import java.io.OutputStream; import java.io.StringWriter; import java.text.SimpleDateFormat; import java.util.Arrays; import java.util.Comparator; import java.util.Date; import java.util.Map; import java.util.Properties; import java.util.TimeZone; import java.util.concurrent.CompletionService; import java.util.concurrent.ExecutionException; import java.util.concurrent.ExecutorCompletionService; import java.util.concurrent.ExecutorService; import java.util.concurrent.Executors; import java.util.concurrent.Future; import java.util.concurrent.TimeUnit; import java.util.logging.Level; import java.util.logging.Logger; import java.util.zip.ZipEntry; import java.util.zip.ZipOutputStream; import org.apache.avalon.framework.CascadingRuntimeException; import org.apache.avalon.framework.configuration.Configurable; import org.apache.avalon.framework.configuration.Configuration; import org.apache.avalon.framework.configuration.ConfigurationException; import org.apache.avalon.framework.parameters.Parameters; import org.apache.avalon.framework.service.ServiceException; import org.apache.cocoon.ProcessingException; import org.apache.cocoon.components.cron.ConfigurableCronJob; import org.apache.cocoon.components.cron.ServiceableCronJob; import org.apache.cocoon.components.source.SourceUtil; import org.apache.cocoon.environment.CocoonRunnable; import org.apache.cocoon.xml.XMLUtils; import org.apache.cocoon.xml.dom.DOMUtil; import org.apache.commons.io.FileUtils; import org.apache.commons.io.FilenameUtils; import org.apache.commons.io.IOUtils; import org.apache.commons.io.filefilter.WildcardFileFilter; import org.apache.commons.lang.exception.ExceptionUtils; import org.apache.excalibur.source.Source; import org.apache.excalibur.source.SourceResolver; import org.apache.xml.serialize.OutputFormat; import org.joda.time.DateTime; import org.w3c.dom.Attr; import org.w3c.dom.Document; import org.w3c.dom.Element; import org.w3c.dom.Node; import org.xml.sax.SAXException; public class QueueProcessorCronJob extends ServiceableCronJob implements Configurable, ConfigurableCronJob { private static final String PARAMETER_QUEUE_PATH = "queue-path"; private static final String PROCESSOR_STATUS_FILE = "processor-status.xml"; private static final long PROCESSOR_STATUS_FILE_STALE = 1200000; private static final long TASK_TIMEOUT = 3000000; // 50 min. private static final String inDirName = "in"; private static final String processingDirName = "in-progress"; private static final String outDirName = "out"; private static final String errorDirName = "error"; private File queuePath; /** * An enum denoting the status of a Processor this class). */ public enum ProcessorStatus { ALIVE, DEAD, NONE } /** * Copy job file to outDir, also, zip contents of processingDir into * "{currentJob-name}.zip" into outDir. * The zip contains a directory {currentJob-name}, all other files are in * that directory. * * @param processingDir * @param outDir * @param currentJob */ private void finishUpJob(File processingDir, File outDir, File currentJob) throws IOException { final String basename = FilenameUtils.getBaseName(currentJob.getName()); final String zipFileName = String.format("%s.zip", basename); File zipFile = new File(outDir, zipFileName); final String zipFolder = basename + "/"; if (this.getLogger().isDebugEnabled()) { this.getLogger().debug("Finishing up job, creating Zip file."); } FileUtils.copyFileToDirectory(currentJob, outDir); try { // create byte buffer byte[] buffer = new byte[1024]; FileOutputStream fos = new FileOutputStream(zipFile); ZipOutputStream zos = new ZipOutputStream(fos); // add a directory to the new ZIP first zos.putNextEntry(new ZipEntry(zipFolder)); File[] files = processingDir.listFiles(); for (File file : files) { FileInputStream fis = new FileInputStream(file); // begin writing a new ZIP entry, positions the stream to the start of the entry data zos.putNextEntry(new ZipEntry(zipFolder + file.getName())); int length; while ((length = fis.read(buffer)) > 0) { zos.write(buffer, 0, length); } zos.closeEntry(); // close the InputStream fis.close(); } // close the ZipOutputStream zos.close(); } catch (IOException ioe) { this.getLogger().error("Error creating zip file" + ioe); } if (this.getLogger().isDebugEnabled()) { this.getLogger().debug("Created Zip file."); } } /** * The object that runs a task. */ private class CocoonTaskRunner extends CocoonRunnable { private final Task task; private final SourceResolver resolver; private final org.apache.avalon.framework.logger.Logger logger; private final OutputStream os; private final int sequenceNumber; public CocoonTaskRunner(Task t, SourceResolver resolver, org.apache.avalon.framework.logger.Logger logger, OutputStream os, int sequenceNumber) { this.task = t; this.resolver = resolver; this.logger = logger; this.os = os; this.sequenceNumber = sequenceNumber; } @Override public void doRun() { try { Document doc = DOMUtil.createDocument(); Element taskNode = doc.createElement("task"); taskNode.setAttribute("id", sequenceNumber + ""); taskNode.setAttribute("uri", task.uri); taskNode.setAttribute("startedAt", "" + new org.joda.time.DateTime()); Element taskResult = processPipeline(task.uri, resolver, logger, doc); taskNode.setAttribute("finishedAt", "" + new org.joda.time.DateTime()); taskNode.appendChild(taskResult); Properties properties = XMLUtils.createPropertiesForXML(true); writeOutputStream(os, XMLUtils.serializeNode(taskNode, properties)); } catch (ProcessingException ex) { Logger.getLogger(QueueProcessorCronJob.class.getName()).log(Level.SEVERE, null, ex); String result = String.format("\n%s\n%s\n%s\n", "<error>", ex.getLocalizedMessage(), "</error>"); writeOutputStream(os, result); } } } /** * Process a job: add all tasks to ExecutorService, invokeAll tasks and wait * until all tasks have finished. While waiting, update * processor-status.xml. * * @param inDir Where all output files are stored. * @param currentJob The current job file. */ private void processCurrentJobConcurrently(File inDir, File currentJob) throws ServiceException, FileNotFoundException, IOException { if (this.getLogger().isInfoEnabled()) { this.getLogger().info("Processing job " + currentJob.getAbsoluteFile()); } if (this.getLogger().isDebugEnabled()) { this.getLogger().debug("Reading job file."); } JobConfig jobConfig = readJobConfig(currentJob); if (this.getLogger().isDebugEnabled()) { this.getLogger().debug("Job file read."); } int totalTasks = jobConfig.tasks.length; int completedTasks = 0; DateTime jobStartedAt = new DateTime(); writeProcessorStatus(jobConfig.name, jobStartedAt, totalTasks, completedTasks); int availableProcessors = Runtime.getRuntime().availableProcessors(); int maxConcurrent = jobConfig.maxConcurrent; int maxThreads = 1; // default nr of threads if (maxConcurrent <= 0) { // If negative, add to availableProcessors, but of course, // use at least one thread. maxThreads = availableProcessors + maxConcurrent; if (maxThreads < 1) { maxThreads = 1; } } else { // Use specified maximum, but only if it is no more than what's // available. maxThreads = maxConcurrent; if (maxConcurrent > availableProcessors) { maxThreads = availableProcessors; } } ExecutorService threadPool = Executors.newFixedThreadPool(maxThreads); if (this.getLogger().isInfoEnabled()) { this.getLogger().info("Using " + maxThreads + " threads to execute " + totalTasks + " tasks."); } CompletionService<CocoonTaskRunner> jobExecutor = new ExecutorCompletionService<CocoonTaskRunner>(threadPool); SourceResolver resolver = (SourceResolver) this.manager.lookup(SourceResolver.ROLE); File outputFile = new File(inDir, "task-results.xml"); OutputStream os = new FileOutputStream(outputFile); writeOutputStream(os, String.format("<tasks job-id=\"%s\" job-name=\"%s\">", jobConfig.id, jobConfig.name)); int submittedTasks = 0; for (Task t : jobConfig.tasks) { CocoonTaskRunner taskRunner = new CocoonTaskRunner(t, resolver, this.getLogger(), os, ++submittedTasks); jobExecutor.submit(taskRunner, taskRunner); } if (this.getLogger().isDebugEnabled()) { this.getLogger().debug("Submitted " + submittedTasks + " tasks."); } boolean interrupted = false; threadPool.shutdown(); // Means: process all tasks. while (!threadPool.isTerminated() && !interrupted && completedTasks < totalTasks) { Future<CocoonTaskRunner> f = null; try { if (this.getLogger().isDebugEnabled()) { this.getLogger().debug("Retrieving next finished task."); } f = jobExecutor.poll(TASK_TIMEOUT, TimeUnit.MILLISECONDS); if (null == f) { this.getLogger().error("Failed getting next finished task (TASK_TIMEOUT (=" + TASK_TIMEOUT + ")), quitting."); interrupted = true; } else { if (this.getLogger().isDebugEnabled()) { this.getLogger().debug("Got finished task."); } Object o = f.get(); } } catch (ExecutionException eex) { this.getLogger().error("Received ExecutionException for task, ignoring, continuing with other tasks: ex = " + eex.getMessage()); } catch (InterruptedException iex) { this.getLogger().error("Received InterruptedException, quitting executing tasks."); interrupted = true; break; } catch (CascadingRuntimeException ex) { this.getLogger().error("Received CascadingRuntimeException, ignoring, continuing with other tasks."); } completedTasks++; if (this.getLogger().isInfoEnabled()) { this.getLogger().info("Tasks completed: " + completedTasks + "/" + totalTasks); } writeProcessorStatus(jobConfig.name, jobStartedAt, totalTasks, completedTasks); } if (interrupted) { threadPool.shutdownNow(); } writeOutputStream(os, "</tasks>"); os.close(); this.manager.release(resolver); } /** * Process the URL in one Task. All errors are caught, if one task goes bad * continue processing the others. * * @param url URL to fetch * @param manager Cocoon servicemanager (so cocoon: protocol is allowed.) * @param logger For logging stuff * @param os Where the output ends up. * @return the output as a String object */ private Element processPipeline(String url, SourceResolver resolver, org.apache.avalon.framework.logger.Logger logger, Document doc) { Source src = null; InputStream is = null; Element node = null; try { if (logger.isDebugEnabled()) { logger.debug("Going to resolve " + url); } src = resolver.resolveURI(url); if (logger.isDebugEnabled()) { logger.debug("Resolved " + url); } Document srcDoc = SourceUtil.toDOM(src); Node srcNode = srcDoc.getFirstChild(); node = (Element)doc.importNode(srcNode, true); } catch (Exception ex) { node = doc.createElement("task-error"); node.appendChild(doc.createTextNode(ex.getLocalizedMessage())); } finally { try { if (null != is) { is.close(); } } catch (IOException ex) { Logger.getLogger(QueueProcessorCronJob.class.getName()).log(Level.SEVERE, null, ex); } finally { if (null != src) { resolver.release(src); src = null; } } } return node; } /** * Check if there's a job in the processingDir. If yes then abstain if * Processor = ALIVE, remove it otherwise. If No then move oldest job to * processingDir, process that job. */ private void processQueue() throws IOException { /* Create subdirs if necessary. */ File queueDir = getOrCreateDirectory(this.queuePath, ""); File inDir = getOrCreateDirectory(queueDir, inDirName); File processingDir = getOrCreateDirectory(queueDir, processingDirName); File outDir = getOrCreateDirectory(queueDir, outDirName); File errorDir = getOrCreateDirectory(queueDir, errorDirName); // Get status of Processor QueueProcessorCronJob.ProcessorStatus pStatus = processorStatus(); File currentJobFile = getOldestJobFile(processingDir); if (this.getLogger().isDebugEnabled()) { this.getLogger().debug(String.format("Processor: %s, queueDir=%s, current job: %s", pStatus, queueDir, currentJobFile)); } // A job is already being processed if (null != currentJobFile) { /* * A job is processed by a live Processor -> quit now. */ if (pStatus.equals(QueueProcessorCronJob.ProcessorStatus.ALIVE)) { if (this.getLogger().isDebugEnabled()) { this.getLogger().debug(String.format("Active job \"%s\" in queue \"%s\", stopping", currentJobFile, queueDir)); } } else { /* * A job was processed, but the Processor is dead. * Move job tot error-folder. Clean processing folder. */ this.getLogger().warn(String.format("Stale job \"%s\" in queue \"%s\", cancelling job and stopping", currentJobFile, queueDir)); moveFileTo(currentJobFile, new File(errorDir, currentJobFile.getName())); FileUtils.cleanDirectory(processingDir); } } else { // No job being processed. File jobFile = getOldestJobFile(inDir); if (jobFile != null) { String jobFileName = jobFile.getName(); File currentJob = new File(processingDir, jobFileName); try { FileUtils.cleanDirectory(processingDir); writeProcessorStatus(jobFileName, new DateTime(), 0, 0); if (this.getLogger().isDebugEnabled()) { this.getLogger().debug(String.format("Processing job \"%s\" in queue \"%s\"", jobFileName, queueDir)); } moveFileTo(jobFile, currentJob); if (this.getLogger().isDebugEnabled()) { this.getLogger().debug(String.format("Moved job \"%s\" to \"%s\"", jobFile, currentJob)); } processCurrentJobConcurrently(processingDir, currentJob); finishUpJob(processingDir, outDir, currentJob); } catch (Exception e) { // Catch IOException AND catch ClassCast exception etc. this.getLogger().error("Error processing job \"" + jobFileName + "\"", e); moveFileTo(currentJob, new File(errorDir, jobFileName)); String stackTrace = ExceptionUtils.getFullStackTrace(e); FileUtils.writeStringToFile(new File(errorDir, FilenameUtils.removeExtension(jobFileName) + ".txt"), stackTrace, "UTF-8"); } finally { FileUtils.cleanDirectory(processingDir); deleteProcessorStatus(); } } else { if (this.getLogger().isDebugEnabled()) { this.getLogger().debug("No job, stopping"); } } } } /** * Main entrypoint for CronJob. * * @param name */ @Override public void execute(String name) { if (this.getLogger().isDebugEnabled()) { this.getLogger().debug("CronJob " + name + " launched at " + new Date()); } try { processQueue(); } catch (IOException e) { throw new CascadingRuntimeException("CronJob " + name + " raised an exception.", e); } } @SuppressWarnings("rawtypes") @Override public void setup(Parameters params, Map objects) { return; } /** * Get path to queue folder. * * @param config * @throws ConfigurationException */ @Override public void configure(final Configuration config) throws ConfigurationException { String actualQueuesDirName = config.getChild(PARAMETER_QUEUE_PATH).getValue(); queuePath = new File(actualQueuesDirName); } /** * Read job description file into JobConfig object using XStream. * * @param currentJob * @return JobConfig */ private JobConfig readJobConfig(File currentJob) throws XStreamException { XStream xstream = getXStreamJobConfig(); JobConfig jobConfig = (JobConfig) xstream.fromXML(currentJob); return jobConfig; } /** * Return NONE (No processor), ALIVE (Processor still active) or DEAD * (Processor hasn't updated status file for too long). * * @return ProcessorStatus: NONE, ALIVE or DEAD. */ private synchronized ProcessorStatus processorStatus() { File statusFile = new File(this.queuePath, PROCESSOR_STATUS_FILE); if (!statusFile.exists()) { return QueueProcessorCronJob.ProcessorStatus.NONE; } else { long lastModified = statusFile.lastModified(); if (System.currentTimeMillis() - lastModified > PROCESSOR_STATUS_FILE_STALE) { return QueueProcessorCronJob.ProcessorStatus.DEAD; } else { return QueueProcessorCronJob.ProcessorStatus.ALIVE; } } } /** * We're done, delete status file. */ private synchronized void deleteProcessorStatus() { File pStatusFile = new File(this.queuePath, PROCESSOR_STATUS_FILE); pStatusFile.delete(); } /** * Update status file. * * @param jobName * @param started * @param totalTasks * @param completedTasks * @param currentTaskStartedAt */ private synchronized void writeProcessorStatus(String jobName, DateTime started, int totalTasks, int completedTasks) { File pStatusFile = new File(this.queuePath, PROCESSOR_STATUS_FILE); String status = String.format("<processor id=\"%s\" job-name=\"%s\" started=\"%s\" tasks=\"%d\" tasks-completed=\"%d\"/>", Thread.currentThread().getId(), jobName, started.toString(), totalTasks, completedTasks); try { FileUtils.writeStringToFile(pStatusFile, status, "UTF-8"); } catch (IOException ex) { Logger.getLogger(QueueProcessorCronJob.class.getName()).log(Level.SEVERE, null, ex); } } /** * Return File object for parent/path, creating it if necessary. * * @param parent * @param path * @return Resulting File object. */ private File getOrCreateDirectory(File parent, String path) { File dir = new File(parent, path); if (!dir.exists()) { dir.mkdirs(); } return dir; } /** * Move file from one File object to another File object, deleting an * already existing file if necessary. * * @param fromFile * @param toFile * @throws IOException */ private void moveFileTo(File fromFile, File toFile) throws IOException { if (toFile.isFile()) { FileUtils.forceDelete(toFile); } if (!fromFile.renameTo(toFile)) { this.getLogger().error(String.format("Could not move file \"%s\" to \"%s\"", fromFile.getAbsolutePath(), toFile.getAbsoluteFile())); } } /** * Get oldest job (file named "job-*.xml") in dir, using lastModified * timestamp and picking first File if there is more than one file with the * same lastModified. * * @param dir * @return */ protected File getOldestJobFile(File dir) { if (dir == null || !dir.isDirectory()) { return null; } File[] files = dir.listFiles((FileFilter) new WildcardFileFilter("job-*.xml")); if (files.length == 0) { return null; } Arrays.sort(files, new Comparator<File>() { public int compare(File file1, File file2) { return Long.valueOf(file1.lastModified()).compareTo(file2.lastModified()); } }); return files[0]; } private void writeOutputStream(OutputStream os, String msg) { // synchronized (os) { try { os.write(msg.getBytes()); } catch (IOException ex) { Logger.getLogger(QueueProcessorCronJob.class.getName()).log(Level.SEVERE, null, ex); } } /** * Classes used by XStream for loading the job-*.xml config files into. */ public static class Task { public String id; public String uri; public Task() { } } public static class JobConfig { // <job id="id" name="job name" description="job description" // created="datetime" max-concurrent="n">tasks...</job> public String id; public String name; public String description; public Date created; public Integer maxConcurrent; public Task[] tasks; public JobConfig() { } } /** * Set some XStream options to configure serialization. * @return The configured XStream object. */ public static XStream getXStreamJobConfig() { // <job id="..." name="test-job" created="20140613T11:45:00" max-concurrent="3" description="..."> // <tasks> // <task id="task-1"> // </task> // </job> XStream xstream = new XStream(new DomDriver()); // ISO8601DateConverter xstream.registerConverter(new ISO8601DateConverter()); xstream.alias("job", JobConfig.class); xstream.useAttributeFor(JobConfig.class, "id"); xstream.useAttributeFor(JobConfig.class, "name"); xstream.useAttributeFor(JobConfig.class, "description"); xstream.useAttributeFor(JobConfig.class, "created"); xstream.useAttributeFor(JobConfig.class, "maxConcurrent"); xstream.aliasField("max-concurrent", JobConfig.class, "maxConcurrent"); xstream.alias("task", Task.class); xstream.useAttributeFor(Task.class, "id"); return xstream; } public static class JodaTimeConverter implements Converter { @Override @SuppressWarnings("unchecked") public boolean canConvert(final Class type) { return DateTime.class.isAssignableFrom(type); } @Override public void marshal(Object source, HierarchicalStreamWriter writer, MarshallingContext context) { writer.setValue(source.toString()); } @Override @SuppressWarnings("unchecked") public Object unmarshal(HierarchicalStreamReader reader, UnmarshallingContext context) { return new DateTime(reader.getValue()); } } }
package org.jetbrains.plugins.scala.compiler; import com.intellij.compiler.OutputParser; import com.intellij.compiler.impl.javaCompiler.FileObject; import com.intellij.openapi.compiler.CompilerMessageCategory; import com.intellij.openapi.vfs.LocalFileSystem; import com.intellij.openapi.vfs.VirtualFileManager; import org.jetbrains.annotations.NonNls; import org.jetbrains.annotations.NotNull; import static org.jetbrains.plugins.scala.compiler.ScalacOutputParser.MESSAGE_TYPE.*; import java.io.File; import java.util.ArrayList; import java.util.Set; import java.util.HashSet; import java.util.Arrays; /** * @author ilyas */ class ScalacOutputParser extends OutputParser { @NonNls private static final String ourErrorMarker = " error:"; @NonNls private static final String ourWarningMarker = " warning:"; @NonNls private static final String ourInfoMarkerStart = "["; @NonNls private static final String ourInfoMarkerEnd = "]"; @NonNls private static final String ourWroteMarker = "wrote "; @NonNls private static final String ourColumnMarker = "^"; @NonNls private static final String ourParsingMarker = "parsing "; @NonNls private static final String ourScalaInternalErrorMsg = "Scalac internal error"; // Phases @NonNls private static final String PHASE = "running phase "; @NonNls private static final String PARSER_ON = "parser on "; @NonNls private static Set<String> PHASES = new HashSet<String>(); static { PHASES.addAll(Arrays.asList( "parser", "namer", "typer", "superaccessors", "pickler", "refchecks", "liftcode", "uncurry", "tailcalls", "explicitouter", "cleanup", "total", "inliner", "jvm", "closelim", "inliner", "dce", "mixin", "flatten", "constructors", "erasure", "lazyvals", "lambdalift" )); } private boolean mustProcessMsg = false; private boolean fullCrash = false; private boolean stopProcessing = false; private int myMsgColumnMarker; private MESSAGE_TYPE myMsgType = PLAIN; private ArrayList<String> myWrittenList = new ArrayList<String>(); private final Object WRITTEN_LIST_LOCK = new Object(); static enum MESSAGE_TYPE { ERROR, WARNING, PLAIN } private Integer myLineNumber; private String myMessage; private String myUrl; @Override public boolean processMessageLine(Callback callback) { final String line = callback.getNextLine(); if (line == null) { flushWrittenList(callback); return false; } String text = line.trim(); if (fullCrash && text.length( ) > 0) { callback.message(CompilerMessageCategory.ERROR, text, "", 0, 0); return true; } if (text.endsWith("\r\n")) text = text.substring(0, text.length() - 2); if (text.startsWith(ourScalaInternalErrorMsg)) { callback.message(CompilerMessageCategory.ERROR, text, "", 0, 0); fullCrash = true; return true; } // Add error message to output if (myMessage != null && stopMsgProcessing(text) && (mustProcessMsg || stopProcessing)) { myMsgColumnMarker = myMsgColumnMarker > 0 ? myMsgColumnMarker : 1; if (myMsgType == ERROR) { callback.message(CompilerMessageCategory.ERROR, myMessage, myUrl, myLineNumber, myMsgColumnMarker); } else if (myMsgType == WARNING) { callback.message(CompilerMessageCategory.WARNING, myMessage, myUrl, myLineNumber, myMsgColumnMarker); } myMessage = null; myMsgType = PLAIN; mustProcessMsg = false; stopProcessing = false; } if (text.indexOf(ourErrorMarker) > 0) { // new error occurred processErrorMesssage(text, text.indexOf(ourErrorMarker), ERROR, callback); } else if (text.indexOf(ourWarningMarker) > 0) { processErrorMesssage(text, text.indexOf(ourWarningMarker), WARNING, callback); } else if (!text.startsWith(ourInfoMarkerStart)) { // continuing process [error | warning] message if (mustProcessMsg) { if (ourColumnMarker.equals(text.trim())) { myMsgColumnMarker = line.indexOf(ourColumnMarker) + 1; stopProcessing = true; } else if (myMessage != null) { if (myMsgType != WARNING) { myMessage += "\n" + text; } } else { mustProcessMsg = false; } } } else { //verbose compiler output mustProcessMsg = false; if (text.endsWith(ourInfoMarkerEnd)) { String info = text.substring(ourInfoMarkerStart.length(), text.length() - ourInfoMarkerEnd.length()); if (info.startsWith(ourParsingMarker)) { //parsing callback.setProgressText(info); // Set file processed callback.fileProcessed(info.substring(info.indexOf(ourParsingMarker) + ourParsingMarker.length())); } //add phases and their times to output else if (getPhaseName(info) != null) { callback.setProgressText("Phase " + getPhaseName(info) + " passed" + info.substring(getPhaseName(info).length())); } else if (info.startsWith("loaded")) { if (info.startsWith("loaded class file ")) { // Loaded file final int end = info.indexOf(".class") + ".class".length(); final int begin = info.substring(0, end - 1).lastIndexOf("/") + 1; callback.setProgressText("Loaded file " + info.substring(begin, end)); } else if (info.startsWith("loaded directory path ")) { final int end = info.indexOf(".jar") + ".jar".length(); final int begin = info.substring(0, end - 1).lastIndexOf("/") + 1; callback.setProgressText("Loaded directory path " + info.substring(begin, end)); } // callback.setProgressText("Loading files..."); } else if (info.startsWith(ourWroteMarker)) { callback.setProgressText(info); String outputPath = info.substring(ourWroteMarker.length()); final String path = outputPath.replace(File.separatorChar, '/'); // callback.fileGenerated(path); synchronized (WRITTEN_LIST_LOCK) { myWrittenList.add(path); } } } } return true; } private static String getPhaseName(@NotNull String st) { for (String phase : PHASES) { if (st.startsWith(phase + " ")) return phase; } return null; } public void flushWrittenList(Callback callback) { synchronized (WRITTEN_LIST_LOCK) { //ensure that all "written" files are really written for (String s : myWrittenList) { File out = new File(s); callback.fileGenerated(new FileObject(out)); } myWrittenList.clear(); } } private boolean stopMsgProcessing(String text) { return text.startsWith(ourInfoMarkerStart) && !text.trim().equals(ourColumnMarker) || text.indexOf(ourErrorMarker) > 0 || text.indexOf(ourWarningMarker) > 0 || stopProcessing; } /* Collect information about error occurrence */ private void processErrorMesssage(String text, int errIndex, MESSAGE_TYPE msgType, Callback callback) { String errorPlace = text.substring(0, errIndex); if (errorPlace.endsWith(":")) errorPlace = errorPlace.substring(0, errorPlace.length() - 1); //hack over compiler output int j = errorPlace.lastIndexOf(':'); if (j > 0) { myUrl = VirtualFileManager.constructUrl(LocalFileSystem.PROTOCOL, errorPlace.substring(0, j).replace(File.separatorChar, '/')); try { myLineNumber = Integer.valueOf(errorPlace.substring(j + 1, errorPlace.length())); myMessage = text.substring(errIndex + 1).trim(); mustProcessMsg = true; myMsgType = msgType; } catch (NumberFormatException e) { callback.message(CompilerMessageCategory.INFORMATION, "", text, -1, -1); myMessage = null; mustProcessMsg = false; myMsgType = PLAIN; } } else { callback.message(CompilerMessageCategory.INFORMATION, "", text, -1, -1); myMsgType = PLAIN; } } public boolean isTrimLines() { return false; } }
package main.java.elegit; import org.eclipse.jgit.api.Git; import org.eclipse.jgit.api.TransportCommand; import org.eclipse.jgit.transport.UsernamePasswordCredentialsProvider; import org.junit.After; import org.junit.Before; import org.junit.Rule; import org.junit.Test; import org.junit.rules.ExpectedException; import java.io.File; import java.io.FileWriter; import java.io.PrintWriter; import java.nio.file.Files; import java.nio.file.Path; import java.nio.file.Paths; import java.util.NoSuchElementException; import java.util.Scanner; import static org.junit.Assert.*; public class AuthenticatedCloneTest { private Path directoryPath; private String testFileLocation; @Before public void setUp() throws Exception { this.directoryPath = Files.createTempDirectory("unitTestRepos"); directoryPath.toFile().deleteOnExit(); testFileLocation = System.getProperty("user.home") + File.separator + "elegitTests" + File.separator; } @After public void tearDown() throws Exception { } @Test public void testCloneHttpNoPassword() throws Exception { Path repoPath = directoryPath.resolve("testrepo"); // Clone from dummy repo: String remoteURL = "https://github.com/TheElegitTeam/TestRepository.git"; ClonedRepoHelper helper = new ClonedRepoHelper(repoPath, remoteURL); assertNotNull(helper); } @Test public void testLsHttpNoPassword() throws Exception { TransportCommand command = Git.lsRemoteRepository().setRemote("https://github.com/TheElegitTeam/TestRepository.git"); command.call(); } /* The httpUsernamePassword should contain three lines, containing: repo http(s) address username password */ @Test public void testHttpUsernamePassword() throws Exception { Path repoPath = directoryPath.resolve("testrepo"); File authData = new File(testFileLocation + "httpUsernamePassword.txt"); // If a developer does not have this file present, test should just pass. if (!authData.exists()) return; Scanner scanner = new Scanner(authData); String remoteURL = scanner.next(); String username = scanner.next(); String password = scanner.next(); UsernamePasswordCredentialsProvider credentials = new UsernamePasswordCredentialsProvider(username, password); ClonedRepoHelper helper = new ClonedRepoHelper(repoPath, remoteURL, credentials); helper.fetch(); Path fileLocation = repoPath.resolve("README.md"); System.out.println(fileLocation); FileWriter fw = new FileWriter(fileLocation.toString(), true); fw.write("1"); fw.close(); helper.addFilePath(fileLocation); helper.commit("Appended to file"); helper.pushAll(); helper.pushTags(); } @Test public void testLshHttpUsernamePasswordPublic() throws Exception { testLsHttpUsernamePassword("httpUsernamePassword.txt"); } @Test public void testLshHttpUsernamePasswordPrivate() throws Exception { testLsHttpUsernamePassword("httpUsernamePasswordPrivate.txt"); } public void testLsHttpUsernamePassword(String filename) throws Exception { File authData = new File(testFileLocation + filename); // If a developer does not have this file present, test should just pass. if (!authData.exists()) return; Scanner scanner = new Scanner(authData); String remoteURL = scanner.next(); String username = scanner.next(); String password = scanner.next(); UsernamePasswordCredentialsProvider credentials = new UsernamePasswordCredentialsProvider(username, password); TransportCommand command = Git.lsRemoteRepository().setRemote(remoteURL); RepoHelper.wrapAuthentication(command, credentials); command.call(); } /* The sshPassword should contain two lines: repo ssh address password */ @Test public void testLsSshPassword() throws Exception { Path repoPath = directoryPath.resolve("testrepo"); File authData = new File(testFileLocation + "sshPassword.txt"); // If a developer does not have this file present, test should just pass. if (!authData.exists()) return; Scanner scanner = new Scanner(authData); String remoteURL = scanner.next(); String password = scanner.next(); TransportCommand command = Git.lsRemoteRepository().setRemote(remoteURL); RepoHelper.wrapAuthentication(command, password); command.call(); } @Rule public ExpectedException exception = ExpectedException.none(); @Test public void testSshPassword() throws Exception { Path repoPath = directoryPath.resolve("testrepo"); File authData = new File(testFileLocation + "sshPassword.txt"); // If a developer does not have this file present, test should just pass. if (!authData.exists()) return; Scanner scanner = new Scanner(authData); String remoteURL = scanner.next(); String password = scanner.next(); ClonedRepoHelper helper = new ClonedRepoHelper(repoPath, remoteURL, password); helper.fetch(); helper.pushAll(); helper.pushTags(); SessionModel sm = SessionModel.getSessionModel(); String pathname = repoPath.toString(); assertEquals(sm.getAuthPref(pathname), AuthMethod.SSHPASSWORD); assertNotEquals(sm.getAuthPref(pathname), AuthMethod.HTTPS); sm.removeAuthPref(pathname); exception.expect(NoSuchElementException.class); exception.expectMessage("AuthPref not present"); sm.getAuthPref(pathname); } }
package rapanui.core; import java.util.Collection; import java.util.List; import java.util.function.IntFunction; import java.util.function.BiConsumer; class Patterns { public static <T> boolean addToSet(Collection<T> set, T item) { if (!set.contains(item)) { set.add(item); return true; } return false; } public static <T> boolean removeWithCheck(Collection<T> collection, T item) { if (collection.contains(item)) { collection.remove(item); return true; } return false; } public static <T> boolean removeWithCheck(List<T> collection, int index) { if (0 <= index && index < collection.size()) { collection.remove(index); return true; } return false; } public static <T> T[] listToArray(Collection<T> collection, IntFunction<T[]> constructor) { return collection.toArray(constructor.apply(collection.size())); } public static <TObserver, TArgument> void notifyObservers( Iterable<TObserver> observers, BiConsumer<TObserver, TArgument> listeningMethod, TArgument argument) { assert observers != null; assert listeningMethod != null; for (TObserver observer : observers) { if (observer != null) listeningMethod.accept(observer, argument); } } }
package grakn.core.server.rpc; import brave.ScopedSpan; import brave.Span; import brave.propagation.TraceContext; import com.google.common.util.concurrent.ThreadFactoryBuilder; import grakn.benchmark.lib.instrumentation.ServerTracing; import grakn.core.api.Transaction.Type; import grakn.core.concept.Concept; import grakn.core.concept.ConceptId; import grakn.core.concept.Label; import grakn.core.concept.thing.Attribute; import grakn.core.concept.type.AttributeType; import grakn.core.concept.type.EntityType; import grakn.core.concept.type.RelationType; import grakn.core.concept.type.Role; import grakn.core.concept.type.Rule; import grakn.core.protocol.SessionProto; import grakn.core.protocol.SessionProto.Transaction; import grakn.core.protocol.SessionServiceGrpc; import grakn.core.server.deduplicator.AttributeDeduplicatorDaemon; import grakn.core.server.exception.TransactionException; import grakn.core.server.session.SessionImpl; import grakn.core.server.session.TransactionOLTP; import graql.lang.Graql; import graql.lang.pattern.Pattern; import graql.lang.query.GraqlQuery; import io.grpc.Status; import io.grpc.stub.StreamObserver; import org.slf4j.Logger; import org.slf4j.LoggerFactory; import javax.annotation.Nullable; import java.util.Collection; import java.util.HashMap; import java.util.HashSet; import java.util.Iterator; import java.util.Map; import java.util.Set; import java.util.UUID; import java.util.concurrent.ConcurrentHashMap; import java.util.concurrent.ExecutionException; import java.util.concurrent.ExecutorService; import java.util.concurrent.Executors; import java.util.concurrent.ThreadFactory; import java.util.concurrent.TimeUnit; import java.util.concurrent.atomic.AtomicBoolean; import java.util.concurrent.atomic.AtomicInteger; import java.util.stream.Stream; /** * Grakn RPC Session Service */ public class SessionService extends SessionServiceGrpc.SessionServiceImplBase { private final OpenRequest requestOpener; private final Map<String, SessionImpl> openSessions; private AttributeDeduplicatorDaemon attributeDeduplicatorDaemon; private Set<TransactionListener> transactionListenerSet; public SessionService(OpenRequest requestOpener, AttributeDeduplicatorDaemon attributeDeduplicatorDaemon) { this.requestOpener = requestOpener; this.attributeDeduplicatorDaemon = attributeDeduplicatorDaemon; this.openSessions = new HashMap<>(); this.transactionListenerSet = new HashSet<>(); } /** * Close all open transactions, sessions and connections with clients - this is invoked by JVM shutdown hook */ public void shutdown(){ transactionListenerSet.forEach(transactionListener -> transactionListener.close(null)); transactionListenerSet.clear(); openSessions.values().forEach(SessionImpl::close); } @Override public StreamObserver<Transaction.Req> transaction(StreamObserver<Transaction.Res> responseSender) { TransactionListener transactionListener = new TransactionListener(responseSender, attributeDeduplicatorDaemon, openSessions); transactionListenerSet.add(transactionListener); return transactionListener; } @Override public void open(SessionProto.Session.Open.Req request, StreamObserver<SessionProto.Session.Open.Res> responseObserver) { try { String keyspace = request.getKeyspace(); SessionImpl session = requestOpener.open(request); String sessionId = keyspace + UUID.randomUUID().toString(); openSessions.put(sessionId, session); responseObserver.onNext(SessionProto.Session.Open.Res.newBuilder().setSessionId(sessionId).build()); responseObserver.onCompleted(); } catch (RuntimeException e) { responseObserver.onError(ResponseBuilder.exception(e)); } } @Override public void close(SessionProto.Session.Close.Req request, StreamObserver<SessionProto.Session.Close.Res> responseObserver) { try { SessionImpl session = openSessions.remove(request.getSessionId()); session.close(); responseObserver.onNext(SessionProto.Session.Close.Res.newBuilder().build()); responseObserver.onCompleted(); } catch (RuntimeException e) { responseObserver.onError(ResponseBuilder.exception(e)); } } /** * A StreamObserver that implements the transaction-handling behaviour for io.grpc.Server. * Receives a stream of Transaction.Reqs and returning a stream of Transaction.Ress. */ class TransactionListener implements StreamObserver<Transaction.Req> { final Logger LOG = LoggerFactory.getLogger(TransactionListener.class); private final StreamObserver<Transaction.Res> responseSender; private final AtomicBoolean terminated = new AtomicBoolean(false); private final ExecutorService threadExecutor; private AttributeDeduplicatorDaemon attributeDeduplicatorDaemon; private final Map<String, SessionImpl> openSessions; private final Iterators iterators = new Iterators(); @Nullable private TransactionOLTP tx = null; private String sessionId; TransactionListener(StreamObserver<Transaction.Res> responseSender, AttributeDeduplicatorDaemon attributeDeduplicatorDaemon, Map<String, SessionImpl> openSessions) { this.responseSender = responseSender; ThreadFactory threadFactory = new ThreadFactoryBuilder().setNameFormat("transaction-listener-%s").build(); this.threadExecutor = Executors.newSingleThreadExecutor(threadFactory); this.attributeDeduplicatorDaemon = attributeDeduplicatorDaemon; this.openSessions = openSessions; } private <T> T nonNull(@Nullable T item) { if (item == null) { throw ResponseBuilder.exception(Status.FAILED_PRECONDITION); } else { return item; } } @Override public void onNext(Transaction.Req request) { // !important: this is the gRPC thread try { if (ServerTracing.tracingEnabledFromMessage(request)) { TraceContext receivedTraceContext = ServerTracing.extractTraceContext(request); Span queueSpan = ServerTracing.createChildSpanWithParentContext("Server receive queue", receivedTraceContext); queueSpan.start(); queueSpan.tag("childNumber", "0"); // hop context & active Span across thread boundaries submit(() -> handleRequest(request, queueSpan, receivedTraceContext)); } else { submit(() -> handleRequest(request)); } } catch (RuntimeException e) { close(e); } } @Override public void onError(Throwable t) { transactionListenerSet.remove(this); // This method is invoked when a client abruptly terminates a connection to the server // so we want to make sure to also close and delete the session to which this transaction is associated to. SessionImpl session = openSessions.remove(sessionId); session.close(); close(t); } @Override public void onCompleted() { transactionListenerSet.remove(this); close(null); } private void handleRequest(Transaction.Req request, Span queueSpan, TraceContext context) { /* this method variant is only called if tracing is active */ // close the Span from gRPC thread queueSpan.finish(); // time spent in queue // create a new scoped span ScopedSpan span = ServerTracing.startScopedChildSpanWithParentContext("Server handle request", context); span.tag("childNumber", "1"); handleRequest(request); } private void handleRequest(Transaction.Req request) { switch (request.getReqCase()) { case OPEN_REQ: open(request.getOpenReq()); break; case COMMIT_REQ: commit(); break; case QUERY_REQ: query(request.getQueryReq()); break; case ITERATE_REQ: next(request.getIterateReq()); break; case GETSCHEMACONCEPT_REQ: getSchemaConcept(request.getGetSchemaConceptReq()); break; case GETCONCEPT_REQ: getConcept(request.getGetConceptReq()); break; case GETATTRIBUTES_REQ: getAttributes(request.getGetAttributesReq()); break; case PUTENTITYTYPE_REQ: putEntityType(request.getPutEntityTypeReq()); break; case PUTATTRIBUTETYPE_REQ: putAttributeType(request.getPutAttributeTypeReq()); break; case PUTRELATIONTYPE_REQ: putRelationType(request.getPutRelationTypeReq()); break; case PUTROLE_REQ: putRole(request.getPutRoleReq()); break; case PUTRULE_REQ: putRule(request.getPutRuleReq()); break; case CONCEPTMETHOD_REQ: conceptMethod(request.getConceptMethodReq()); break; default: case REQ_NOT_SET: throw ResponseBuilder.exception(Status.INVALID_ARGUMENT); } } public void close(@Nullable Throwable error) { submit(() -> { if (tx != null) { tx.close(); } }); if (!terminated.getAndSet(true)) { if (error != null) { LOG.error("Runtime Exception in RPC TransactionListener: ", error); responseSender.onError(ResponseBuilder.exception(error)); } else { responseSender.onCompleted(); } } // just in case there's a trailing span, let's close it if (ServerTracing.tracingActive()) { ServerTracing.currentSpan().finish(); } threadExecutor.shutdownNow(); try { boolean terminated = threadExecutor.awaitTermination(30, TimeUnit.SECONDS); if (!terminated) { LOG.warn("Some tasks did not terminate within the timeout period."); } } catch (InterruptedException e) { Thread.currentThread().interrupt(); } } private void submit(Runnable runnable) { try { threadExecutor.submit(runnable).get(); } catch (ExecutionException e) { Throwable cause = e.getCause(); assert cause instanceof RuntimeException : "No checked exceptions are thrown, because it's a `Runnable`"; throw (RuntimeException) cause; } catch (InterruptedException e) { Thread.currentThread().interrupt(); } } private void open(Transaction.Open.Req request) { if (tx != null) { throw ResponseBuilder.exception(Status.FAILED_PRECONDITION); } sessionId = request.getSessionId(); SessionImpl session = openSessions.get(sessionId); Type type = Type.of(request.getType().getNumber()); if (type != null && type.equals(Type.WRITE)) { tx = session.transaction().write(); } else if (type != null && type.equals(Type.READ)) { tx = session.transaction().read(); } else { throw TransactionException.create("Invalid Transaction Type"); } Transaction.Res response = ResponseBuilder.Transaction.open(); onNextResponse(response); } private void commit() { /* permanent tracing hooks one method down */ tx().commitAndGetLogs().ifPresent(commitLog -> commitLog.attributes().forEach((attributeIndex, conceptIds) -> conceptIds.forEach(id -> attributeDeduplicatorDaemon.markForDeduplication(commitLog.keyspace(), attributeIndex, id)) )); onNextResponse(ResponseBuilder.Transaction.commit()); } private void query(SessionProto.Transaction.Query.Req request) { /* permanent tracing hooks, as performance here varies depending on query and what's in the graph */ int parseQuerySpanId = ServerTracing.startScopedChildSpan("Parsing Graql Query"); GraqlQuery query = Graql.parse(request.getQuery()); ServerTracing.closeScopedChildSpan(parseQuerySpanId); int createStreamSpanId = ServerTracing.startScopedChildSpan("Creating query stream"); Stream<Transaction.Res> responseStream = tx().stream(query, request.getInfer().equals(Transaction.Query.INFER.TRUE)).map(ResponseBuilder.Transaction.Iter::query); Transaction.Res response = ResponseBuilder.Transaction.queryIterator(iterators.add(responseStream.iterator())); ServerTracing.closeScopedChildSpan(createStreamSpanId); onNextResponse(response); } private void getSchemaConcept(Transaction.GetSchemaConcept.Req request) { Concept concept = tx().getSchemaConcept(Label.of(request.getLabel())); Transaction.Res response = ResponseBuilder.Transaction.getSchemaConcept(concept); onNextResponse(response); } private void getConcept(Transaction.GetConcept.Req request) { Concept concept = tx().getConcept(ConceptId.of(request.getId())); Transaction.Res response = ResponseBuilder.Transaction.getConcept(concept); onNextResponse(response); } private void getAttributes(Transaction.GetAttributes.Req request) { Object value = request.getValue().getAllFields().values().iterator().next(); Collection<Attribute<Object>> attributes = tx().getAttributesByValue(value); Iterator<Transaction.Res> iterator = attributes.stream().map(ResponseBuilder.Transaction.Iter::getAttributes).iterator(); int iteratorId = iterators.add(iterator); Transaction.Res response = ResponseBuilder.Transaction.getAttributesIterator(iteratorId); onNextResponse(response); } private void putEntityType(Transaction.PutEntityType.Req request) { EntityType entityType = tx().putEntityType(Label.of(request.getLabel())); Transaction.Res response = ResponseBuilder.Transaction.putEntityType(entityType); onNextResponse(response); } private void putAttributeType(Transaction.PutAttributeType.Req request) { Label label = Label.of(request.getLabel()); AttributeType.DataType<?> dataType = ResponseBuilder.Concept.DATA_TYPE(request.getDataType()); AttributeType<?> attributeType = tx().putAttributeType(label, dataType); Transaction.Res response = ResponseBuilder.Transaction.putAttributeType(attributeType); onNextResponse(response); } private void putRelationType(Transaction.PutRelationType.Req request) { RelationType relationType = tx().putRelationType(Label.of(request.getLabel())); Transaction.Res response = ResponseBuilder.Transaction.putRelationType(relationType); onNextResponse(response); } private void putRole(Transaction.PutRole.Req request) { Role role = tx().putRole(Label.of(request.getLabel())); Transaction.Res response = ResponseBuilder.Transaction.putRole(role); onNextResponse(response); } private void putRule(Transaction.PutRule.Req request) { Label label = Label.of(request.getLabel()); Pattern when = Graql.parsePattern(request.getWhen()); Pattern then = Graql.parsePattern(request.getThen()); Rule rule = tx().putRule(label, when, then); Transaction.Res response = ResponseBuilder.Transaction.putRule(rule); onNextResponse(response); } private TransactionOLTP tx() { return nonNull(tx); } private void conceptMethod(Transaction.ConceptMethod.Req request) { Concept concept = nonNull(tx().getConcept(ConceptId.of(request.getId()))); Transaction.Res response = ConceptMethod.run(concept, request.getMethod(), iterators, tx()); onNextResponse(response); } private void next(Transaction.Iter.Req iterate) { int iteratorId = iterate.getId(); Transaction.Res response = iterators.next(iteratorId); if (response == null) throw ResponseBuilder.exception(Status.FAILED_PRECONDITION); onNextResponse(response); } private void onNextResponse(Transaction.Res response) { if (ServerTracing.tracingActive()) { ServerTracing.currentSpan().finish(); } responseSender.onNext(response); } } /** * Contains a mutable map of iterators of Transaction.Res for gRPC. These iterators are used for returning * lazy, streaming responses such as for Graql query results. */ class Iterators { private final AtomicInteger iteratorIdCounter = new AtomicInteger(1); private final Map<Integer, Iterator<Transaction.Res>> iterators = new ConcurrentHashMap<>(); public int add(Iterator<Transaction.Res> iterator) { int iteratorId = iteratorIdCounter.getAndIncrement(); iterators.put(iteratorId, iterator); return iteratorId; } public Transaction.Res next(int iteratorId) { Iterator<Transaction.Res> iterator = iterators.get(iteratorId); if (iterator == null) return null; Transaction.Res response; if (iterator.hasNext()) { response = iterator.next(); } else { response = SessionProto.Transaction.Res.newBuilder() .setIterateRes(SessionProto.Transaction.Iter.Res.newBuilder() .setDone(true)).build(); stop(iteratorId); } return response; } public void stop(int iteratorId) { iterators.remove(iteratorId); } } }
package readinstruction; import java.util.UUID; public class ReadInstructionBuilder { private UUID instructionId; private int readAddress; private int arrivalTime = 0; private boolean hasDeadline = false; public ReadInstructionBuilder withInstructionId(UUID id){ this.instructionId = instructionId; return this; } public ReadInstructionBuilder withReadAddress(int readAddres){ this.readAddress = readAddres; return this; } public ReadInstructionBuilder withArrivalTime(int arrivalTime){ this.arrivalTime = arrivalTime; return this; } public ReadInstructionBuilder withDeadline(){ this.hasDeadline = true; return this; } }
package test55; import java.io.File; import java.util.concurrent.Executors; import com.embeddedunveiled.serial.SerialComManager; import com.embeddedunveiled.serial.SerialComManager.BAUDRATE; import com.embeddedunveiled.serial.SerialComManager.DATABITS; import com.embeddedunveiled.serial.SerialComManager.FLOWCONTROL; import com.embeddedunveiled.serial.SerialComManager.FTPPROTO; import com.embeddedunveiled.serial.SerialComManager.FTPVAR; import com.embeddedunveiled.serial.SerialComManager.PARITY; import com.embeddedunveiled.serial.SerialComManager.STOPBITS; import com.embeddedunveiled.serial.ftp.ISerialComXmodemProgress; import com.embeddedunveiled.serial.ftp.SerialComFTPCMDAbort; class AbortTest implements Runnable { SerialComFTPCMDAbort abort = null; public AbortTest(SerialComFTPCMDAbort bb) { abort = bb; } @Override public void run() { try { Thread.sleep(500); } catch (InterruptedException e) { e.printStackTrace(); } System.out.println("=======ABORTING !======"); abort.abortTransfer(); } } // send file from one thread and receive from other using XMODEM checksum protocol public class Test55 implements ISerialComXmodemProgress { public static SerialComManager scm = null; public static String PORT1 = null; public static String PORT2 = null; public static String sndtxt1 = null; public static String sndtxt2 = null; public static String rcvdiry1 = null; public static String rcvdiry2 = null; public static String rcvdiry3 = null; public static String rcvdiry4 = null; public static String sndjpg1 = null; public static String sndjpg2 = null; public static volatile boolean done = false; public static Test55 test55 = new Test55(); public static void main(String[] args) { try { scm = new SerialComManager(); int osType = scm.getOSType(); if(osType == SerialComManager.OS_LINUX) { PORT1 = "/dev/ttyUSB0"; PORT2 = "/dev/ttyUSB1"; sndtxt1 = "/home/r/ws-host-uart/ftptest/f1.txt"; rcvdiry1 = "/home/r/ws-host-uart/ftptest/xrf1.txt"; sndtxt2 = "/home/r/ws-host-uart/ftptest/xf2.txt"; rcvdiry2 = "/home/r/ws-host-uart/ftptest/xrf2.txt"; sndjpg1 = "/home/r/ws-host-uart/ftptest/f1.jpg"; rcvdiry3 = "/home/r/ws-host-uart/ftptest/xrf1.jpg"; sndjpg2 = "/home/r/ws-host-uart/ftptest/f2.jpg"; rcvdiry4 = "/home/r/ws-host-uart/ftptest/xrf2.jpg"; }else if(osType == SerialComManager.OS_WINDOWS) { PORT1 = "COM51"; PORT2 = "COM52"; }else if(osType == SerialComManager.OS_MAC_OS_X) { PORT1 = "/dev/cu.usbserial-A70362A3"; PORT2 = "/dev/cu.usbserial-A602RDCH"; }else if(osType == SerialComManager.OS_SOLARIS) { PORT1 = null; PORT2 = null; }else{ } PORT1 = "/dev/pts/4"; PORT2 = "/dev/pts/3"; Executors.newSingleThreadExecutor().execute(new Runnable() { @Override public void run() { try { long handle1 = scm.openComPort(PORT1, true, true, true); scm.configureComPortData(handle1, DATABITS.DB_8, STOPBITS.SB_1, PARITY.P_NONE, BAUDRATE.B115200, 0); scm.configureComPortControl(handle1, FLOWCONTROL.NONE, 'x', 'x', false, false); File[] f = new File[1]; f[0] = new File(sndtxt1); Thread.sleep(1000); boolean status1 = scm.sendFile(handle1, f, FTPPROTO.XMODEM, FTPVAR.CHKSUM, true, test55, null); System.out.println("ASCII MODE sent txt status : " + status1); done = true; scm.closeComPort(handle1); }catch (Exception e) { e.printStackTrace(); } } }); long handle2 = scm.openComPort(PORT2, true, true, true); scm.configureComPortData(handle2, DATABITS.DB_8, STOPBITS.SB_1, PARITY.P_NONE, BAUDRATE.B115200, 0); scm.configureComPortControl(handle2, FLOWCONTROL.NONE, 'x', 'x', false, false); boolean status2 = scm.receiveFile(handle2, new File(rcvdiry1), FTPPROTO.XMODEM, FTPVAR.CHKSUM, true, test55, null); System.out.println("ASCII MODE received status txt : " + status2); scm.closeComPort(handle2); while(done == false) { Thread.sleep(10); } System.out.println("\n done = false; Executors.newSingleThreadExecutor().execute(new Runnable() { @Override public void run() { try { long handle3 = scm.openComPort(PORT1, true, true, true); scm.configureComPortData(handle3, DATABITS.DB_8, STOPBITS.SB_1, PARITY.P_NONE, BAUDRATE.B115200, 0); scm.configureComPortControl(handle3, FLOWCONTROL.NONE, 'x', 'x', false, false); File[] f = new File[1]; f[0] = new File(sndtxt2); Thread.sleep(1000); boolean status3 = scm.sendFile(handle3, f, FTPPROTO.XMODEM, FTPVAR.CHKSUM, false, test55, null); System.out.println("BINARY MODE sent txt status : " + status3); done = true; scm.closeComPort(handle3); }catch (Exception e) { e.printStackTrace(); } } }); long handle4 = scm.openComPort(PORT2, true, true, true); scm.configureComPortData(handle4, DATABITS.DB_8, STOPBITS.SB_1, PARITY.P_NONE, BAUDRATE.B115200, 0); scm.configureComPortControl(handle4, FLOWCONTROL.NONE, 'x', 'x', false, false); boolean status4 = scm.receiveFile(handle4, new File(rcvdiry2), FTPPROTO.XMODEM, FTPVAR.CHKSUM, false, test55, null); System.out.println("BINARY MODE received status txt : " + status4); scm.closeComPort(handle4); while(done == false) { Thread.sleep(10); } System.out.println("\n done = false; Executors.newSingleThreadExecutor().execute(new Runnable() { @Override public void run() { try { long handle5 = scm.openComPort(PORT1, true, true, true); scm.configureComPortData(handle5, DATABITS.DB_8, STOPBITS.SB_1, PARITY.P_NONE, BAUDRATE.B115200, 0); scm.configureComPortControl(handle5, FLOWCONTROL.NONE, 'x', 'x', false, false); File[] f = new File[2]; f[0] = new File(sndjpg1); Thread.sleep(1000); boolean status5 = scm.sendFile(handle5, f, FTPPROTO.XMODEM, FTPVAR.CHKSUM, false, test55, null); System.out.println("BINARY MODE sent jpg status : " + status5); done = true; scm.closeComPort(handle5); }catch (Exception e) { e.printStackTrace(); } } }); long handle6 = scm.openComPort(PORT2, true, true, true); scm.configureComPortData(handle6, DATABITS.DB_8, STOPBITS.SB_1, PARITY.P_NONE, BAUDRATE.B115200, 0); scm.configureComPortControl(handle6, FLOWCONTROL.NONE, 'x', 'x', false, false); boolean status6 = scm.receiveFile(handle6, new File(rcvdiry3), FTPPROTO.XMODEM, FTPVAR.CHKSUM, false, test55, null); System.out.println("BINARY MODE received status jpg : " + status6); scm.closeComPort(handle6); while(done == false) { Thread.sleep(10); } System.out.println("\n done = false; Executors.newSingleThreadExecutor().execute(new Runnable() { @Override public void run() { try { long handle5 = scm.openComPort(PORT1, true, true, true); scm.configureComPortData(handle5, DATABITS.DB_8, STOPBITS.SB_1, PARITY.P_NONE, BAUDRATE.B115200, 0); scm.configureComPortControl(handle5, FLOWCONTROL.NONE, 'x', 'x', false, false); File[] f = new File[2]; f[0] = new File(sndjpg2); Thread.sleep(1000); boolean status5 = scm.sendFile(handle5, f, FTPPROTO.XMODEM, FTPVAR.CHKSUM, false, test55, null); System.out.println("BINARY MODE sent jpg status : " + status5); done = true; scm.closeComPort(handle5); }catch (Exception e) { e.printStackTrace(); } } }); long handle7 = scm.openComPort(PORT2, true, true, true); scm.configureComPortData(handle7, DATABITS.DB_8, STOPBITS.SB_1, PARITY.P_NONE, BAUDRATE.B115200, 0); scm.configureComPortControl(handle7, FLOWCONTROL.NONE, 'x', 'x', false, false); boolean status7 = scm.receiveFile(handle7, new File(rcvdiry4), FTPPROTO.XMODEM, FTPVAR.CHKSUM, false, test55, null); System.out.println("BINARY MODE received status jpg : " + status7); scm.closeComPort(handle7); while(done == false) { Thread.sleep(10); } System.out.println("\n } catch (Exception e) { e.printStackTrace(); } } @Override public void onXmodemReceiveProgressUpdate(long arg0) { System.out.println("Receive numBlock : " + arg0); } @Override public void onXmodemSentProgressUpdate(long arg0, int arg1) { System.out.println("Sent numBlock : " + arg0 + " percentOfBlocksSent : " + arg1); } }
package protocolsupport.protocol.storage.netcache; import protocolsupport.utils.Utils; public class MovementCache { protected double x; protected double y; protected double z; protected int teleportConfirmId; public int tryTeleportConfirm(double x, double y, double z) { if (teleportConfirmId == -1) { return -1; } if ((this.x == x) && (this.y == y) && (this.z == z)) { int r = teleportConfirmId; teleportConfirmId = -1; return r; } return -1; } public void setTeleportLocation(double x, double y, double z, int teleportConfirmId) { this.x = x; this.y = y; this.z = z; this.teleportConfirmId = teleportConfirmId; } @Override public String toString() { return Utils.toStringAllFields(this); } }
// This program is free software; you can redistribute it and/or modify // (at your option) any later version. // This program is distributed in the hope that it will be useful, // MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the // along with this program; if not, write to the Free Software // Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA. // For more information contact: // Tab Size = 8 package org.opennms.netmgt.capsd; import java.lang.*; import java.net.InetAddress; import java.net.UnknownHostException; import java.sql.SQLException; import java.sql.Connection; import java.sql.PreparedStatement; import java.sql.ResultSet; import java.util.Map; import java.util.List; import java.util.ArrayList; import java.util.Iterator; import java.util.Date; import org.apache.log4j.Category; import org.opennms.core.utils.ThreadCategory; import org.opennms.netmgt.EventConstants; import org.opennms.netmgt.eventd.EventIpcManagerFactory; import org.opennms.netmgt.capsd.snmp.*; import org.opennms.protocols.snmp.*; import org.opennms.netmgt.config.DatabaseConnectionFactory; import org.opennms.netmgt.config.CapsdConfigFactory; import org.opennms.netmgt.config.CollectdConfigFactory; import org.opennms.netmgt.config.PollerConfigFactory; import org.opennms.netmgt.utils.IPSorter; // These generated by castor import org.opennms.netmgt.xml.event.Event; import org.opennms.netmgt.xml.event.Parm; import org.opennms.netmgt.xml.event.Value; import org.opennms.netmgt.xml.event.Parms; // castor classes generated from the discovery-configuration.xsd import org.opennms.netmgt.config.capsd.*; final class SuspectEventProcessor implements Runnable { /** * SQL statement to retrieve the node identifier for a given IP address */ private static String SQL_RETRIEVE_INTERFACE_NODEID_PREFIX = "SELECT nodeId FROM ipinterface WHERE "; /** * SQL statement to retrieve the ipaddresses for a given node ID */ private final static String SQL_RETRIEVE_IPINTERFACES_ON_NODEID = "SELECT ipaddr FROM ipinterface WHERE nodeid = ?"; private final static String SELECT_METHOD_MIN = "min"; private final static String SELECT_METHOD_MAX = "max"; /** * IP address of new suspect interface */ String m_suspectIf; /** * Constructor. * * @param ifAddress Suspect interface address. */ SuspectEventProcessor(String ifAddress) { // Check the arguments if(ifAddress == null) throw new IllegalArgumentException("The interface address cannot be null"); m_suspectIf = ifAddress; } /** * This method is responsible for determining if a node already exists in the * database for the current interface. If the IfCollector object contains a * valid SNMP collection, an attempt will be made to look up in the database * each interface contained in the SNMP collection's ifTable. If an interface * is found to already exist in the database a DbNodeEntry object will be * created from it and returned. If the IfCollector object does not contain * a valid SNMP collection or if none of the interfaces exist in the database * null is returned. * * @param dbc Connection to the database. * @param collector Interface collector object * * @return dbNodeEntry Returns null if a node does not already exist in the database, * otherwise returns the DbNodeEntry object for the node under which * the current interface/IP address should be added. * * @throws SQLException Thrown if an error occurs retrieving the parent nodeid from * the database. */ private DbNodeEntry getExistingNodeEntry(java.sql.Connection dbc, IfCollector collector ) throws SQLException { Category log = ThreadCategory.getInstance(getClass()); if (log.isDebugEnabled()) log.debug("getExistingNodeEntry: checking for current target: " + collector.getTarget()); // Do we have any additional interface information collected via SNMP? // If not simply return, there is nothing to check if(!collector.hasSnmpCollection() || collector.getSnmpCollector().failed()) return null; // Next verify that ifTable and ipAddrTable entries were collected IfSnmpCollector snmpc = collector.getSnmpCollector(); IfTable ifTable = null; IpAddrTable ipAddrTable = null; if(snmpc.hasIfTable()) ifTable = snmpc.getIfTable(); if (snmpc.hasIpAddrTable()) ipAddrTable = snmpc.getIpAddrTable(); if (ifTable == null || ipAddrTable == null) return null; // SQL statement prefix StringBuffer sqlBuffer = new StringBuffer(SQL_RETRIEVE_INTERFACE_NODEID_PREFIX); boolean firstAddress = true; // Loop through the interface table entries and see if any already exist // in the database. Iterator iter = ifTable.getEntries().iterator(); List ipaddrsOfNewNode = new ArrayList(); List ipaddrsOfOldNode = new ArrayList(); while(iter.hasNext()) { IfTableEntry ifEntry = (IfTableEntry)iter.next(); if (ifEntry.containsKey("ifIndex") != true) { log.debug("getExistingNodeEntry: Breaking from loop"); break; } // Get ifIndex int ifIndex = -1; SnmpInt32 snmpIfIndex = (SnmpInt32)ifEntry.get(IfTableEntry.IF_INDEX); if(snmpIfIndex != null) ifIndex = snmpIfIndex.getValue(); // Get ALL IP Addresses for this ifIndex List ipAddrs = IpAddrTable.getIpAddresses(ipAddrTable.getEntries(), ifIndex); if (log.isDebugEnabled()) log.debug("getExistingNodeEntry: number of interfaces retrieved for ifIndex " + ifIndex + " is: " + ipAddrs.size()); // Get ifType for this interface int ifType = -1; SnmpInt32 snmpIfType = (SnmpInt32)ifEntry.get(IfTableEntry.IF_TYPE); if(snmpIfType != null) ifType = snmpIfType.getValue(); // Iterate over IP address list and add each to the sql buffer Iterator aiter = ipAddrs.iterator(); while (aiter.hasNext()) { InetAddress ipAddress = (InetAddress)aiter.next(); // Skip interface if no IP address or if IP address is "0.0.0.0" // or if this interface is of type loopback if (ipAddress == null || ipAddress.getHostAddress().equals("0.0.0.0") || ipAddress.getHostAddress().startsWith("127.")) continue; if (firstAddress) { sqlBuffer.append("ipaddr='").append(ipAddress.getHostAddress()).append("'"); firstAddress = false; } else sqlBuffer.append(" OR ipaddr='").append(ipAddress.getHostAddress()).append("'"); ipaddrsOfNewNode.add(ipAddress.getHostAddress()); } } // end while // Make sure we added at least one address to the SQL query if (firstAddress) return null; // Prepare the db statement in advance if (log.isDebugEnabled()) log.debug("getExistingNodeEntry: issuing SQL command: " + sqlBuffer.toString()); PreparedStatement stmt = dbc.prepareStatement(sqlBuffer.toString()); // Do any of the IP addrs already exist in the database under another node? int nodeID = -1; try { ResultSet rs = stmt.executeQuery(); if (rs.next()) { nodeID = rs.getInt(1); if (log.isDebugEnabled()) log.debug("getExistingNodeEntry: target " + collector.getTarget().getHostAddress() + nodeID); rs = null; } } catch(SQLException sqlE) { throw sqlE; } finally { try { stmt.close(); // automatically closes the result set as well } catch (Exception e) { // Ignore } } if (nodeID == -1) return null; try { stmt = dbc.prepareStatement(SQL_RETRIEVE_IPINTERFACES_ON_NODEID); stmt.setInt(1, nodeID); ResultSet rs = stmt.executeQuery(); while (rs.next()) { String ipaddr = rs.getString(1); if (!ipaddr.equals("0.0.0.0")) ipaddrsOfOldNode.add(ipaddr); } } catch(SQLException sqlE) { throw sqlE; } finally { try { stmt.close(); // automatically closes the result set as well } catch (Exception e) { // Ignore } } if (ipaddrsOfNewNode.containsAll(ipaddrsOfOldNode)) { if (log.isDebugEnabled()) log.debug("getExistingNodeEntry: found one of the addrs under existing node: " + nodeID); return DbNodeEntry.get(nodeID); } else { String dupIpaddr = getDuplicateIpaddress(ipaddrsOfOldNode, ipaddrsOfNewNode); createAndSendDuplicateIpaddressEvent(nodeID, dupIpaddr); return null; } } /** * This method is used to verify if there is a same ipaddress existing in two sets * of ipaddresses, and return the first ipaddress that is the same in both sets as * a string. * * @param ipListA a collection of ip addresses. * @param ipListB a collection of ip addresses. * * @return the first ipaddress exists in both ipaddress lists. * */ private String getDuplicateIpaddress(List ipListA, List ipListB) { Category log = ThreadCategory.getInstance(getClass()); if (ipListA == null || ipListB == null) return null; String ipaddr = null; Iterator iter = ipListA.iterator(); while (iter.hasNext()) { ipaddr = (String)iter.next(); if (ipListB.contains(ipaddr)) { if (log.isDebugEnabled()) log.debug("getDuplicateIpaddress: get duplicate ip address: " + ipaddr); break; } else ipaddr = null; } return ipaddr; } /** * This method is responsble for inserting a new node into the node table. * * @param dbc Database connection. * @param ifaddr Suspect interface * @param collector Interface collector containing SMB and SNMP info * collected from the remote device. * * @return DbNodeEntry object associated with the newly inserted node * table entry. * * @throws SQLException if an error occurs inserting the new node. */ private DbNodeEntry createNode(Connection dbc, InetAddress ifaddr, IfCollector collector) throws SQLException { Category log = ThreadCategory.getInstance(getClass()); // Determine primary interface for the node. Primary interface // is needed for determining the node label. InetAddress primaryIf = determinePrimaryInterface(collector); // Get Snmp and Smb collector objects IfSnmpCollector snmpc = collector.getSnmpCollector(); IfSmbCollector smbc = collector.getSmbCollector(); // First create a node entry for the new interface DbNodeEntry entryNode = DbNodeEntry.create(); // fill in the node information Date now = new Date(); entryNode.setCreationTime(now); entryNode.setLastPoll(now); entryNode.setNodeType(DbNodeEntry.NODE_TYPE_ACTIVE); entryNode.setLabel(primaryIf.getHostName()); if(entryNode.getLabel().equals(primaryIf.getHostAddress())) entryNode.setLabelSource(DbNodeEntry.LABEL_SOURCE_ADDRESS); else entryNode.setLabelSource(DbNodeEntry.LABEL_SOURCE_HOSTNAME); if(snmpc != null) { if(snmpc.hasSystemGroup()) { SystemGroup sysgrp = snmpc.getSystemGroup(); // sysObjectId entryNode.setSystemOID(sysgrp.get(SystemGroup.SYS_OBJECTID).toString()); // sysName String str = SystemGroup.getPrintableString((SnmpOctetString)sysgrp.get(SystemGroup.SYS_NAME)); if (log.isDebugEnabled()) log.debug("SuspectEventProcessor: " + ifaddr.getHostAddress() + " has sysName: " + str); if(str != null && str.length() > 0) { entryNode.setSystemName(str); // Hostname takes precedence over sysName so only replace label if // hostname was not available. if(entryNode.getLabelSource() == DbNodeEntry.LABEL_SOURCE_ADDRESS) { entryNode.setLabel(str); entryNode.setLabelSource(DbNodeEntry.LABEL_SOURCE_SYSNAME); } } // sysDescription str = SystemGroup.getPrintableString((SnmpOctetString) sysgrp.get(SystemGroup.SYS_DESCR)); if (log.isDebugEnabled()) log.debug("SuspectEventProcessor: " + ifaddr.getHostAddress() + " has sysDescription: " + str); if (str!= null && str.length() > 0) entryNode.setSystemDescription(str); // sysLocation str = SystemGroup.getPrintableString((SnmpOctetString) sysgrp.get(SystemGroup.SYS_LOCATION)); if (log.isDebugEnabled()) log.debug("SuspectEventProcessor: " + ifaddr.getHostAddress() + " has sysLocation: " + str); if(str != null && str.length() > 0) entryNode.setSystemLocation(str); // sysContact str = SystemGroup.getPrintableString((SnmpOctetString) sysgrp.get(SystemGroup.SYS_CONTACT)); if (log.isDebugEnabled()) log.debug("SuspectEventProcessor: " + ifaddr.getHostAddress() + " has sysContact: " + str); if(str != null && str.length() > 0) entryNode.setSystemContact(str); } } // check for SMB information if(smbc != null) { // Netbios Name and Domain // Note: only override if the label source is not HOSTNAME if(smbc.getNbtName() != null && entryNode.getLabelSource() != DbNodeEntry.LABEL_SOURCE_HOSTNAME) { entryNode.setLabel(smbc.getNbtName()); entryNode.setLabelSource(DbNodeEntry.LABEL_SOURCE_NETBIOS); entryNode.setNetBIOSName(entryNode.getLabel()); if (smbc.getDomainName() != null) { entryNode.setDomainName(smbc.getDomainName()); } } // Operating System if(smbc.getOS() != null) { entryNode.setOS(smbc.getOS()); } } entryNode.store(dbc); return entryNode; } /** * This method is responsble for inserting new entries into the ipInterface * table for each interface found to be associated with the suspect interface * during the capabilities scan. * * @param dbc Database connection. * @param node DbNodeEntry object representing the suspect interface's * parent node table entry * @param useExistingNode False if a new node was created for the suspect interface. * True if an existing node entry was found under which the * the suspect interface is to be added. * @param ifaddr Suspect interface * @param collector Interface collector containing SMB and SNMP info * collected from the remote device. * * @throws SQLException if an error occurs adding interfaces to the ipInterface * table. */ private void addInterfaces(Connection dbc, DbNodeEntry node, boolean useExistingNode, InetAddress ifaddr, IfCollector collector) throws SQLException { Category log = ThreadCategory.getInstance(getClass()); CapsdConfigFactory cFactory = CapsdConfigFactory.getInstance(); PollerConfigFactory pollerCfgFactory = PollerConfigFactory.getInstance(); Date now = new Date(); // if there is no snmp information then it's a // simple addtion to the database if(!collector.hasSnmpCollection() || collector.getSnmpCollector().failed()) { DbIpInterfaceEntry ipIfEntry = DbIpInterfaceEntry.create(node.getNodeId(), ifaddr); ipIfEntry.setLastPoll(now); ipIfEntry.setHostname(ifaddr.getHostName()); // NOTE: (reference internal bug# 201) // If the ip is 'managed', it might still be 'not polled' based // on the poller configuration // The package filter evaluation requires that the ip be in the // database - at this point the ip is NOT in db, so insert as active // and update afterward // Try to avoid re-evaluating the ip against filters for // each service, try to get the first package here and use // that for service evaluation boolean addrUnmanaged = cFactory.isAddressUnmanaged(ifaddr); if(addrUnmanaged) ipIfEntry.setManagedState(DbIpInterfaceEntry.STATE_UNMANAGED); else ipIfEntry.setManagedState(DbIpInterfaceEntry.STATE_MANAGED); ipIfEntry.setPrimaryState(DbIpInterfaceEntry.SNMP_NOT_ELIGIBLE); ipIfEntry.store(dbc); // now update if necessary org.opennms.netmgt.config.poller.Package ipPkg = null; if (!addrUnmanaged) { boolean ipToBePolled = false; ipPkg = pollerCfgFactory.getFirstPackageMatch(ifaddr.getHostAddress()); if (ipPkg != null) ipToBePolled = true; if (!ipToBePolled) { // update ismanaged to 'N' in ipinterface ipIfEntry.setManagedState(DbIpInterfaceEntry.STATE_NOT_POLLED); ipIfEntry.store(dbc); } } // Add supported protocols addSupportedProtocols(node, ifaddr, collector.getSupportedProtocols(), addrUnmanaged, -1, ipPkg); } else { IfSnmpCollector snmpc = collector.getSnmpCollector(); // more complicate work needs to be done here. Information must // be looked up in various entrys now! DbIpInterfaceEntry ipIfEntry = DbIpInterfaceEntry.create(node.getNodeId(), ifaddr); ipIfEntry.setLastPoll(now); ipIfEntry.setHostname(ifaddr.getHostName()); // NOTE: (reference internal bug# 201) // If the ip is 'managed', it might still be 'not polled' based // on the poller configuration // The package filter evaluation requires that the ip be in the // database - at this point the ip is NOT in db, so insert as active // and update afterward // Try to avoid re-evaluating the ip against filters for // each service, try to get the first package here and use // that for service evaluation boolean addrUnmanaged = cFactory.isAddressUnmanaged(ifaddr); if(addrUnmanaged) ipIfEntry.setManagedState(DbIpInterfaceEntry.STATE_UNMANAGED); else ipIfEntry.setManagedState(DbIpInterfaceEntry.STATE_MANAGED); ipIfEntry.setPrimaryState(DbIpInterfaceEntry.SNMP_NOT_ELIGIBLE); ipIfEntry.store(dbc); // now update if necessary org.opennms.netmgt.config.poller.Package ipPkg = null; if (!addrUnmanaged) { boolean ipToBePolled = false; ipPkg = pollerCfgFactory.getFirstPackageMatch(ifaddr.getHostAddress()); if (ipPkg != null) ipToBePolled = true; if (!ipToBePolled) { // update ismanaged to 'N' in ipinterface ipIfEntry.setManagedState(DbIpInterfaceEntry.STATE_NOT_POLLED); ipIfEntry.store(dbc); } } int ifIndex = -1; if((ifIndex = snmpc.getIfIndex(ifaddr)) != -1) { // Just set primary state to secondary for now. The primary SNMP interface // won't be selected until after all interfaces have been inserted // into the database. This is because the interface must already be in // the database for filter rule evaluation to succeed. ipIfEntry.setPrimaryState(DbIpInterfaceEntry.SNMP_SECONDARY); ipIfEntry.setIfIndex(ifIndex); int status = snmpc.getAdminStatus(ifIndex); if(status != -1) ipIfEntry.setStatus(status); } else { // Address does not have a valid ifIndex associated with it // so set primary state to NOT_ELIGIBLE. ipIfEntry.setPrimaryState(DbIpInterfaceEntry.SNMP_NOT_ELIGIBLE); } ipIfEntry.store(dbc); // Add supported protocols addSupportedProtocols(node, ifaddr, collector.getSupportedProtocols(), addrUnmanaged, ifIndex, ipPkg); // If the useExistingNode flag is true, then we're done. The interface // is most likely an alias and the subinterfaces collected via SNMP should // already be in the database. if (useExistingNode == true) return; // Made it this far...lets add the sub interfaces Map extraTargets = collector.getAdditionalTargets(); Iterator iter = extraTargets.keySet().iterator(); while(iter.hasNext()) { InetAddress xifaddr = (InetAddress)iter.next(); if (log.isDebugEnabled()) log.debug("addInterfaces: adding interface " + xifaddr.getHostAddress()); DbIpInterfaceEntry xipIfEntry = DbIpInterfaceEntry.create(node.getNodeId(), xifaddr); xipIfEntry.setLastPoll(now); xipIfEntry.setHostname(xifaddr.getHostName()); // NOTE: (reference internal bug# 201) // If the ip is 'managed', it might still be 'not polled' based // on the poller configuration // The package filter evaluation requires that the ip be in the // database - at this point the ip is NOT in db, so insert as active // and update afterward // Try to avoid re-evaluating the ip against filters for // each service, try to get the first package here and use // that for service evaluation boolean xaddrUnmanaged = cFactory.isAddressUnmanaged(xifaddr); if(xaddrUnmanaged) xipIfEntry.setManagedState(DbIpInterfaceEntry.STATE_UNMANAGED); else xipIfEntry.setManagedState(DbIpInterfaceEntry.STATE_MANAGED); int xifIndex = -1; if((xifIndex = snmpc.getIfIndex(xifaddr)) != -1) { xipIfEntry.setIfIndex(xifIndex); int status = snmpc.getAdminStatus(xifIndex); if(status != -1) xipIfEntry.setStatus(status); if (supportsSnmp((List)extraTargets.get(xifaddr))) { // Just set primary state to secondary for now. The primary SNMP interface // won't be selected until after all interfaces have been inserted // into the database. This is because the interface must already be in // the database for filter rule evaluation to succeed. xipIfEntry.setPrimaryState(DbIpInterfaceEntry.SNMP_SECONDARY); } else { xipIfEntry.setPrimaryState(DbIpInterfaceEntry.SNMP_NOT_ELIGIBLE); } } else { // No ifIndex found so set primary state to NOT_ELIGIBLE xipIfEntry.setPrimaryState(DbIpInterfaceEntry.SNMP_NOT_ELIGIBLE); } xipIfEntry.store(dbc); // now update if necessary org.opennms.netmgt.config.poller.Package xipPkg = null; if (!xaddrUnmanaged) { boolean xipToBePolled = false; xipPkg = pollerCfgFactory.getFirstPackageMatch(xifaddr.getHostAddress()); if (xipPkg != null) xipToBePolled = true; if (!xipToBePolled) { // update ismanaged to 'N' in ipinterface xipIfEntry.setManagedState(DbIpInterfaceEntry.STATE_NOT_POLLED); xipIfEntry.store(dbc); } } // add the supported protocols addSupportedProtocols(node, xifaddr, (List)extraTargets.get(xifaddr), xaddrUnmanaged, xifIndex, xipPkg); } // end while() // Now add any non-IP interfaces if (collector.hasNonIpInterfaces()) { iter = ((List)collector.getNonIpInterfaces()).iterator(); while(iter.hasNext()) { SnmpInt32 ifindex = (SnmpInt32)iter.next(); DbIpInterfaceEntry xipIfEntry = null; try { xipIfEntry = DbIpInterfaceEntry.create(node.getNodeId(), InetAddress.getByName("0.0.0.0")); } catch(UnknownHostException e) { continue; } xipIfEntry.setLastPoll(now); xipIfEntry.setManagedState(DbIpInterfaceEntry.STATE_UNMANAGED); xipIfEntry.setIfIndex(ifindex.getValue()); int status = snmpc.getAdminStatus(ifIndex); if(status != -1) xipIfEntry.setStatus(status); xipIfEntry.setPrimaryState(DbIpInterfaceEntry.SNMP_NOT_ELIGIBLE); xipIfEntry.store(dbc); } } // last thing to do is add all the snmp interface information IfTable ift = snmpc.getIfTable(); Iterator ifiter = ift.getEntries().iterator(); while(ifiter.hasNext()) { IfTableEntry ifte = (IfTableEntry)ifiter.next(); // index int xifIndex = -1; SnmpInt32 sint = (SnmpInt32)ifte.get(IfTableEntry.IF_INDEX); if(sint != null) xifIndex = sint.getValue(); else continue; // address // WARNING: IfSnmpCollector.getIfAddressAndMask() ONLY returns // the FIRST IP address and mask for a given interface as specified // in the ipAddrTable. InetAddress[] aaddrs = snmpc.getIfAddressAndMask(sint.getValue()); if(aaddrs == null) { // Must be non-IP interface, set ifAddress to '0.0.0.0' and // Mask to null aaddrs = new InetAddress[2]; try { aaddrs[0] = InetAddress.getByName("0.0.0.0"); } catch (UnknownHostException e) { continue; } aaddrs[1] = null; } // Retrieve ifType so we can check for loopback sint = (SnmpInt32)ifte.get(IfTableEntry.IF_TYPE); int ifType = sint.getValue(); // Skip loopback interfaces if (aaddrs[0].getHostAddress().startsWith("127.")) continue; DbSnmpInterfaceEntry snmpEntry = DbSnmpInterfaceEntry.create(node.getNodeId(), xifIndex); // IP address snmpEntry.setIfAddress(aaddrs[0]); // netmask if (aaddrs[1] != null) snmpEntry.setNetmask(aaddrs[1]); // description String str = SystemGroup.getPrintableString((SnmpOctetString)ifte.get(IfTableEntry.IF_DESCR)); if (log.isDebugEnabled()) log.debug("SuspectEventProcessor: " + aaddrs[0].getHostAddress() + " has ifDescription: " + str); if(str != null && str.length() > 0) snmpEntry.setDescription(str); // physical address StringBuffer sbuf = new StringBuffer(); SnmpOctetString ostr = (SnmpOctetString)ifte.get(IfTableEntry.IF_PHYS_ADDR); byte[] bytes = ostr.getString(); for(int i = 0; i < bytes.length; i++) { sbuf.append(Integer.toHexString(((int)bytes[i] >> 4) & 0xf)); sbuf.append(Integer.toHexString((int)bytes[i] & 0xf)); } String physAddr = sbuf.toString().trim(); if (log.isDebugEnabled()) log.debug("SuspectEventProcessor: " + aaddrs[0].getHostAddress() + " has physical address: -" + physAddr + "-"); if (physAddr.length() == 12) { snmpEntry.setPhysicalAddress(physAddr); } // type snmpEntry.setType(ifType); // speed SnmpUInt32 uint = (SnmpUInt32)ifte.get(IfTableEntry.IF_SPEED); if (uint == null) { snmpEntry.setSpeed(0); } else { snmpEntry.setSpeed((int)uint.getValue()); } // admin status sint = (SnmpInt32)ifte.get(IfTableEntry.IF_ADMIN_STATUS); if (sint == null) { snmpEntry.setAdminStatus(0); } else { snmpEntry.setAdminStatus(sint.getValue()); } // oper status sint = (SnmpInt32)ifte.get(IfTableEntry.IF_OPER_STATUS); if (sint == null) { snmpEntry.setOperationalStatus(0); } else { snmpEntry.setOperationalStatus(sint.getValue()); } // name (from interface extensions table) SnmpOctetString snmpIfName = snmpc.getIfName(xifIndex); if (snmpIfName != null) { String ifName = SystemGroup.getPrintableString(snmpIfName); if (ifName != null && ifName.length() > 0) snmpEntry.setName(ifName); } snmpEntry.store(dbc); } } } /** * Responsible for iterating inserting an entry into the ifServices * table for each protocol supported by the interface. * * @param node Node entry * @param ifaddr Interface address * @param protocols List of supported protocols * @param addrUnmanaged Boolean flag indicating if interface is managed or * unmanaged according to the Capsd configuration. * @param ifIndex Interface index or -1 if index is not known * @param ipPkg Poller package to which the interface belongs * * @throws SQLException if an error occurs adding interfaces to the ipInterface * table. */ private void addSupportedProtocols(DbNodeEntry node, InetAddress ifaddr, List protocols, boolean addrUnmanaged, int ifIndex, org.opennms.netmgt.config.poller.Package ipPkg) throws SQLException { // add the supported protocols // NOTE!!!!!: (reference internal bug# 201) // If the ip is 'managed', the service can still be 'not polled' // based on the poller configuration - at this point the ip is already // in the database, so package filter evaluation should go through OK Iterator iproto = protocols.iterator(); while(iproto.hasNext()) { IfCollector.SupportedProtocol p = (IfCollector.SupportedProtocol)iproto.next(); Number sid = (Number)CapsdConfigFactory.getInstance().getServiceIdentifier(p.getProtocolName()); DbIfServiceEntry ifSvcEntry = DbIfServiceEntry.create(node.getNodeId(), ifaddr, sid.intValue()); // now fill in the entry if(addrUnmanaged) ifSvcEntry.setStatus(DbIfServiceEntry.STATUS_UNMANAGED); else { boolean svcToBePolled = false; if (ipPkg != null) { svcToBePolled = PollerConfigFactory.getInstance().isPolled(p.getProtocolName(), ipPkg); if (!svcToBePolled) svcToBePolled = PollerConfigFactory.getInstance().isPolled(ifaddr.getHostAddress(), p.getProtocolName()); } if (svcToBePolled) ifSvcEntry.setStatus(DbIfServiceEntry.STATUS_ACTIVE); else ifSvcEntry.setStatus(DbIfServiceEntry.STATUS_NOT_POLLED); } // Set qualifier if available. Currently the qualifier field // is used to store the port at which the protocol was found. if (p.getQualifiers() != null && p.getQualifiers().get("port") != null) { try { Integer port = (Integer)p.getQualifiers().get("port"); ifSvcEntry.setQualifier(port.toString()); } catch (ClassCastException ccE) { // Do nothing } } ifSvcEntry.setSource(DbIfServiceEntry.SOURCE_PLUGIN); ifSvcEntry.setNotify(DbIfServiceEntry.NOTIFY_ON); if(ifIndex != -1) ifSvcEntry.setIfIndex(ifIndex); ifSvcEntry.store(); } } /** * Utility method which checks the provided list of supported * protocols to determine if the SNMP service is present. * * @param supportedProtocols List of supported protocol objects. * * @return TRUE if service "SNMP" is present in the list, FALSE otherwise */ static boolean supportsSnmp(List supportedProtocols) { Iterator iter = supportedProtocols.iterator(); while (iter.hasNext()) { IfCollector.SupportedProtocol p = (IfCollector.SupportedProtocol)iter.next(); if (p.getProtocolName().equals("SNMP")) return true; } return false; } /** * Utility method which determines if the passed IfSnmpCollector object * contains an ifIndex value for the passed IP address. * * @param ipaddr IP address * @param snmpc SNMP collection * * @return TRUE if an ifIndex value was found in the SNMP collection for * the provided IP address, FALSE otherwise. */ static boolean hasIfIndex(InetAddress ipaddr, IfSnmpCollector snmpc) { int ifIndex = snmpc.getIfIndex(ipaddr); Category log = ThreadCategory.getInstance(Capsd.class); if (log.isDebugEnabled()) log.debug("hasIfIndex: ipAddress: " + ipaddr.getHostAddress() + " has ifIndex: " + ifIndex); if (ifIndex == -1) return false; else return true; } /** * Utility method which determines returns the ifType for * the passed IP address. * * @param ipaddr IP address * @param snmpc SNMP collection * * @return TRUE if an ifIndex value was found in the SNMP collection for * the provided IP address, FALSE otherwise. */ static int getIfType(InetAddress ipaddr, IfSnmpCollector snmpc) { int ifIndex = snmpc.getIfIndex(ipaddr); int ifType = snmpc.getIfType(ifIndex); Category log = ThreadCategory.getInstance(Capsd.class); if (log.isDebugEnabled()) log.debug("getIfType: ipAddress: " + ipaddr.getHostAddress() + " has ifIndex: " + ifIndex + " and ifType: " + ifType); return ifType; } /** * Utility method which compares two InetAddress objects based on the provided method (MIN/MAX) * and returns the InetAddress which is to be considered the primary interface. * * NOTE: In order for an interface to be considered primary it must be * managed. This method will return null if the 'oldPrimary' address is * null and the 'currentIf' address is unmanaged. * * @param currentIf Interface with which to compare the 'oldPrimary' address. * @param oldPrimary Primary interface to be compared against the 'currentIf' address. * @param method Comparison method to be used (either "min" or "max") * * @return InetAddress object of the primary interface based on the provided method * or null if neither address is eligible to be primary. */ static InetAddress compareAndSelectPrimary(InetAddress currentIf, InetAddress oldPrimary, String method) { InetAddress newPrimary = null; if (oldPrimary == null) { if (!CapsdConfigFactory.getInstance().isAddressUnmanaged(currentIf)) return currentIf; else return oldPrimary; } long current = IPSorter.convertToLong(currentIf.getAddress()); long primary = IPSorter.convertToLong(oldPrimary.getAddress()); if (method.equals(SELECT_METHOD_MIN)) { // Smallest address wins if (current < primary) { // Replace the primary interface with the current // interface only if the current interface is managed! if(!CapsdConfigFactory.getInstance().isAddressUnmanaged(currentIf)) newPrimary = currentIf; } } else { // Largest address wins if (current > primary) { // Replace the primary interface with the current // interface only if the current interface is managed! if(!CapsdConfigFactory.getInstance().isAddressUnmanaged(currentIf)) newPrimary = currentIf; } } if (newPrimary != null) return newPrimary; else return oldPrimary; } /** * Builds a list of InetAddress objects representing each of * the interfaces from the IfCollector object which support SNMP * and have a valid ifIndex and is a loopback interface. * * This is in order to allow a non-127.*.*.* loopback address to * be chosen as the primary SNMP interface. * * @param collector IfCollector object containing SNMP and SMB info. * * @return List of InetAddress objects. */ private static List buildLBSnmpAddressList(IfCollector collector) { Category log = ThreadCategory.getInstance(SuspectEventProcessor.class); List addresses = new ArrayList(); // Verify that SNMP info is available if (collector.getSnmpCollector() == null) { if (log.isDebugEnabled()) log.debug("buildLBSnmpAddressList: no SNMP info for " + collector.getTarget()); return addresses; } // Verify that both the ifTable and ipAddrTable were // successfully collected. IfSnmpCollector snmpc = collector.getSnmpCollector(); if (!snmpc.hasIfTable() || !snmpc.hasIpAddrTable()) { log.info("buildLBSnmpAddressList: missing SNMP info for " + collector.getTarget()); return addresses; } // To be eligible to be the primary SNMP interface for a node: // 1. The interface must support SNMP // 2. The interface must have a valid ifIndex // Add eligible target. InetAddress ipAddr = collector.getTarget(); if ( supportsSnmp(collector.getSupportedProtocols()) && hasIfIndex(ipAddr, snmpc) && getIfType(ipAddr, snmpc) == 24) { if (log.isDebugEnabled()) log.debug("buildLBSnmpAddressList: adding target interface " + ipAddr.getHostAddress() + " temporarily marked as primary!"); addresses.add(ipAddr); } // Add eligible subtargets. if (collector.hasAdditionalTargets()) { Map extraTargets = collector.getAdditionalTargets(); Iterator iter = extraTargets.keySet().iterator(); while(iter.hasNext()) { InetAddress currIf = (InetAddress)iter.next(); // Test current subtarget. if (supportsSnmp((List)extraTargets.get(currIf)) && getIfType(currIf, snmpc) == 24 ) { if (log.isDebugEnabled()) log.debug("buildLBSnmpAddressList: adding subtarget interface " + currIf.getHostAddress() + " temporarily marked as primary!"); addresses.add(currIf); } } // end while() } // end if() return addresses; } /** * Builds a list of InetAddress objects representing each of * the interfaces from the IfCollector object which support SNMP * and have a valid ifIndex. * * @param collector IfCollector object containing SNMP and SMB info. * * @return List of InetAddress objects. */ private static List buildSnmpAddressList(IfCollector collector) { Category log = ThreadCategory.getInstance(SuspectEventProcessor.class); List addresses = new ArrayList(); // Verify that SNMP info is available if (collector.getSnmpCollector() == null) { if (log.isDebugEnabled()) log.debug("buildSnmpAddressList: no SNMP info for " + collector.getTarget()); return addresses; } // Verify that both the ifTable and ipAddrTable were // successfully collected. IfSnmpCollector snmpc = collector.getSnmpCollector(); if (!snmpc.hasIfTable() || !snmpc.hasIpAddrTable()) { log.info("buildSnmpAddressList: missing SNMP info for " + collector.getTarget()); return addresses; } // To be eligible to be the primary SNMP interface for a node: // 1. The interface must support SNMP // 2. The interface must have a valid ifIndex // Add eligible target. InetAddress ipAddr = collector.getTarget(); if ( supportsSnmp(collector.getSupportedProtocols()) && hasIfIndex(ipAddr, snmpc)) { if (log.isDebugEnabled()) log.debug("buildSnmpAddressList: adding target interface " + ipAddr.getHostAddress() + " temporarily marked as primary!"); addresses.add(ipAddr); } // Add eligible subtargets. if (collector.hasAdditionalTargets()) { Map extraTargets = collector.getAdditionalTargets(); Iterator iter = extraTargets.keySet().iterator(); while(iter.hasNext()) { InetAddress currIf = (InetAddress)iter.next(); // Test current subtarget. if (supportsSnmp((List)extraTargets.get(currIf)) && hasIfIndex(currIf, snmpc) ) { if (log.isDebugEnabled()) log.debug("buildSnmpAddressList: adding subtarget interface " + currIf.getHostAddress() + " temporarily marked as primary!"); addresses.add(currIf); } } // end while() } // end if() return addresses; } /** * This method is responsbile for determining the node's primary IP interface * from among all the node's IP interfaces. * * @param collector IfCollector object containing SNMP and SMB info. * * @return InetAddress object of the primary SNMP interface or null if none * of the node's interfaces are eligible. */ private InetAddress determinePrimaryInterface(IfCollector collector) { Category log = ThreadCategory.getInstance(getClass()); InetAddress primaryIf = null; // For now hard-coding primary interface address selection method to MIN String method = SELECT_METHOD_MIN; // Initially set the target interface as primary primaryIf = collector.getTarget(); // Next the subtargets will be tested. If is managed and // has a smaller numeric IP address then it will in turn be // set as the primary interface. if (collector.hasAdditionalTargets()) { Map extraTargets = collector.getAdditionalTargets(); Iterator iter = extraTargets.keySet().iterator(); while(iter.hasNext()) { InetAddress currIf = (InetAddress)iter.next(); primaryIf = compareAndSelectPrimary(currIf, primaryIf, method); } // end while() } // end if (Collector.hasAdditionalTargets()) if (log.isDebugEnabled()) if (primaryIf != null) log.debug("determinePrimaryInterface: selected primary interface: " + primaryIf.getHostAddress()); else log.debug("determinePrimaryInterface: no primary interface found"); return primaryIf; } /** * This is where all the work of the class is done. */ public void run() { Category log = ThreadCategory.getInstance(getClass()); CapsdConfigFactory cFactory = CapsdConfigFactory.getInstance(); // Convert interface InetAddress object InetAddress ifaddr = null; try { ifaddr = InetAddress.getByName(m_suspectIf); } catch(UnknownHostException e) { log.warn("SuspectEventProcessor: Failed to convert interface address " + m_suspectIf + " to InetAddress", e); return; } // collect the information if(log.isDebugEnabled()) log.debug("SuspectEventProcessor: running collection for " + ifaddr.getHostAddress()); IfCollector collector = new IfCollector(ifaddr, true); collector.run(); // Track changes to primary SNMP interface InetAddress oldSnmpPrimaryIf = null; InetAddress newSnmpPrimaryIf = null; InetAddress newLBSnmpPrimaryIf = null; // Update the database boolean updateCompleted = false; boolean useExistingNode = false; DbNodeEntry entryNode = null; try { // Synchronize on the Capsd sync lock so we can check if // the interface is already in the database and perform // the necessary inserts in one atomic operation // The RescanProcessor class is also synchronizing on this // lock prior to performing database inserts or updates. Connection dbc = null; synchronized(Capsd.getDbSyncLock()) { // Get database connection try { dbc = DatabaseConnectionFactory.getInstance().getConnection(); // Only add the node/interface to the database if // it isn't already in the database if (!cFactory.isInterfaceInDB(dbc, ifaddr)) { // Using the interface collector object determine // if this interface belongs under a node already // in the database. entryNode = getExistingNodeEntry(dbc, collector); if (entryNode == null) { // Create a node entry for the new interface entryNode = createNode(dbc, ifaddr, collector); } else { // Will use existing node entry useExistingNode = true; } // Get old primary SNMP interface (if one exists) oldSnmpPrimaryIf = getPrimarySnmpInterfaceFromDb(dbc, entryNode); // Add interfaces addInterfaces(dbc, entryNode, useExistingNode, ifaddr, collector); // Now that all interfaces have been added to the database we // can update the 'primarySnmpInterface' field of the ipInterface // table. Necessary because the IP address must already be in // the database to evaluate against a filter rule. // First create a list of eligible loopback addresses, and // choose one if valid. List snmpLBAddresses = buildLBSnmpAddressList(collector); newLBSnmpPrimaryIf = CollectdConfigFactory.getInstance().determinePrimarySnmpInterface(snmpLBAddresses); if (newLBSnmpPrimaryIf == null) { List snmpAddresses = buildSnmpAddressList(collector); newSnmpPrimaryIf = CollectdConfigFactory.getInstance().determinePrimarySnmpInterface(snmpAddresses); setPrimarySnmpInterface(dbc, entryNode, newSnmpPrimaryIf, oldSnmpPrimaryIf); } else { if(log.isDebugEnabled()) log.debug("SuspectEventProcessor: Loopback Address set as primary: " + newLBSnmpPrimaryIf); setPrimarySnmpInterface(dbc, entryNode, newLBSnmpPrimaryIf, oldSnmpPrimaryIf); } // Update updateCompleted = true; } } finally { if(dbc != null) { try { dbc.close(); } catch(SQLException e) { if(log.isInfoEnabled()) log.info("run: an sql exception occured closing the database connection", e); } } dbc = null; } } } // end try catch(Throwable t) { log.error("Error writing records", t); } // Send events if (updateCompleted) { if (!useExistingNode) createAndSendNodeAddedEvent(entryNode); sendInterfaceEvents(entryNode, useExistingNode, ifaddr, collector); if (useExistingNode) { generateSnmpDataCollectionEvents(entryNode, oldSnmpPrimaryIf, newSnmpPrimaryIf); } } if (log.isDebugEnabled()) log.debug("SuspectEventProcessor for " + m_suspectIf + " completed."); } // end run /** * Returns the InetAddress object of the primary SNMP interface (if one * exists). * * @param dbc Database connection. * @param node DbNodeEntry object representing the interface's * parent node table entry * * @throws SQLException if an error occurs updating the ipInterface table * @return Old SNMP primary interface address. */ static InetAddress getPrimarySnmpInterfaceFromDb(Connection dbc, DbNodeEntry node) throws SQLException { Category log = ThreadCategory.getInstance(SuspectEventProcessor.class); // Get old primary SNMP interface if one exists log.debug("getPrimarySnmpInterfaceFromDb: retrieving old primary snmp interface..."); InetAddress oldPrimarySnmpIf = null; // Prepare SQL statement PreparedStatement stmt = dbc.prepareStatement("SELECT ipAddr FROM ipInterface WHERE nodeId=? AND isSnmpPrimary='P' AND isManaged!='D'"); stmt.setInt(1, node.getNodeId()); // Execute statement ResultSet rs = null; try { rs = stmt.executeQuery(); if (rs.next()) { String oldPrimaryAddr = rs.getString("ipAddr"); if (oldPrimaryAddr != null) { try { oldPrimarySnmpIf = InetAddress.getByName(oldPrimaryAddr); log.debug("getPrimarySnmpInterfaceFromDb: old primary Snmp interface is " + oldPrimarySnmpIf.getHostAddress()); } catch (UnknownHostException e) { log.warn("Failed converting IP address " + oldPrimaryAddr); } } } } catch(SQLException sqlE) { throw sqlE; } finally { try { stmt.close(); // automatically closes the result set as well } catch (Exception e) { // Ignore } } return oldPrimarySnmpIf; } /** * Responsible for setting the value of the 'isSnmpPrimary' field of the * ipInterface table to 'P' (Primary) for the primary SNMP interface address. * * @param dbc Database connection. * @param node DbNodeEntry object representing the suspect interface's * parent node table entry * @param newPrimarySnmpIf New primary SNMP interface. * @param oldPrimarySnmpIf Old primary SNMP interface. * * @throws SQLException if an error occurs updating the ipInterface table * */ static void setPrimarySnmpInterface(Connection dbc, DbNodeEntry node, InetAddress newPrimarySnmpIf, InetAddress oldPrimarySnmpIf) throws SQLException { Category log = ThreadCategory.getInstance(SuspectEventProcessor.class); if (newPrimarySnmpIf == null) { if (log.isDebugEnabled()) log.debug("setPrimarySnmpInterface: newSnmpPrimary is null, nothing to set, returning."); return; } else { if (log.isDebugEnabled()) log.debug("setPrimarySnmpInterface: newSnmpPrimary=" + newPrimarySnmpIf); } // Verify that old and new primary interfaces are different if (oldPrimarySnmpIf != null && oldPrimarySnmpIf.equals(newPrimarySnmpIf)) { // Old and new primary interfaces are the same, just return return; } // They are different so mark the old primary as a secondary interface if (oldPrimarySnmpIf != null) { // Prepare SQL statement PreparedStatement stmt = dbc.prepareStatement("UPDATE ipInterface SET isSnmpPrimary='S' WHERE nodeId=? AND ipAddr=? AND isManaged!='D'"); stmt.setInt(1, node.getNodeId()); stmt.setString(2, oldPrimarySnmpIf.getHostAddress()); // Execute statement try { stmt.executeUpdate(); log.debug("setPrimarySnmpInterface: completed update of old primary interface to SECONDARY."); } catch(SQLException sqlE) { throw sqlE; } finally { try { stmt.close(); } catch (Exception e) { // Ignore } } } // Set primary SNMP interface 'isSnmpPrimary' field to 'P' for primary if (newPrimarySnmpIf != null) { if (log.isDebugEnabled()) log.debug("setPrimarySnmpInterface: primary SNMP interface=" + newPrimarySnmpIf.getHostAddress()); // Update the appropriate entry in the 'ipInterface' table // Prepare SQL statement PreparedStatement stmt = dbc.prepareStatement("UPDATE ipInterface SET isSnmpPrimary='P' WHERE nodeId=? AND ipaddr=? AND isManaged!='D'"); stmt.setInt(1, node.getNodeId()); stmt.setString(2, newPrimarySnmpIf.getHostAddress()); // Execute statement try { stmt.executeUpdate(); if (log.isDebugEnabled()) log.debug("setPrimarySnmpInterface: completed update of new primary interface to PRIMARY."); } catch(SQLException sqlE) { throw sqlE; } finally { try { stmt.close(); } catch (Exception e) { // Ignore } } } } /** * Determines if any SNMP data collection related events need to * be generated based upon the results of the current rescan. If * necessary will generate one of the following events: * 'reinitializePrimarySnmpInterface' * 'primarySnmpInterfaceChanged' * * @param nodeEntry DbNodeEntry object of the node being rescanned. * @param oldPrimary Old primary SNMP interface * @param newPrimary New primary SNMP interface */ private void generateSnmpDataCollectionEvents(DbNodeEntry nodeEntry, InetAddress oldPrimary, InetAddress newPrimary) { Category log = ThreadCategory.getInstance(getClass()); // Sanity check -- should not happen if (oldPrimary == null && newPrimary == null) { log.warn("generateSnmpDataCollectionEvents: both old and new primary SNMP interface vars are null!"); } // Sanity check -- should not happen else if (oldPrimary != null && newPrimary == null) { log.warn("generateSnmpDataCollectionEvents: old primary (" + oldPrimary.getHostAddress() + ") is not null but new primary is null!"); } // Just added the primary SNMP interface to the node, the nodeGainedService // event already generated is sufficient to start SNMP data collection...no // additional events are required. else if (oldPrimary == null && newPrimary != null) { if (log.isDebugEnabled()) log.debug("generateSnmpDataCollectionEvents: identified " + newPrimary.getHostAddress() + " as the primary SNMP interface for node " + nodeEntry.getNodeId()); } // A PrimarySnmpInterfaceChanged event is generated if the scan // found a different primary SNMP interface than what is stored // in the database. else if (!oldPrimary.equals(newPrimary) ) { if (log.isDebugEnabled()) { log.debug("generateSnmpDataCollectionEvents: primary SNMP interface has changed. Was: " + oldPrimary.getHostAddress() + " Is: " + newPrimary.getHostAddress()); } createAndSendPrimarySnmpInterfaceChangedEvent(nodeEntry.getNodeId(), newPrimary, oldPrimary); } // The primary SNMP interface did not change but the Capsd scan just added // an interface to the node so we need to update the interface // map which is maintained in memory for the purpose of doing // SNMP data collection. Therefore we generate a // reinitializePrimarySnmpInterface event so that this map // can be refreshed based on the most up to date information // in the database. else { if (log.isDebugEnabled()) log.debug("generateSnmpDataCollectionEvents: Generating reinitializeSnmpInterface event for interface " + newPrimary.getHostAddress()); createAndSendReinitializePrimarySnmpInterfaceEvent(nodeEntry.getNodeId(), newPrimary); } } /** * This method is responsible for generating a primarySnmpInterfaceChanged event and * sending it to eventd.. * * @param nodeId Nodeid of node being rescanned. * @param newPrimaryIf new primary SNMP interface address * @param oldPrimaryIf old primary SNMP interface address */ private void createAndSendPrimarySnmpInterfaceChangedEvent(int nodeId, InetAddress newPrimaryIf, InetAddress oldPrimaryIf) { Category log = ThreadCategory.getInstance(getClass()); String oldPrimaryAddr = null; if (oldPrimaryIf != null) oldPrimaryAddr = oldPrimaryIf.getHostAddress(); String newPrimaryAddr = null; if (newPrimaryIf != null) newPrimaryAddr = newPrimaryIf.getHostAddress(); if (log.isDebugEnabled()) log.debug("createAndSendPrimarySnmpInterfaceChangedEvent: nodeId: " + nodeId + " oldPrimarySnmpIf: '" + oldPrimaryAddr + "' newPrimarySnmpIf: '" + newPrimaryAddr + "'"); Event newEvent = new Event(); newEvent.setUei(EventConstants.PRIMARY_SNMP_INTERFACE_CHANGED_EVENT_UEI); newEvent.setSource("OpenNMS.Capsd"); newEvent.setNodeid(nodeId); newEvent.setInterface(newPrimaryAddr); newEvent.setHost(Capsd.getLocalHostAddress()); newEvent.setService("SNMP"); newEvent.setTime(EventConstants.formatToString(new java.util.Date())); // Add appropriate parms Parms eventParms = new Parms(); Parm eventParm = null; Value parmValue = null; if (oldPrimaryAddr != null) { // Add old node label eventParm = new Parm(); eventParm.setParmName(EventConstants.PARM_OLD_PRIMARY_SNMP_ADDRESS); parmValue = new Value(); parmValue.setContent(oldPrimaryAddr); eventParm.setValue(parmValue); eventParms.addParm(eventParm); } if (newPrimaryAddr != null) { // Add new node label eventParm = new Parm(); eventParm.setParmName(EventConstants.PARM_NEW_PRIMARY_SNMP_ADDRESS); parmValue = new Value(); parmValue.setContent(newPrimaryAddr); eventParm.setValue(parmValue); eventParms.addParm(eventParm); } // Add Parms to the event newEvent.setParms(eventParms); // Send event to Eventd try { EventIpcManagerFactory.getInstance().getManager().sendNow(newEvent); if (log.isDebugEnabled()) log.debug("createAndSendPrimarySnmpInterfaceChangedEvent: successfully sent primarySnmpInterfaceChanged event for nodeID: " + nodeId); } catch(Throwable t) { log.warn("run: unexpected throwable exception caught during send to middleware", t); } } /** * This method is responsible for generating a reinitializePrimarySnmpInterface * event and sending it to eventd. * * @param nodeId Nodeid of node being rescanned. * @param InetAddress Primary SNMP interface address. */ private void createAndSendReinitializePrimarySnmpInterfaceEvent(int nodeId, InetAddress primarySnmpIf) { Category log = ThreadCategory.getInstance(getClass()); if (log.isDebugEnabled()) log.debug("reinitializePrimarySnmpInterface: nodeId: " + nodeId + " interface: " + primarySnmpIf.getHostAddress()); Event newEvent = new Event(); newEvent.setUei(EventConstants.REINITIALIZE_PRIMARY_SNMP_INTERFACE_EVENT_UEI); newEvent.setSource("OpenNMS.Capsd"); newEvent.setNodeid(nodeId); newEvent.setHost(Capsd.getLocalHostAddress()); newEvent.setInterface(primarySnmpIf.getHostAddress()); newEvent.setTime(EventConstants.formatToString(new java.util.Date())); // Send event to Eventd try { EventIpcManagerFactory.getInstance().getManager().sendNow(newEvent); if (log.isDebugEnabled()) log.debug("createAndSendReinitializePrimarySnmpInterfaceEvent: successfully sent reinitializePrimarySnmpInterface event for nodeID: " + nodeId); } catch(Throwable t) { log.warn("run: unexpected throwable exception caught during send to middleware", t); } } /** * This method is responsible for creating all the necessary interface-level * events for the node and sending them to Eventd. * * @param node DbNodeEntry object for the parent node. * @param useExistingNode TRUE if existing node was used, FALSE if new * node was created. * @param ifaddr Target interface address * @param collector Interface collector containing SNMP and SMB info. */ private void sendInterfaceEvents(DbNodeEntry node, boolean useExistingNode, InetAddress ifaddr, IfCollector collector) { Category log = ThreadCategory.getInstance(getClass()); // Go ahead and send events for the target interface // nodeGainedInterface if (log.isDebugEnabled()) log.debug("sendInterfaceEvents: sending node gained interface event for " + ifaddr.getHostAddress()); createAndSendNodeGainedInterfaceEvent(node.getNodeId(), ifaddr); // nodeGainedService log.debug("sendInterfaceEvents: processing supported services for " + ifaddr.getHostAddress()); Iterator iproto = collector.getSupportedProtocols().iterator(); while(iproto.hasNext()) { IfCollector.SupportedProtocol p = (IfCollector.SupportedProtocol)iproto.next(); if (log.isDebugEnabled()) log.debug("sendInterfaceEvents: sending event for service: " + p.getProtocolName()); createAndSendNodeGainedServiceEvent(node, ifaddr, p.getProtocolName(), null); } // If the useExistingNode flag is set to TRUE we're done, none of the // sub-targets should have been added. if (useExistingNode) return; // If SNMP info available send events for sub-targets if(collector.hasSnmpCollection() && !collector.getSnmpCollector().failed()) { Map extraTargets = collector.getAdditionalTargets(); Iterator iter = extraTargets.keySet().iterator(); while(iter.hasNext()) { InetAddress xifaddr = (InetAddress)iter.next(); // nodeGainedInterface createAndSendNodeGainedInterfaceEvent(node.getNodeId(), xifaddr); // nodeGainedService List supportedProtocols = (List)extraTargets.get(xifaddr); log.debug("interface " + xifaddr + " supports " + supportedProtocols.size() + " protocols."); if (supportedProtocols != null) { iproto = supportedProtocols.iterator(); while(iproto.hasNext()) { IfCollector.SupportedProtocol p = (IfCollector.SupportedProtocol)iproto.next(); createAndSendNodeGainedServiceEvent(node, xifaddr, p.getProtocolName(), null); } } } } } /** * This method is responsible for creating and sending a 'nodeAdded' event * to Eventd * * @param nodeEntry DbNodeEntry object for the newly created node. */ private void createAndSendNodeAddedEvent(DbNodeEntry nodeEntry) { Category log = ThreadCategory.getInstance(getClass()); // create the event to be sent Event newEvent = new Event(); newEvent.setUei(EventConstants.NODE_ADDED_EVENT_UEI); newEvent.setSource("OpenNMS.Capsd"); newEvent.setNodeid(nodeEntry.getNodeId()); newEvent.setHost(Capsd.getLocalHostAddress()); newEvent.setTime(EventConstants.formatToString(new java.util.Date())); // Add appropriate parms Parms eventParms = new Parms(); Parm eventParm = null; Value parmValue = null; // Add node label eventParm = new Parm(); eventParm.setParmName(EventConstants.PARM_NODE_LABEL); parmValue = new Value(); parmValue.setContent(nodeEntry.getLabel()); eventParm.setValue(parmValue); eventParms.addParm(eventParm); // Add node label source eventParm = new Parm(); eventParm.setParmName(EventConstants.PARM_NODE_LABEL_SOURCE); parmValue = new Value(); char labelSource[] = new char[] {nodeEntry.getLabelSource()}; parmValue.setContent(new String(labelSource)); eventParm.setValue(parmValue); eventParms.addParm(eventParm); // Add discovery method eventParm = new Parm(); eventParm.setParmName(EventConstants.PARM_METHOD); parmValue = new Value(); parmValue.setContent("icmp"); eventParm.setValue(parmValue); eventParms.addParm(eventParm); // Add Parms to the event newEvent.setParms(eventParms); // Send event to Eventd try { EventIpcManagerFactory.getInstance().getManager().sendNow(newEvent); if (log.isDebugEnabled()) log.debug("createAndSendNodeAddedEvent: successfully sent NodeAdded event for nodeID: " + nodeEntry.getNodeId()); } catch(Throwable t) { log.warn("run: unexpected throwable exception caught during send to middleware", t); } } /** * This method is responsible for creating and sending a 'duplicateIPAddress' * event to Eventd * * @param nodeId Interface's parent node identifier. * @param ipAddr Interface's IP address */ private void createAndSendDuplicateIpaddressEvent(int nodeId, String ipAddr) { Category log = ThreadCategory.getInstance(getClass()); // create the event to be sent Event newEvent = new Event(); newEvent.setUei(EventConstants.DUPLICATE_IPINTERFACE_EVENT_UEI); newEvent.setSource("OpenNMS.Capsd"); newEvent.setNodeid(nodeId); newEvent.setHost(Capsd.getLocalHostAddress()); newEvent.setInterface(ipAddr); newEvent.setTime(EventConstants.formatToString(new java.util.Date())); // Send event to Eventd try { EventIpcManagerFactory.getInstance().getManager().sendNow(newEvent); if (log.isDebugEnabled()) log.debug("createAndSendDuplicateIpaddressEvent: successfully sent duplicateIPAddress event for interface: " + ipAddr); } catch(Throwable t) { log.warn("run: unexpected throwable exception caught during send to middleware", t); } } /** * This method is responsible for creating and sending a 'nodeGainedInterface' * event to Eventd * * @param nodeId Interface's parent node identifier. * @param ipAddr Interface's IP address */ private void createAndSendNodeGainedInterfaceEvent(int nodeId, InetAddress ipAddr) { Category log = ThreadCategory.getInstance(getClass()); // create the event to be sent Event newEvent = new Event(); newEvent.setUei(EventConstants.NODE_GAINED_INTERFACE_EVENT_UEI); newEvent.setSource("OpenNMS.Capsd"); newEvent.setNodeid(nodeId); newEvent.setHost(Capsd.getLocalHostAddress()); newEvent.setInterface(ipAddr.getHostAddress()); newEvent.setTime(EventConstants.formatToString(new java.util.Date())); // Add appropriate parms Parms eventParms = new Parms(); Parm eventParm = null; Value parmValue = null; // Add IP host name eventParm = new Parm(); eventParm.setParmName(EventConstants.PARM_IP_HOSTNAME); parmValue = new Value(); parmValue.setContent(ipAddr.getHostName()); eventParm.setValue(parmValue); eventParms.addParm(eventParm); // Add discovery method eventParm = new Parm(); eventParm.setParmName(EventConstants.PARM_METHOD); parmValue = new Value(); parmValue.setContent("icmp"); eventParm.setValue(parmValue); eventParms.addParm(eventParm); // Add Parms to the event newEvent.setParms(eventParms); // Send event to Eventd try { EventIpcManagerFactory.getInstance().getManager().sendNow(newEvent); if (log.isDebugEnabled()) log.debug("createAndSendNodeGainedInterfaceEvent: successfully sent NodeGainedInterface event for interface: " + ipAddr.getHostAddress()); } catch(Throwable t) { log.warn("run: unexpected throwable exception caught during send to middleware", t); } } /** * This method is responsible for creating and sending a 'nodeGainedService' * event to Eventd * * @param nodeEntry Interface's parent node identifier. * @param ipAddr Interface's IP address * @param svcName Service name * @param qualifier Service qualifier (typically the port on which the * service was found) */ private void createAndSendNodeGainedServiceEvent(DbNodeEntry nodeEntry, InetAddress ipAddr, String svcName, String qualifier) { Category log = ThreadCategory.getInstance(getClass()); // create the event to be sent Event newEvent = new Event(); newEvent.setUei(EventConstants.NODE_GAINED_SERVICE_EVENT_UEI); newEvent.setSource("OpenNMS.Capsd"); newEvent.setNodeid(nodeEntry.getNodeId()); newEvent.setHost(Capsd.getLocalHostAddress()); newEvent.setInterface(ipAddr.getHostAddress()); newEvent.setService(svcName); newEvent.setTime(EventConstants.formatToString(new java.util.Date())); // Add appropriate parms Parms eventParms = new Parms(); Parm eventParm = null; Value parmValue = null; // Add IP host name eventParm = new Parm(); eventParm.setParmName(EventConstants.PARM_IP_HOSTNAME); parmValue = new Value(); parmValue.setContent(ipAddr.getHostName()); eventParm.setValue(parmValue); eventParms.addParm(eventParm); // Add node label eventParm = new Parm(); eventParm.setParmName(EventConstants.PARM_NODE_LABEL); parmValue = new Value(); parmValue.setContent(nodeEntry.getLabel()); eventParm.setValue(parmValue); eventParms.addParm(eventParm); // Add node label source eventParm = new Parm(); eventParm.setParmName(EventConstants.PARM_NODE_LABEL_SOURCE); parmValue = new Value(); char labelSource[] = new char[] {nodeEntry.getLabelSource()}; parmValue.setContent(new String(labelSource)); eventParm.setValue(parmValue); eventParms.addParm(eventParm); // Add qualifier (if available) if (qualifier != null && qualifier.length() > 0) { eventParm = new Parm(); eventParm.setParmName(EventConstants.PARM_QUALIFIER); parmValue = new Value(); parmValue.setContent(qualifier); eventParm.setValue(parmValue); eventParms.addParm(eventParm); } // Add sysName (if available) if (nodeEntry.getSystemName() != null) { eventParm = new Parm(); eventParm.setParmName(EventConstants.PARM_NODE_SYSNAME); parmValue = new Value(); parmValue.setContent(nodeEntry.getSystemName()); eventParm.setValue(parmValue); eventParms.addParm(eventParm); } // Add sysDescr (if available) if (nodeEntry.getSystemDescription() != null) { eventParm = new Parm(); eventParm.setParmName(EventConstants.PARM_NODE_SYSDESCRIPTION); parmValue = new Value(); parmValue.setContent(nodeEntry.getSystemDescription()); eventParm.setValue(parmValue); eventParms.addParm(eventParm); } // Add Parms to the event newEvent.setParms(eventParms); // Send event to Eventd try { EventIpcManagerFactory.getInstance().getManager().sendNow(newEvent); if (log.isDebugEnabled()) log.debug("createAndSendNodeGainedServiceEvent: successfully sent NodeGainedService event for interface: " + ipAddr.getHostAddress() + " and service: " + svcName); } catch(Throwable t) { log.warn("run: unexpected throwable exception caught during send to middleware", t); } } } // end class
package com.devicehive.websockets; import com.devicehive.base.AbstractWebSocketTest; import com.devicehive.base.fixture.JsonFixture; import com.devicehive.base.fixture.WebSocketFixture; import com.devicehive.base.websocket.WebSocketSynchronousConnection; import com.devicehive.model.JsonStringWrapper; import com.devicehive.model.wrappers.DeviceCommandWrapper; import com.devicehive.model.wrappers.DeviceNotificationWrapper; import com.google.gson.JsonElement; import com.google.gson.JsonObject; import com.google.gson.JsonPrimitive; import org.junit.After; import org.junit.Test; import org.springframework.web.socket.TextMessage; import java.util.HashMap; import java.util.Optional; import static com.devicehive.base.websocket.WebSocketSynchronousConnection.WAIT_TIMEOUT; import static org.hamcrest.CoreMatchers.is; import static org.hamcrest.CoreMatchers.notNullValue; import static org.junit.Assert.assertThat; import static org.junit.Assert.assertTrue; public class CommandHandlersTest extends AbstractWebSocketTest { @After public void tearDown() throws Exception { clearWSConnections(); } @Test public void should_insert_command_signed_in_as_admin() throws Exception { WebSocketSynchronousConnection connection = syncConnection("/websocket/client"); WebSocketFixture.authenticateUser(ADMIN_LOGIN, ADMIN_PASS, connection); DeviceCommandWrapper command = new DeviceCommandWrapper(); command.setCommand(Optional.of("test command")); JsonObject commandInsert = JsonFixture.createWsCommand("command/insert", "1", new HashMap<String, JsonElement>() {{ put("deviceGuid", new JsonPrimitive(DEVICE_ID)); put("command", gson.toJsonTree(command)); }}); long time = System.currentTimeMillis(); TextMessage response = connection.sendMessage(new TextMessage(gson.toJson(commandInsert)), WAIT_TIMEOUT); JsonObject jsonResp = gson.fromJson(response.getPayload(), JsonObject.class); assertThat(jsonResp.get("action").getAsString(), is("command/insert")); assertThat(jsonResp.get("requestId").getAsString(), is("1")); assertThat(jsonResp.get("status").getAsString(), is("success")); assertThat(jsonResp.get("command"), notNullValue()); InsertCommand commandResp = gson.fromJson(jsonResp.get("command"),InsertCommand.class); assertThat(commandResp.getId(), notNullValue()); assertThat(commandResp.getTimestamp(), notNullValue()); assertTrue(commandResp.getTimestamp().getTime() > time); } @Test public void should_insert_notification_signed_in_as_key() throws Exception { WebSocketSynchronousConnection connection = syncConnection("/websocket/client"); WebSocketFixture.authenticateKey(ACCESS_KEY, connection); DeviceNotificationWrapper notification = new DeviceNotificationWrapper(); notification.setNotification("hi there"); notification.setParameters(new JsonStringWrapper("{\"param\": \"param_1\"}")); JsonObject notificationInsert = JsonFixture.createWsCommand("notification/insert", "1", new HashMap<String, JsonElement>() {{ put("deviceGuid", new JsonPrimitive(DEVICE_ID)); put("notification", gson.toJsonTree(notification)); }}); long time = System.currentTimeMillis(); TextMessage response = connection.sendMessage(new TextMessage(gson.toJson(notificationInsert)), WAIT_TIMEOUT); JsonObject jsonResp = gson.fromJson(response.getPayload(), JsonObject.class); assertThat(jsonResp.get("action").getAsString(), is("notification/insert")); assertThat(jsonResp.get("requestId").getAsString(), is("1")); assertThat(jsonResp.get("status").getAsString(), is("success")); assertThat(jsonResp.get("notification"), notNullValue()); InsertNotification notificationResp = gson.fromJson(jsonResp.get("notification"),InsertNotification.class); assertThat(notificationResp.getId(), notNullValue()); assertThat(notificationResp.getTimestamp(), notNullValue()); assertTrue(notificationResp.getTimestamp().getTime() > time); } }
package com.imsweb.seerapi.client.staging; import java.io.IOException; import java.util.EnumSet; import java.util.HashMap; import java.util.List; import java.util.Map; import java.util.Set; import org.hamcrest.CoreMatchers; import org.hamcrest.MatcherAssert; import org.junit.BeforeClass; import org.junit.Test; import com.imsweb.seerapi.client.SeerApi; import com.imsweb.seerapi.client.disease.DateRange; import com.imsweb.seerapi.client.disease.DateRangeString; import com.imsweb.seerapi.client.disease.YearRange; import com.imsweb.seerapi.client.disease.YearRangeInteger; import com.imsweb.seerapi.client.disease.YearRangeString; import com.imsweb.seerapi.client.glossary.Glossary.Category; import com.imsweb.seerapi.client.shared.KeywordMatch; import com.imsweb.seerapi.client.staging.cs.CsSchemaLookup; import com.imsweb.seerapi.client.staging.cs.CsStagingData; import com.imsweb.seerapi.client.staging.cs.CsStagingData.CsInput; import com.imsweb.seerapi.client.staging.cs.CsStagingData.CsStagingInputBuilder; import com.imsweb.seerapi.client.staging.eod.EodSchemaLookup; import com.imsweb.seerapi.client.staging.eod.EodStagingData; import com.imsweb.seerapi.client.staging.eod.EodStagingData.EodInput; import com.imsweb.seerapi.client.staging.eod.EodStagingData.EodOutput; import com.imsweb.seerapi.client.staging.eod.EodStagingData.EodStagingInputBuilder; import com.imsweb.seerapi.client.staging.tnm.TnmSchemaLookup; import com.imsweb.seerapi.client.staging.tnm.TnmStagingData; import com.imsweb.seerapi.client.staging.tnm.TnmStagingData.TnmInput; import com.imsweb.seerapi.client.staging.tnm.TnmStagingData.TnmOutput; import com.imsweb.seerapi.client.staging.tnm.TnmStagingData.TnmStagingInputBuilder; import static com.google.code.beanmatchers.BeanMatchers.hasValidBeanConstructor; import static com.google.code.beanmatchers.BeanMatchers.hasValidBeanEquals; import static com.google.code.beanmatchers.BeanMatchers.hasValidGettersAndSetters; import static com.google.code.beanmatchers.BeanMatchers.hasValidGettersAndSettersExcluding; import static com.imsweb.seerapi.client.staging.StagingData.HISTOLOGY_KEY; import static com.imsweb.seerapi.client.staging.StagingData.PRIMARY_SITE_KEY; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.AJCC6_M; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.AJCC6_MDESCRIPTOR; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.AJCC6_N; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.AJCC6_NDESCRIPTOR; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.AJCC6_STAGE; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.AJCC6_T; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.AJCC6_TDESCRIPTOR; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.AJCC7_M; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.AJCC7_MDESCRIPTOR; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.AJCC7_N; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.AJCC7_NDESCRIPTOR; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.AJCC7_STAGE; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.AJCC7_T; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.AJCC7_TDESCRIPTOR; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.CSVER_DERIVED; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.SCHEMA_NUMBER; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.SS1977_M; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.SS1977_N; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.SS1977_STAGE; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.SS1977_T; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.SS2000_M; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.SS2000_N; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.SS2000_STAGE; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.SS2000_T; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.STOR_AJCC6_M; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.STOR_AJCC6_MDESCRIPTOR; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.STOR_AJCC6_N; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.STOR_AJCC6_NDESCRIPTOR; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.STOR_AJCC6_STAGE; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.STOR_AJCC6_T; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.STOR_AJCC6_TDESCRIPTOR; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.STOR_AJCC7_M; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.STOR_AJCC7_MDESCRIPTOR; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.STOR_AJCC7_N; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.STOR_AJCC7_NDESCRIPTOR; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.STOR_AJCC7_STAGE; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.STOR_AJCC7_T; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.STOR_AJCC7_TDESCRIPTOR; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.STOR_SS1977_STAGE; import static com.imsweb.seerapi.client.staging.cs.CsStagingData.CsOutput.STOR_SS2000_STAGE; import static org.assertj.core.api.Assertions.assertThat; import static org.assertj.core.api.Assertions.assertThatExceptionOfType; public class StagingTest { private static final String _ALGORITHM = "cs"; private static final String _VERSION = "02.05.50"; private static StagingService _STAGING; @BeforeClass public static void setup() { _STAGING = new SeerApi.Builder().connect().staging(); } @Test public void testGetAlgorithms() throws IOException { List<StagingAlgorithm> algorithms = _STAGING.algorithms().execute().body(); assertThat(algorithms).isNotEmpty().extracting("algorithm").contains("cs", "tnm", "eod_public"); } @Test public void testGetAlgorithmVersions() throws IOException { List<StagingVersion> versions = _STAGING.versions(_ALGORITHM).execute().body(); assertThat(versions).isNotEmpty(); } @Test public void testListSchemas() throws IOException { List<StagingSchemaInfo> schemaInfos = _STAGING.schemas(_ALGORITHM, _VERSION).execute().body(); assertThat(schemaInfos).isNotEmpty(); schemaInfos = _STAGING.schemas(_ALGORITHM, _VERSION, "skin").execute().body(); assertThat(schemaInfos).isNotEmpty(); } @Test public void testSchemaLookup() throws IOException { // first test simple lookup that returns a single schema with site/hist only List<StagingSchemaInfo> schemas = _STAGING.schemaLookup(_ALGORITHM, _VERSION, new CsSchemaLookup("C509", "8000").getInputs()).execute().body(); assertThat(schemas).hasSize(1).extracting("id").contains("breast"); // now test just site SchemaLookup data = new SchemaLookup(); data.setInput(PRIMARY_SITE_KEY, "C111"); assertThat(_STAGING.schemaLookup(_ALGORITHM, _VERSION, data.getInputs()).execute().body()).hasSize(7); // add histology data.setInput(StagingData.HISTOLOGY_KEY, "8000"); assertThat(_STAGING.schemaLookup(_ALGORITHM, _VERSION, data.getInputs()).execute().body()).hasSize(2); // add discriminator data.setInput("ssf25", "010"); schemas = _STAGING.schemaLookup(_ALGORITHM, _VERSION, data.getInputs()).execute().body(); assertThat(schemas).hasSize(1).extracting("id").contains("nasopharynx"); // test with the CS schemas = _STAGING.schemaLookup(_ALGORITHM, _VERSION, new CsSchemaLookup("C111", "8000", "010").getInputs()).execute().body(); assertThat(schemas).hasSize(1).extracting("id").contains("nasopharynx"); // test with the TNM schemas = _STAGING.schemaLookup(_ALGORITHM, _VERSION, new TnmSchemaLookup("C680", "8000").getInputs()).execute().body(); assertThat(schemas).hasSize(1).extracting("id").contains("urethra"); // test with the EOD schemas = _STAGING.schemaLookup(_ALGORITHM, _VERSION, new EodSchemaLookup("C680", "8000").getInputs()).execute().body(); assertThat(schemas).hasSize(1).extracting("id").contains("urethra"); Map<String, String> values = new HashMap<>(); values.put(PRIMARY_SITE_KEY, "C680"); values.put(HISTOLOGY_KEY, "8000"); SchemaLookup schemaLookup = new SchemaLookup(values); assertThat(schemaLookup.getInput(PRIMARY_SITE_KEY)).isEqualTo("C680"); assertThat(schemaLookup.getSite()).isEqualTo("C680"); assertThat(schemaLookup.getHistology()).isEqualTo("8000"); assertThat(schemaLookup.hasDiscriminator()).isFalse(); assertThat(schemaLookup).isEqualTo(new SchemaLookup("C680", "8000")); // test invalid input CsSchemaLookup csLookup = new CsSchemaLookup(); csLookup.setSite("C111"); csLookup.setHistology("8000"); csLookup.setInput(CsStagingData.SSF25_KEY, "010"); assertThatExceptionOfType(IllegalStateException.class) .isThrownBy(() -> csLookup.setInput("bad_key", "1")) .withMessageContaining("is not allowed for lookups"); assertThat(csLookup.hasDiscriminator()).isTrue(); // test clearning inpuyts schemaLookup.clearInputs(); assertThat(schemaLookup.getInput(PRIMARY_SITE_KEY)).isNull(); } @Test public void testSchemaById() throws IOException { StagingSchema schema = _STAGING.schemaById(_ALGORITHM, _VERSION, "brain").execute().body(); assertThat(schema).isNotNull(); assertThat(schema.getAlgorithm()).isEqualTo("cs"); assertThat(schema.getVersion()).isEqualTo("02.05.50"); assertThat(schema.getId()).isEqualTo("brain"); // verify the inputs StagingSchemaInput input = schema.getInputs().stream().filter(i -> "site".equals(i.getKey())).findFirst().orElse(null); assertThat(input).isNotNull(); assertThat(input.getName()).isEqualTo("Primary Site"); assertThat(input.getDescription()).isEqualTo("Code for the primary site of the tumor being reported using either ICD-O-2 or ICD-O-3."); assertThat(input.getNaaccrItem()).isEqualTo(400); assertThat(input.getNaaccrXmlId()).isEqualTo("primarySite"); assertThat(input.getUsedForStaging()).isTrue(); assertThat(input.getTable()).isEqualTo("primary_site"); // verify the outputs StagingSchemaOutput output = schema.getOutputs().stream().filter(i -> "csver_derived".equals(i.getKey())).findFirst().orElse(null); assertThat(output).isNotNull(); assertThat(output.getName()).isEqualTo("CS Version Derived"); assertThat(output.getDescription()).isEqualTo("Collaborative Staging (CS) version used to derive the CS output fields."); assertThat(output.getNaaccrItem()).isEqualTo(2936); assertThat(output.getNaaccrXmlId()).isEqualTo("csVersionDerived"); assertThat(output.getDefault()).isEqualTo("020550"); } @Test public void testSchemaInvolvedTables() throws IOException { List<StagingTable> tables = _STAGING.involvedTables(_ALGORITHM, _VERSION, "brain").execute().body(); assertThat(tables).isNotEmpty(); } @Test public void testListTables() throws IOException { List<StagingTable> tables = _STAGING.tables(_ALGORITHM, _VERSION, "ssf1").execute().body(); assertThat(tables).isNotEmpty(); tables = _STAGING.tables(_ALGORITHM, _VERSION, null, true).execute().body(); assertThat(tables).isEmpty(); tables = _STAGING.tables(_ALGORITHM, _VERSION, null, false).execute().body(); assertThat(tables).isNotEmpty(); } @Test public void testTableById() throws IOException { StagingTable table = _STAGING.tableById(_ALGORITHM, _VERSION, "primary_site").execute().body(); assertThat(table).isNotNull(); assertThat(table.getAlgorithm()).isEqualTo("cs"); assertThat(table.getVersion()).isEqualTo("02.05.50"); assertThat(table.getId()).isEqualTo("primary_site"); } @Test public void testTableInvoledSchemas() throws IOException { List<StagingSchema> schemas = _STAGING.involvedSchemas(_ALGORITHM, _VERSION, "extension_baa").execute().body(); assertThat(schemas).isNotEmpty(); } @Test public void testCsInputBuilder() { CsStagingData data1 = new CsStagingData(); data1.setInput(CsInput.PRIMARY_SITE, "C680"); data1.setInput(CsInput.HISTOLOGY, "8000"); data1.setInput(CsInput.BEHAVIOR, "3"); data1.setInput(CsInput.GRADE, "9"); data1.setInput(CsInput.DX_YEAR, "2013"); data1.setInput(CsInput.CS_VERSION_ORIGINAL, "020550"); data1.setInput(CsInput.TUMOR_SIZE, "075"); data1.setInput(CsInput.EXTENSION, "100"); data1.setInput(CsInput.EXTENSION_EVAL, "9"); data1.setInput(CsInput.LYMPH_NODES, "100"); data1.setInput(CsInput.LYMPH_NODES_EVAL, "9"); data1.setInput(CsInput.REGIONAL_NODES_POSITIVE, "99"); data1.setInput(CsInput.REGIONAL_NODES_EXAMINED, "99"); data1.setInput(CsInput.METS_AT_DX, "10"); data1.setInput(CsInput.METS_EVAL, "9"); data1.setInput(CsInput.LVI, "9"); data1.setInput(CsInput.AGE_AT_DX, "060"); data1.setSsf(1, "020"); CsStagingData data2 = new CsStagingInputBuilder() .withInput(CsStagingData.CsInput.PRIMARY_SITE, "C680") .withInput(CsStagingData.CsInput.HISTOLOGY, "8000") .withInput(CsStagingData.CsInput.BEHAVIOR, "3") .withInput(CsStagingData.CsInput.GRADE, "9") .withInput(CsStagingData.CsInput.DX_YEAR, "2013") .withInput(CsStagingData.CsInput.CS_VERSION_ORIGINAL, "020550") .withInput(CsStagingData.CsInput.TUMOR_SIZE, "075") .withInput(CsStagingData.CsInput.EXTENSION, "100") .withInput(CsStagingData.CsInput.EXTENSION_EVAL, "9") .withInput(CsStagingData.CsInput.LYMPH_NODES, "100") .withInput(CsStagingData.CsInput.LYMPH_NODES_EVAL, "9") .withInput(CsStagingData.CsInput.REGIONAL_NODES_POSITIVE, "99") .withInput(CsStagingData.CsInput.REGIONAL_NODES_EXAMINED, "99") .withInput(CsStagingData.CsInput.METS_AT_DX, "10") .withInput(CsStagingData.CsInput.METS_EVAL, "9") .withInput(CsStagingData.CsInput.LVI, "9") .withInput(CsStagingData.CsInput.AGE_AT_DX, "060") .withSsf(1, "020") .build(); assertThat(data1.getInput()).isEqualTo(data2.getInput()); } @Test public void testCsStaging() throws IOException { CsStagingData data = new CsStagingInputBuilder() .withInput(CsInput.PRIMARY_SITE, "C680") .withInput(CsInput.HISTOLOGY, "8000") .withInput(CsInput.BEHAVIOR, "3") .withInput(CsInput.GRADE, "9") .withInput(CsInput.DX_YEAR, "2013") .withInput(CsInput.CS_VERSION_ORIGINAL, "020550") .withInput(CsInput.TUMOR_SIZE, "075") .withInput(CsInput.EXTENSION, "100") .withInput(CsInput.EXTENSION_EVAL, "9") .withInput(CsInput.LYMPH_NODES, "100") .withInput(CsInput.LYMPH_NODES_EVAL, "9") .withInput(CsInput.REGIONAL_NODES_POSITIVE, "99") .withInput(CsInput.REGIONAL_NODES_EXAMINED, "99") .withInput(CsInput.METS_AT_DX, "10") .withInput(CsInput.METS_EVAL, "9") .withInput(CsInput.LVI, "9") .withInput(CsInput.AGE_AT_DX, "060") .withSsf(1, "020") .build(); // perform the staging StagingData output = _STAGING.stage("cs", "02.05.50", data.getInput()).execute().body(); assertThat(output).isNotNull(); assertThat(output.getResult()).isEqualTo(StagingData.Result.STAGED); assertThat(output.getErrors()).isEmpty(); assertThat(output.getPath()).hasSize(37); // check output assertThat(output.getOutput(SCHEMA_NUMBER.toString())).isEqualTo("129"); assertThat(output.getSchemaId()).isEqualTo("urethra"); assertThat(output.getOutput(CSVER_DERIVED.toString())).isEqualTo("020550"); // AJCC 6 assertThat(output.getOutput(AJCC6_T.toString())).isEqualTo("T1"); assertThat(output.getOutput(STOR_AJCC6_T.toString())).isEqualTo("10"); assertThat(output.getOutput(AJCC6_TDESCRIPTOR.toString())).isEqualTo("c"); assertThat(output.getOutput(STOR_AJCC6_TDESCRIPTOR.toString())).isEqualTo("c"); assertThat(output.getOutput(AJCC6_N.toString())).isEqualTo("N1"); assertThat(output.getOutput(STOR_AJCC6_N.toString())).isEqualTo("10"); assertThat(output.getOutput(AJCC6_NDESCRIPTOR.toString())).isEqualTo("c"); assertThat(output.getOutput(STOR_AJCC6_NDESCRIPTOR.toString())).isEqualTo("c"); assertThat(output.getOutput(AJCC6_M.toString())).isEqualTo("M1"); assertThat(output.getOutput(STOR_AJCC6_M.toString())).isEqualTo("10"); assertThat(output.getOutput(AJCC6_MDESCRIPTOR.toString())).isEqualTo("c"); assertThat(output.getOutput(STOR_AJCC6_MDESCRIPTOR.toString())).isEqualTo("c"); assertThat(output.getOutput(AJCC6_STAGE.toString())).isEqualTo("IV"); assertThat(output.getOutput(STOR_AJCC6_STAGE.toString())).isEqualTo("70"); // AJCC 7 assertThat(output.getOutput(AJCC7_T.toString())).isEqualTo("T1"); assertThat(output.getOutput(STOR_AJCC7_T.toString())).isEqualTo("100"); assertThat(output.getOutput(AJCC7_TDESCRIPTOR.toString())).isEqualTo("c"); assertThat(output.getOutput(STOR_AJCC7_TDESCRIPTOR.toString())).isEqualTo("c"); assertThat(output.getOutput(AJCC7_N.toString())).isEqualTo("N1"); assertThat(output.getOutput(STOR_AJCC7_N.toString())).isEqualTo("100"); assertThat(output.getOutput(AJCC7_NDESCRIPTOR.toString())).isEqualTo("c"); assertThat(output.getOutput(STOR_AJCC7_NDESCRIPTOR.toString())).isEqualTo("c"); assertThat(output.getOutput(AJCC7_M.toString())).isEqualTo("M1"); assertThat(output.getOutput(STOR_AJCC7_M.toString())).isEqualTo("100"); assertThat(output.getOutput(AJCC7_MDESCRIPTOR.toString())).isEqualTo("c"); assertThat(output.getOutput(STOR_AJCC7_MDESCRIPTOR.toString())).isEqualTo("c"); assertThat(output.getOutput(AJCC7_STAGE.toString())).isEqualTo("IV"); assertThat(output.getOutput(STOR_AJCC7_STAGE.toString())).isEqualTo("700"); // Summary Stage assertThat(output.getOutput(SS1977_T.toString())).isEqualTo("L"); assertThat(output.getOutput(SS1977_N.toString())).isEqualTo("RN"); assertThat(output.getOutput(SS1977_M.toString())).isEqualTo("D"); assertThat(output.getOutput(SS1977_STAGE.toString())).isEqualTo("D"); assertThat(output.getOutput(STOR_SS1977_STAGE.toString())).isEqualTo("7"); assertThat(output.getOutput(SS2000_T.toString())).isEqualTo("L"); assertThat(output.getOutput(SS2000_N.toString())).isEqualTo("RN"); assertThat(output.getOutput(SS2000_M.toString())).isEqualTo("D"); assertThat(output.getOutput(SS2000_STAGE.toString())).isEqualTo("D"); assertThat(output.getOutput(STOR_SS2000_STAGE.toString())).isEqualTo("7"); } @Test public void testTnmInputBuilder() { TnmStagingData data1 = new TnmStagingData(); data1.setInput(TnmInput.PRIMARY_SITE, "C680"); data1.setInput(TnmInput.HISTOLOGY, "8000"); data1.setInput(TnmInput.BEHAVIOR, "3"); data1.setInput(TnmInput.GRADE, "9"); data1.setInput(TnmInput.DX_YEAR, "2013"); data1.setInput(TnmInput.REGIONAL_NODES_POSITIVE, "99"); data1.setInput(TnmInput.AGE_AT_DX, "060"); data1.setInput(TnmInput.SEX, "1"); data1.setInput(TnmInput.RX_SUMM_SURGERY, "8"); data1.setInput(TnmInput.RX_SUMM_RADIATION, "9"); data1.setInput(TnmInput.CLIN_T, "1"); data1.setInput(TnmInput.CLIN_N, "2"); data1.setInput(TnmInput.CLIN_M, "3"); data1.setInput(TnmInput.PATH_T, "4"); data1.setInput(TnmInput.PATH_N, "5"); data1.setInput(TnmInput.PATH_M, "6"); data1.setSsf(1, "020"); TnmStagingData data2 = new TnmStagingData.TnmStagingInputBuilder() .withInput(TnmInput.PRIMARY_SITE, "C680") .withInput(TnmInput.HISTOLOGY, "8000") .withInput(TnmInput.BEHAVIOR, "3") .withInput(TnmInput.GRADE, "9") .withInput(TnmInput.DX_YEAR, "2013") .withInput(TnmInput.REGIONAL_NODES_POSITIVE, "99") .withInput(TnmInput.AGE_AT_DX, "060") .withInput(TnmInput.SEX, "1") .withInput(TnmInput.RX_SUMM_SURGERY, "8") .withInput(TnmInput.RX_SUMM_RADIATION, "9") .withInput(TnmInput.CLIN_T, "1") .withInput(TnmInput.CLIN_N, "2") .withInput(TnmInput.CLIN_M, "3") .withInput(TnmInput.PATH_T, "4") .withInput(TnmInput.PATH_N, "5") .withInput(TnmInput.PATH_M, "6") .withSsf(1, "020").build(); assertThat(data1.getInput()).isEqualTo(data2.getInput()); } @Test public void testTnmStaging() throws IOException { TnmStagingData data = new TnmStagingInputBuilder() .withInput(TnmInput.PRIMARY_SITE, "C680") .withInput(TnmInput.HISTOLOGY, "8000") .withInput(TnmInput.BEHAVIOR, "3") .withInput(TnmInput.DX_YEAR, "2016") .withInput(TnmInput.RX_SUMM_SURGERY, "2") .withInput(TnmInput.RX_SUMM_RADIATION, "4") .withInput(TnmInput.REGIONAL_NODES_POSITIVE, "02") .withInput(TnmInput.CLIN_T, "c0") .withInput(TnmInput.CLIN_N, "c1") .withInput(TnmInput.CLIN_M, "c0") .withInput(TnmInput.PATH_T, "p0") .withInput(TnmInput.PATH_N, "p1") .withInput(TnmInput.PATH_M, "p1") .build(); // perform the staging StagingData output = _STAGING.stage("tnm", "1.9", data.getInput()).execute().body(); // check output assertThat(output).isNotNull(); assertThat(output.getResult()).isEqualTo(StagingData.Result.STAGED); assertThat(output.getSchemaId()).isEqualTo("urethra"); assertThat(output.getErrors()).isEmpty(); assertThat(output.getPath()).hasSize(25); assertThat(output.getOutput()).hasSize(10); // check outputs assertThat(output.getOutput(TnmOutput.DERIVED_VERSION.toString())).isEqualTo("1.9"); assertThat(output.getOutput(TnmOutput.CLIN_STAGE_GROUP.toString())).isEqualTo("3"); assertThat(output.getOutput(TnmOutput.PATH_STAGE_GROUP.toString())).isEqualTo("4"); assertThat(output.getOutput(TnmOutput.COMBINED_STAGE_GROUP.toString())).isEqualTo("4"); assertThat(output.getOutput(TnmOutput.COMBINED_T.toString())).isEqualTo("c0"); assertThat(output.getOutput(TnmOutput.SOURCE_T.toString())).isEqualTo("1"); assertThat(output.getOutput(TnmOutput.COMBINED_N.toString())).isEqualTo("c1"); assertThat(output.getOutput(TnmOutput.SOURCE_N.toString())).isEqualTo("1"); assertThat(output.getOutput(TnmOutput.COMBINED_M.toString())).isEqualTo("p1"); assertThat(output.getOutput(TnmOutput.SOURCE_M.toString())).isEqualTo("2"); } @Test public void testEodInputBuilder() { EodStagingData data1 = new EodStagingData(); data1.setInput(EodInput.PRIMARY_SITE, "C250"); data1.setInput(EodInput.HISTOLOGY, "8154"); data1.setInput(EodInput.DX_YEAR, "2018"); data1.setInput(EodInput.AGE_AT_DX, "060"); data1.setInput(EodInput.SEX, "1"); data1.setInput(EodInput.TUMOR_SIZE_SUMMARY, "004"); data1.setInput(EodInput.NODES_POS, "03"); data1.setInput(EodInput.EOD_PRIMARY_TUMOR, "500"); data1.setInput(EodInput.EOD_REGIONAL_NODES, "300"); data1.setInput(EodInput.EOD_METS, "10"); EodStagingData data2 = new EodStagingInputBuilder() .withInput(EodInput.PRIMARY_SITE, "C250") .withInput(EodInput.HISTOLOGY, "8154") .withInput(EodInput.DX_YEAR, "2018") .withInput(EodInput.AGE_AT_DX, "060") .withInput(EodInput.SEX, "1") .withInput(EodInput.TUMOR_SIZE_SUMMARY, "004") .withInput(EodInput.NODES_POS, "03") .withInput(EodInput.EOD_PRIMARY_TUMOR, "500") .withInput(EodInput.EOD_REGIONAL_NODES, "300") .withInput(EodInput.EOD_METS, "10").build(); assertThat(data1.getInput()).isEqualTo(data2.getInput()); } @Test public void testEodStaging() throws IOException { EodStagingData data = new EodStagingInputBuilder() .withInput(EodInput.PRIMARY_SITE, "C250") .withInput(EodInput.HISTOLOGY, "8154") .withInput(EodInput.DX_YEAR, "2018") .withInput(EodInput.TUMOR_SIZE_SUMMARY, "004") .withInput(EodInput.NODES_POS, "03") .withInput(EodInput.EOD_PRIMARY_TUMOR, "500") .withInput(EodInput.EOD_REGIONAL_NODES, "300") .withInput(EodInput.EOD_METS, "10").build(); // perform the staging StagingData output = _STAGING.stage("eod_public", "2.1", data.getInput()).execute().body(); assertThat(output).isNotNull(); assertThat(output.getResult()).isEqualTo(StagingData.Result.STAGED); assertThat(output.getSchemaId()).isEqualTo("pancreas"); assertThat(output.getErrors()).isEmpty(); assertThat(output.getPath()).hasSize(12); assertThat(output.getOutput()).hasSize(9); // check outputs assertThat(output.getOutput(EodOutput.DERIVED_VERSION.toString())).isEqualTo("2.1"); assertThat(output.getOutput(EodOutput.SS_2018_DERIVED.toString())).isEqualTo("7"); assertThat(output.getOutput(EodOutput.NAACCR_SCHEMA_ID.toString())).isEqualTo("00280"); assertThat(output.getOutput(EodOutput.EOD_2018_STAGE_GROUP.toString())).isEqualTo("4"); assertThat(output.getOutput(EodOutput.EOD_2018_T.toString())).isEqualTo("T1a"); assertThat(output.getOutput(EodOutput.EOD_2018_N.toString())).isEqualTo("N1"); assertThat(output.getOutput(EodOutput.EOD_2018_M.toString())).isEqualTo("M1"); assertThat(output.getOutput(EodOutput.AJCC_ID.toString())).isEqualTo("28"); } @Test public void testStagingWithErrors() throws IOException { StagingData data = new StagingData(); data.setInput("site", "C181"); data.setInput("hist", "8093"); data.setInput("year_dx", "2015"); data.setInput("extension", "670"); // perform the staging StagingData output = _STAGING.stage(_ALGORITHM, _VERSION, data.getInput()).execute().body(); assertThat(output).isNotNull(); assertThat(output.getResult()).isEqualTo(StagingData.Result.STAGED); assertThat(output.getErrors()).hasSize(9); } @Test public void testStagingGlossary() throws IOException { Set<KeywordMatch> matches = _STAGING.schemaGlossary("eod_public", "2.0", "breast", null, true).execute().body(); assertThat(matches).hasSize(26); matches = _STAGING.schemaGlossary("eod_public", "2.0", "breast", EnumSet.of(Category.STAGING), true).execute().body(); assertThat(matches).hasSize(1); matches = _STAGING.tableGlossary("eod_public", "2.0", "cea_pretx_lab_value_33864", null, true).execute().body(); assertThat(matches).hasSize(24); matches = _STAGING.tableGlossary("eod_public", "2.0", "cea_pretx_lab_value_33864", EnumSet.of(Category.STAGING), true).execute().body(); assertThat(matches).isEmpty(); } @Test public void testStagingMetadata() throws IOException { StagingSchema schema = _STAGING.schemaById("eod_public", "2.0", "brain").execute().body(); assertThat(schema).isNotNull(); StagingSchemaInput mgmt = schema.getInputs().stream().filter(i -> i.getKey().equals("mgmt")).findFirst().orElse(null); assertThat(mgmt).isNotNull(); assertThat(mgmt.getMetadata()).extracting("name").containsExactlyInAnyOrder("COC_REQUIRED", "SEER_REQUIRED", "SSDI"); } @Test public void testBeans() { MatcherAssert.assertThat(StagingAlgorithm.class, CoreMatchers.allOf(hasValidBeanConstructor(), hasValidGettersAndSetters())); MatcherAssert.assertThat(StagingMetadata.class, CoreMatchers.allOf(hasValidBeanConstructor(), hasValidGettersAndSetters(), hasValidBeanEquals())); MatcherAssert.assertThat(StagingVersion.class, CoreMatchers.allOf(hasValidBeanConstructor(), hasValidGettersAndSettersExcluding("production", "beta", "development"))); MatcherAssert.assertThat(StagingSchema.class, CoreMatchers.allOf(hasValidBeanConstructor(), hasValidGettersAndSetters())); MatcherAssert.assertThat(StagingSchemaInfo.class, CoreMatchers.allOf(hasValidBeanConstructor(), hasValidGettersAndSetters())); MatcherAssert.assertThat(StagingSchemaInput.class, CoreMatchers.allOf(hasValidBeanConstructor(), hasValidGettersAndSetters())); MatcherAssert.assertThat(StagingSchemaOutput.class, CoreMatchers.allOf(hasValidBeanConstructor(), hasValidGettersAndSetters())); MatcherAssert.assertThat(StagingTable.class, CoreMatchers.allOf(hasValidBeanConstructor(), hasValidGettersAndSetters())); MatcherAssert.assertThat(StagingTablePath.class, CoreMatchers.allOf(hasValidBeanConstructor(), hasValidGettersAndSetters())); MatcherAssert.assertThat(StagingColumnDefinition.class, CoreMatchers.allOf(hasValidBeanConstructor(), hasValidGettersAndSetters())); MatcherAssert.assertThat(StagingSchemaInput.class, CoreMatchers.allOf(hasValidBeanConstructor(), hasValidGettersAndSetters())); MatcherAssert.assertThat(StagingSchemaOutput.class, CoreMatchers.allOf(hasValidBeanConstructor(), hasValidGettersAndSetters())); MatcherAssert.assertThat(StagingMapping.class, CoreMatchers.allOf(hasValidBeanConstructor(), hasValidGettersAndSetters())); MatcherAssert.assertThat(StagingKeyMapping.class, CoreMatchers.allOf(hasValidBeanConstructor(), hasValidGettersAndSetters())); MatcherAssert.assertThat(StagingKeyValue.class, CoreMatchers.allOf(hasValidBeanConstructor(), hasValidGettersAndSetters())); MatcherAssert.assertThat(StagingError.class, CoreMatchers.allOf(hasValidBeanConstructor(), hasValidGettersAndSetters())); MatcherAssert.assertThat(YearRange.class, CoreMatchers.allOf(hasValidBeanConstructor(), hasValidGettersAndSetters())); MatcherAssert.assertThat(YearRangeString.class, CoreMatchers.allOf(hasValidBeanConstructor(), hasValidGettersAndSetters())); MatcherAssert.assertThat(YearRangeInteger.class, CoreMatchers.allOf(hasValidBeanConstructor(), hasValidGettersAndSetters())); MatcherAssert.assertThat(DateRange.class, CoreMatchers.allOf(hasValidBeanConstructor(), hasValidGettersAndSetters())); MatcherAssert.assertThat(DateRangeString.class, CoreMatchers.allOf(hasValidBeanConstructor(), hasValidGettersAndSetters())); } }
package com.milaboratory.core.mutations; import com.milaboratory.core.alignment.Aligner; import com.milaboratory.core.alignment.Alignment; import com.milaboratory.core.alignment.LinearGapAlignmentScoring; import com.milaboratory.core.sequence.NucleotideSequence; import org.junit.Assert; import org.junit.Test; import static org.junit.Assert.assertEquals; import static org.junit.Assert.assertTrue; /** * @author Dmitry Bolotin * @author Stanislav Poslavsky */ public class MutationsTest { @Test public void testCombine1() throws Exception { NucleotideSequence seq1 = new NucleotideSequence("ATTAGACA"), seq2 = new NucleotideSequence("CATTACCA"), seq3 = new NucleotideSequence("CATAGCCA"); Mutations<NucleotideSequence> m1 = Aligner.alignGlobal(LinearGapAlignmentScoring.getNucleotideBLASTScoring(), seq1, seq2).getGlobalMutations(), m2 = Aligner.alignGlobal(LinearGapAlignmentScoring.getNucleotideBLASTScoring(), seq2, seq3).getGlobalMutations(); checkMutations(m1); checkMutations(m2); Mutations<NucleotideSequence> m3 = m1.combineWith(m2); assertTrue(MutationsUtil.check(m3)); Assert.assertEquals(seq3, m3.mutate(seq1)); } @Test public void testCombine2() throws Exception { NucleotideSequence seq1 = new NucleotideSequence("ACGTGTTACCGGTGATT"), seq2 = new NucleotideSequence("AGTTCTTGTTTTTTCCGTAC"), seq3 = new NucleotideSequence("ATCCGTAAATTACGTGCTGT"); Mutations<NucleotideSequence> m1 = Aligner.alignGlobal(LinearGapAlignmentScoring.getNucleotideBLASTScoring(), seq1, seq2).getGlobalMutations(), m2 = Aligner.alignGlobal(LinearGapAlignmentScoring.getNucleotideBLASTScoring(), seq2, seq3).getGlobalMutations(); Mutations<NucleotideSequence> m3 = m1.combineWith(m2); assertTrue(MutationsUtil.check(m3)); checkMutations(m1); checkMutations(m2); checkMutations(m3); Assert.assertEquals(seq3, m3.mutate(seq1)); } @Test public void testCombine3() throws Exception { NucleotideSequence seq1 = new NucleotideSequence("AACTGCTAACTCGA"), seq2 = new NucleotideSequence("CGAACGTTAAGCACAAA"), seq3 = new NucleotideSequence("CAAATGTGAGATC"); Mutations<NucleotideSequence> m1 = Aligner.alignGlobal(LinearGapAlignmentScoring.getNucleotideBLASTScoring(), seq1, seq2).getGlobalMutations(), m2 = Aligner.alignGlobal(LinearGapAlignmentScoring.getNucleotideBLASTScoring(), seq2, seq3).getGlobalMutations(); Mutations<NucleotideSequence> m3 = m1.combineWith(m2); assertTrue(MutationsUtil.check(m3)); checkMutations(m1); checkMutations(m2); checkMutations(m3); Assert.assertEquals(seq3, m3.mutate(seq1)); } @Test public void testBS() throws Exception { NucleotideSequence seq1 = new NucleotideSequence("TGACCCGTAACCCCCCGGT"), seq2 = new NucleotideSequence("CGTAACTTCAGCCT"); Alignment<NucleotideSequence> alignment = Aligner.alignGlobal(LinearGapAlignmentScoring.getNucleotideBLASTScoring(), seq1, seq2); // AlignmentHelper helper = alignment.getAlignmentHelper(); // System.out.println(helper); // int p; // for (int i = helper.size() - 1; i >= 0; --i) { // if ((p = helper.convertPositionToSeq1(i)) > 0) // assertEquals(NucleotideSequence.ALPHABET.symbolFromCode(seq1.codeAt(p)), // helper.getLine1().charAt(i)); // if ((p = helper.convertPositionToSeq2(i)) > 0) // assertEquals(NucleotideSequence.ALPHABET.symbolFromCode(seq2.codeAt(p)), // helper.getLine3().charAt(i)); Mutations<NucleotideSequence> mutations = alignment.getGlobalMutations(); checkMutations(mutations); Assert.assertEquals(-1, mutations.firstMutationWithPosition(-1)); Assert.assertEquals(3, mutations.firstMutationWithPosition(3)); Assert.assertEquals(4, mutations.firstMutationWithPosition(4)); Assert.assertEquals(-6, mutations.firstMutationWithPosition(5)); Assert.assertEquals(5, mutations.firstMutationWithPosition(11)); Assert.assertEquals(7, mutations.firstMutationWithPosition(12)); Assert.assertEquals(8, mutations.firstMutationWithPosition(13)); } public static void checkMutations(Mutations mutations) { assertEquals("Encode/Decode", mutations, Mutations.decode(mutations.encode(), NucleotideSequence.ALPHABET)); } @Test public void test1() throws Exception { MutationsBuilder<NucleotideSequence> builder = new MutationsBuilder<>(NucleotideSequence.ALPHABET); builder.appendDeletion(1, 2); builder.appendDeletion(2, 1); builder.appendSubstitution(7, 3, 1); builder.appendInsertion(9, 2); builder.appendSubstitution(10, 3, 1); Mutations<NucleotideSequence> mutations = builder.createAndDestroy(); assertEquals(1, mutations.getPositionByIndex(0)); assertEquals(1, mutations.getFromByIndex(1)); assertEquals(3, mutations.getFromByIndex(2)); assertEquals(1, mutations.getToByIndex(2)); assertEquals(9, mutations.getPositionByIndex(3)); assertEquals(2, mutations.getToByIndex(3)); assertEquals(1, mutations.getToByIndex(4)); assertEquals(10, mutations.getPositionByIndex(4)); } @Test public void test2() throws Exception { MutationsBuilder<NucleotideSequence> builder = new MutationsBuilder<>(NucleotideSequence.ALPHABET); builder.appendDeletion(1, 2); builder.appendDeletion(2, 1); builder.appendSubstitution(7, 3, 1); builder.appendInsertion(9, 2); builder.appendSubstitution(10, 3, 1); Mutations<NucleotideSequence> mutations = builder.createAndDestroy(); assertEquals(1, mutations.firsMutationPosition()); assertEquals(10, mutations.lastMutationPosition()); } }
package com.pm.server.repository; import static org.junit.Assert.assertEquals; import static org.junit.Assert.assertNull; import static org.junit.Assert.assertSame; import static org.junit.Assert.assertTrue; import static org.junit.Assert.fail; import java.util.ArrayList; import java.util.Arrays; import java.util.List; import org.apache.logging.log4j.LogManager; import org.apache.logging.log4j.Logger; import org.junit.After; import org.junit.Before; import org.junit.Test; import org.springframework.beans.factory.annotation.Autowired; import com.pm.server.TestTemplate; import com.pm.server.datatype.Coordinate; import com.pm.server.datatype.CoordinateImpl; import com.pm.server.datatype.PlayerState; import com.pm.server.player.Pacman; import com.pm.server.player.PacmanImpl; public class PacmanRepositoryTest extends TestTemplate { private List<Pacman> pacmanList = new ArrayList<Pacman>(); private final static Integer numOfPacmans = 2; private static final List<Integer> randomIdList = Arrays.asList( 95873, 30839, 34918 ); private static final List<Coordinate> randomCoordinateList = Arrays.asList( new CoordinateImpl(45983.39872, 98347.39182), new CoordinateImpl(39487.22889, 90893.32281), new CoordinateImpl(49990.12929, 48982.39489) ); @Autowired private PacmanRepository pacmanRepository; private static final Logger log = LogManager.getLogger(PacmanRepositoryTest.class.getName()); @Before public void setUp() { for(Integer i = 0; i < numOfPacmans; i++) { // Arbitrary decimal values Coordinate coordinate = new CoordinateImpl( (i+12345.6789) / 100, (i-9876.54321) / 100 ); Pacman pacman = new PacmanImpl(); pacman.setId(i); pacman.setLocation(coordinate); pacmanList.add(pacman); } assert(pacmanList.size() == numOfPacmans); } @After public void cleanUp() { pacmanRepository.clearPlayers(); assert(pacmanRepository.getPlayer() == null); pacmanList.clear(); assert(pacmanList.size() == 0); } @Test public void unitTest_addPlayer() { // Given Pacman pacman = pacmanList.get(0); // When addPlayer_failUponException(pacman); // Then Pacman pacmanReturned = pacmanRepository.getPlayer(); assertEquals(pacman.getId(), pacmanReturned.getId()); assertEquals(pacman.getLocation(), pacmanReturned.getLocation()); } @Test public void unitTest_addPlayer_noId() { // Given Pacman pacman = pacmanList.get(0); pacman.setId(null); // When addPlayer_failUponException(pacman); // Then Pacman pacman_returned = pacmanRepository.getPlayer(); assertEquals(pacman.getLocation(), pacman_returned.getLocation()); } @Test public void unitTest_addPlayer_noLocation() { // Given Pacman pacman = pacmanList.get(0); pacman.setLocation(null); // When addPlayer_failUponException(pacman); // Then Pacman pacman_returned = pacmanRepository.getPlayer(); assertEquals(pacman.getId(), pacman_returned.getId()); } @Test public void unitTest_addPlayer_nullPlayer() { // Given // When addPlayer_failUponException(null); // Then assertNull(pacmanRepository.getPlayer()); } @Test(expected = IllegalStateException.class) public void unitTest_addPlayer_pacmanAlreadyExists() throws Exception { // Given Pacman pacman1 = pacmanList.get(0); Pacman pacman2 = pacmanList.get(1); addPlayer_failUponException(pacman1); // When pacmanRepository.addPlayer(pacman2); // Then // Exception thrown above } @Test public void unitTest_deletePlayerById() { // Given addPlayer_failUponException(pacmanList.get(0)); Integer randomId = randomIdList.get(0); // When try { pacmanRepository.deletePlayerById(randomId); } catch(Exception e) { log.error(e.getMessage()); fail(); } // Then assertNull(pacmanRepository.getPlayer()); } @Test public void unitTest_deletePlayerById_noId() { // Given addPlayer_failUponException(pacmanList.get(0)); // When try { pacmanRepository.deletePlayerById(null); } catch(Exception e) { log.error(e.getMessage()); fail(); } // Then assertNull(pacmanRepository.getPlayer()); } @Test(expected = IllegalStateException.class) public void unitTest_deletePlayerById_noPlayer() throws Exception { // Given Integer randomId = randomIdList.get(0); // When pacmanRepository.deletePlayerById(randomId); // Then // Exception thrown above } @Test public void unitTest_clearPlayers() { // Given addPlayer_failUponException(pacmanList.get(0)); // When pacmanRepository.clearPlayers(); // Then assertNull(pacmanRepository.getPlayer()); } @Test public void unitTest_getPlayerById() { // Given Pacman pacman = pacmanList.get(0); addPlayer_failUponException(pacman); Integer randomId = randomIdList.get(0); // When Pacman pacmanReturned = pacmanRepository.getPlayerById(randomId); // Then assertSame(pacman.getLocation(), pacmanReturned.getLocation()); } @Test public void unitTest_getPlayerById_nullAddedId() { // Given Pacman pacman = pacmanList.get(0); pacman.setId(null); addPlayer_failUponException(pacman); Integer randomId = randomIdList.get(0); // When Pacman pacmanReturned = pacmanRepository.getPlayerById(randomId); // Then assertSame(pacman.getLocation(), pacmanReturned.getLocation()); } @Test public void unitTest_getPlayerById_nullRequestedId() { // Given Pacman pacman = pacmanList.get(0); addPlayer_failUponException(pacman); // When Pacman pacmanReturned = pacmanRepository.getPlayerById(null); // Then assertSame(pacman.getLocation(), pacmanReturned.getLocation()); } @Test public void unitTest_getPlayerById_noPacman() { // Given Integer randomId = randomIdList.get(0); // When Pacman pacmanReturned = pacmanRepository.getPlayerById(randomId); // Then assertNull(pacmanReturned); } @Test public void unitTest_getPlayer() { // Given Pacman pacman = pacmanList.get(0); addPlayer_failUponException(pacman); // When Pacman pacmanReturned = pacmanRepository.getPlayer(); // Then assertEquals(pacman, pacmanReturned); } @Test public void unitTest_getPlayer_noPacman() { // Given // When Pacman pacmanReturned = pacmanRepository.getPlayer(); // Then assertNull(pacmanReturned); } @Test public void unitTest_getAllPlayers() { // Given Pacman pacman = pacmanList.get(0); addPlayer_failUponException(pacman); // When List<Pacman> pacmanReturnedList = pacmanRepository.getAllPlayers(); // Then assertSame(pacman, pacmanReturnedList.get(0)); } @Test public void unitTest_getAllPlayers_noPacman() { // Given // When List<Pacman> pacmanReturnedList = pacmanRepository.getAllPlayers(); // Then assertTrue(pacmanReturnedList.isEmpty()); } @Test public void unitTest_setPlayerLocationById() { // Given Pacman pacman = pacmanList.get(0); addPlayer_failUponException(pacman); Coordinate newLocation = randomCoordinateList.get(0); // When pacmanRepository.setPlayerLocationById(pacman.getId(), newLocation); // Then Pacman pacmanReturned = pacmanRepository.getPlayer(); assertSame(newLocation, pacmanReturned.getLocation()); } @Test public void unitTest_setPlayerLocationById_randomId() { // Given Pacman pacman = pacmanList.get(0); addPlayer_failUponException(pacman); Integer randomId = randomIdList.get(0); Coordinate newLocation = randomCoordinateList.get(0); // When pacmanRepository.setPlayerLocationById(randomId, newLocation); // Then Pacman pacmanReturned = pacmanRepository.getPlayer(); assertSame(newLocation, pacmanReturned.getLocation()); } @Test public void unitTest_setPlayerLocationById_nullId() { // Given Pacman pacman = pacmanList.get(0); addPlayer_failUponException(pacman); Coordinate newLocation = randomCoordinateList.get(0); // When pacmanRepository.setPlayerLocationById(null, newLocation); // Then Pacman pacmanReturned = pacmanRepository.getPlayer(); assertSame(newLocation, pacmanReturned.getLocation()); } @Test(expected = NullPointerException.class) public void unitTest_setPlayerLocationById_nullLocation() { // Given Integer randomId = randomIdList.get(0); // When pacmanRepository.setPlayerLocationById(randomId, null); // Then // Exception thrown above } @Test(expected = IllegalStateException.class) public void unitTest_setPlayerLocationById_noPacman() throws IllegalArgumentException { // Given Integer randomId = randomIdList.get(0); Coordinate newLocation = randomCoordinateList.get(0); // When pacmanRepository.setPlayerLocationById(randomId, newLocation); // Then // Exception thrown above } @Test public void unitTest_setPlayerLocation() { // Given Pacman pacman = pacmanList.get(0); addPlayer_failUponException(pacman); Coordinate newLocation = randomCoordinateList.get(0); // When pacmanRepository.setPlayerLocation(newLocation); // Then Pacman pacmanReturned = pacmanRepository.getPlayer(); assertSame(newLocation, pacmanReturned.getLocation()); } @Test(expected = NullPointerException.class) public void unitTest_setPlayerLocation_nullLocation() { // Given // When pacmanRepository.setPlayerLocation(null); // Then // Exception thrown above } @Test(expected = IllegalStateException.class) public void unitTest_setPlayerLocation_noPacman() throws IllegalArgumentException { // Given Coordinate newLocation = randomCoordinateList.get(0); // When pacmanRepository.setPlayerLocation(newLocation); // Then // Exception thrown above } @Test public void unitTest_setPlayerStateById() { // Given Pacman pacman = pacmanList.get(0); addPlayer_failUponException(pacman); PlayerState newState = PlayerState.ACTIVE; // When pacmanRepository.setPlayerStateById(pacman.getId(), newState); // Then Pacman pacmanResult = pacmanRepository.getPlayer(); assertEquals(newState, pacmanResult.getState()); } @Test public void unitTest_setPlayerStateById_sameState() { // Given Pacman pacman = pacmanList.get(0); addPlayer_failUponException(pacman); PlayerState newState = PlayerState.ACTIVE; pacmanRepository.setPlayerState(newState); // When pacmanRepository.setPlayerStateById(pacman.getId(), newState); // Then Pacman pacmanResult = pacmanRepository.getPlayer(); assertEquals(newState, pacmanResult.getState()); } @Test public void unitTest_setPlayerStateById_nullId() { // Given Pacman pacman = pacmanList.get(0); addPlayer_failUponException(pacman); PlayerState newState = PlayerState.ACTIVE; // When pacmanRepository.setPlayerStateById(null, newState); // Then Pacman pacmanResult = pacmanRepository.getPlayer(); assertEquals(newState, pacmanResult.getState()); } @Test(expected = NullPointerException.class) public void unitTest_setPlayerStateById_nullState() { // Given Pacman pacman = pacmanList.get(0); addPlayer_failUponException(pacman); // When pacmanRepository.setPlayerStateById(pacman.getId(), null); // Then // Exception thrown above } @Test public void unitTest_setPlayerState() { // Given Pacman pacman = pacmanList.get(0); addPlayer_failUponException(pacman); PlayerState newState = PlayerState.ACTIVE; // When pacmanRepository.setPlayerState(newState); // Then Pacman pacmanResult = pacmanRepository.getPlayer(); assertEquals(newState, pacmanResult.getState()); } @Test public void unitTest_setPlayerState_sameState() { // Given Pacman pacman = pacmanList.get(0); addPlayer_failUponException(pacman); PlayerState newState = PlayerState.ACTIVE; pacmanRepository.setPlayerState(newState); // When pacmanRepository.setPlayerState(newState); // Then Pacman pacmanResult = pacmanRepository.getPlayer(); assertEquals(newState, pacmanResult.getState()); } @Test(expected = NullPointerException.class) public void unitTest_setPlayerState_nullState() { // Given Pacman pacman = pacmanList.get(0); addPlayer_failUponException(pacman); // When pacmanRepository.setPlayerState(null); // Then // Exception thrown above } @Test public void unitTest_clearPlayers_noPlayer() { // Given // When pacmanRepository.clearPlayers(); // Then assertNull(pacmanRepository.getPlayer()); } @Test public void unitTest_numOfPlayers_0players() { // Given // When Integer numOfPlayers = pacmanRepository.numOfPlayers(); // Then assertEquals((Integer)0, numOfPlayers); } @Test public void unitTest_numofPlayers_1player() { // Given addPlayer_failUponException(pacmanList.get(0)); // When Integer numOfPlayers = pacmanRepository.numOfPlayers(); // Then assertEquals((Integer)1, numOfPlayers); } private void addPlayer_failUponException(Pacman pacman) { try { pacmanRepository.addPlayer(pacman); } catch (Exception e) { log.error(e.getMessage()); fail(); } } }
package oshi; import junit.framework.TestCase; import oshi.hardware.HardwareAbstractionLayer; import oshi.hardware.Memory; import oshi.hardware.Processor; import oshi.software.os.OperatingSystem; import oshi.software.os.OperatingSystemVersion; import oshi.util.FormatUtil; /** * @author dblock[at]dblock[dot]org */ public class SystemInfoTests extends TestCase { public static void main(String[] args) { SystemInfo si = new SystemInfo(); // software // software: operating system OperatingSystem os = si.getOperatingSystem(); System.out.println(os); // hardware HardwareAbstractionLayer hal = si.getHardware(); // hardware: processors System.out.println(hal.getProcessors().length + " CPU(s):"); for(Processor cpu : hal.getProcessors()) { System.out.println(" " + cpu); } // hardware: memory System.out.println("Memory: " + FormatUtil.formatBytes(hal.getMemory().getAvailable()) + "/" + FormatUtil.formatBytes(hal.getMemory().getTotal())); } public void testGetVersion() { SystemInfo si = new SystemInfo(); OperatingSystem os = si.getOperatingSystem(); assertNotNull(os); OperatingSystemVersion version = os.getVersion(); assertNotNull(version); assertTrue(os.toString().length() > 0); } public void testGetProcessors() { SystemInfo si = new SystemInfo(); HardwareAbstractionLayer hal = si.getHardware(); assertTrue(hal.getProcessors().length > 0); } public void testGetMemory() { SystemInfo si = new SystemInfo(); HardwareAbstractionLayer hal = si.getHardware(); Memory memory = hal.getMemory(); assertNotNull(memory); assertTrue(memory.getTotal() > 0); assertTrue(memory.getAvailable() >= 0); assertTrue(memory.getAvailable() <= memory.getTotal()); } }
package com.poiji.deserialize; import com.poiji.deserialize.model.EmployeeExtended; import com.poiji.exception.PoijiException; import com.poiji.internal.Poiji; import com.poiji.option.PoijiOptions; import org.junit.Test; import org.junit.runner.RunWith; import org.junit.runners.Parameterized; import java.io.File; import java.text.ParseException; import java.text.SimpleDateFormat; import java.util.ArrayList; import java.util.Arrays; import java.util.List; import static org.hamcrest.CoreMatchers.instanceOf; import static org.hamcrest.CoreMatchers.is; import static org.hamcrest.CoreMatchers.not; import static org.hamcrest.CoreMatchers.notNullValue; import static org.junit.Assert.assertThat; import static org.junit.Assert.fail; @RunWith(Parameterized.class) public class DerializersExtendedTest { private String path; private List<EmployeeExtended> expectedEmployess; private Class<?> expectedException; public DerializersExtendedTest(String path, List<EmployeeExtended> expectedEmployess, Class<?> expectedException) { this.path = path; this.expectedEmployess = expectedEmployess; this.expectedException = expectedException; } @Parameterized.Parameters(name = "{index}: ({0})={1}") public static Iterable<Object[]> queries() throws Exception { return Arrays.asList(new Object[][]{ {"src/test/resources/employees_extended.xls", unmarshalling(), null}, {"src/test/resources/cloud.xls", unmarshalling(), PoijiException.class}, }); } @Test public void shouldMapExcelToJava() { try { PoijiOptions options = PoijiOptions.PoijiOptionsBuilder.settings().skip(1).datePattern("dd/mm/yyyy").build(); List<EmployeeExtended> actualEmployees = Poiji.fromExcel(new File(path), EmployeeExtended.class, options); assertThat(actualEmployees, notNullValue()); assertThat(actualEmployees.size(), not(0)); assertThat(actualEmployees.size(), is(expectedEmployess.size())); EmployeeExtended actualEmployee1 = actualEmployees.get(0); EmployeeExtended actualEmployee2 = actualEmployees.get(1); EmployeeExtended actualEmployee3 = actualEmployees.get(2); EmployeeExtended expectedEmployee1 = expectedEmployess.get(0); EmployeeExtended expectedEmployee2 = expectedEmployess.get(1); EmployeeExtended expectedEmployee3 = expectedEmployess.get(2); assertThat(actualEmployee1.toString(), is(expectedEmployee1.toString())); assertThat(actualEmployee2.toString(), is(expectedEmployee2.toString())); assertThat(actualEmployee3.toString(), is(expectedEmployee3.toString())); } catch (Exception e) { if (expectedException == null) { fail(e.getMessage()); } else { assertThat(e, instanceOf(expectedException)); } } } private static List<EmployeeExtended> unmarshalling() throws ParseException { List<EmployeeExtended> employees = new ArrayList<>(3); SimpleDateFormat sdf = new SimpleDateFormat("dd/mm/yyyy"); EmployeeExtended employee1 = new EmployeeExtended(); employee1.setEmployeeId(123923L); employee1.setName("Joe"); employee1.setSurname("Doe"); employee1.setSingle(true); employee1.setAge(30); employee1.setBirthday("4/9/1987"); employee1.setRate(4.9); employee1.setDate(sdf.parse("05/01/2017 22:00:01.0")); employees.add(employee1); EmployeeExtended employee2 = new EmployeeExtended(); employee2.setEmployeeId(123123L); employee2.setName("Sophie"); employee2.setSurname("Derue"); employee2.setSingle(false); employee2.setAge(20); employee2.setBirthday("5/3/1997"); employee2.setRate(5.3); employee2.setDate((sdf).parse("05/01/2017 22:00:01.0")); employees.add(employee2); EmployeeExtended employee3 = new EmployeeExtended(); employee3.setEmployeeId(135923L); employee3.setName("Paul"); employee3.setSurname("Raul"); employee3.setSingle(false); employee3.setAge(31); employee3.setBirthday("4/9/1986"); employee3.setRate(6.6); employee3.setDate(sdf.parse("05/01/2017 22:00:01.0")); employees.add(employee3); return employees; } }
package com.richodemus.dropwizard.jwt; import com.richodemus.dropwizard.jwt.helpers.TestApp; import com.richodemus.dropwizard.jwt.helpers.TestConfiguration; import com.richodemus.dropwizard.jwt.helpers.model.CreateUserRequest; import com.richodemus.dropwizard.jwt.helpers.model.CreateUserResponse; import com.richodemus.dropwizard.jwt.helpers.model.LoginRequest; import com.richodemus.dropwizard.jwt.model.Role; import io.dropwizard.testing.DropwizardTestSupport; import io.dropwizard.testing.ResourceHelpers; import org.junit.After; import org.junit.Before; import org.junit.Test; import javax.ws.rs.ForbiddenException; import javax.ws.rs.client.ClientBuilder; import javax.ws.rs.client.Entity; import static org.assertj.core.api.Assertions.assertThat; public class IntegrationTest { private static final String EXISTING_USER = "existing_user"; private static final String EXISTING_USER_PASSWORD = "existing_user_password"; private static final Role EXISTING_USER_ROLE = new Role("user"); public DropwizardTestSupport<TestConfiguration> target; @Before public void setUp() throws Exception { target = new DropwizardTestSupport<>(TestApp.class, ResourceHelpers.resourceFilePath("conf.yaml")); target.before(); } @After public void tearDown() throws Exception { target.after(); } @Test public void shouldCreateUser() throws Exception { final CreateUserResponse result = ClientBuilder.newClient() .target("http://localhost:" + target.getLocalPort()) .path("api/login/new") .request() .post(Entity.json(new CreateUserRequest(EXISTING_USER, EXISTING_USER_PASSWORD, EXISTING_USER_ROLE.stringValue())), CreateUserResponse.class); assertThat(result.getResult()).isEqualTo(CreateUserResponse.Result.OK); final Token result2 = ClientBuilder.newClient() .target("http://localhost:" + target.getLocalPort()) .path("api/login") .request() .post(Entity.json(new LoginRequest(EXISTING_USER, EXISTING_USER_PASSWORD)), Token.class); assertThat(result2.getUsername()).isEqualTo(EXISTING_USER); assertThat(result2.getRole()).isEqualTo(EXISTING_USER_ROLE.stringValue()); } @Test(expected = ForbiddenException.class) public void shouldLoginUser() throws Exception { ClientBuilder.newClient() .target("http://localhost:" + target.getLocalPort()) .path("api/login") .request() .post(Entity.json(new LoginRequest(EXISTING_USER, EXISTING_USER_PASSWORD)), Token.class); } }
package com.scienceminer.nerd.mention; import com.scienceminer.nerd.disambiguation.NerdContext; import com.scienceminer.nerd.service.NerdQuery; import com.scienceminer.nerd.utilities.StringPos; import com.scienceminer.nerd.utilities.Utilities; import org.grobid.core.analyzers.GrobidAnalyzer; import org.grobid.core.lang.Language; import org.grobid.core.layout.LayoutToken; import org.junit.Before; import org.junit.Ignore; import org.junit.Test; import java.util.*; import java.util.prefs.PreferenceChangeEvent; import java.util.stream.Collector; import java.util.stream.Collectors; import static org.hamcrest.CoreMatchers.is; import static org.hamcrest.CoreMatchers.notNullValue; import static org.hamcrest.Matchers.greaterThan; import static org.hamcrest.Matchers.hasSize; import static org.junit.Assert.*; public class ProcessTextTest { private ProcessText processText = null; static final String testText = "Other factors were also at play, said Felix Boni, head of research at " + "James Capel in Mexico City, such as positive technicals and economic uncertainty in Argentina, " + "which has put it and neighbouring Brazil's markets at risk."; @Before public void setUp() throws Exception { processText = new ProcessText(true); } @Test public void testAcronymsStringAllLower() { String input = "A graphical model or probabilistic graphical model (PGM) is a probabilistic model."; Map<Mention, Mention> acronyms = processText.acronymCandidates(input, new Language("en", 1.0)); assertNotNull(acronyms); for (Map.Entry<Mention, Mention> entry : acronyms.entrySet()) { Mention base = entry.getValue(); Mention acronym = entry.getKey(); assertEquals(input.substring(acronym.getOffsetStart(), acronym.getOffsetEnd()).trim(), "PGM"); assertEquals(base.getRawName(), "probabilistic graphical model"); } } @Test @Ignore("Not yet finished") public void testAcronymCandidates() { String input = "We are working with Pulse Calculation Tarmac (P.C.T.) during our discovery on science"; final Map<Mention, Mention> acronyms = processText.acronymCandidates(input, new Language("en")); assertThat(acronyms.keySet(), hasSize(1)); } @Test public void testAcronymsTokensAllLower() { String input = "A graphical model or probabilistic graphical model (PGM) is a probabilistic model."; List<LayoutToken> tokens = GrobidAnalyzer.getInstance().tokenizeWithLayoutToken(input, new Language("en", 1.0)); Map<Mention, Mention> acronyms = processText.acronymCandidates(tokens); assertThat(acronyms.entrySet(), hasSize(1)); final ArrayList<Mention> keys = new ArrayList<>(acronyms.keySet()); final Mention shortAcronym = keys.get(0); final Mention extendedAcronym = acronyms.get(shortAcronym); assertThat(extendedAcronym.getRawName(), is("probabilistic graphical model")); assertThat(input.substring(shortAcronym.getOffsetStart(), shortAcronym.getOffsetEnd()), is("PGM")); } @Test public void testAcronymsTokens() { String input = "Figure 4. \n" + "Canonical Correspondence Analysis (CCA) diagram showing the ordination of anopheline species along the\n" + "first two axes and their correlation with environmental variables. The first axis is horizontal, second vertical. Direction\n" + "and length of arrows shows the degree of correlation between mosquito larvae and the variables."; List<LayoutToken> tokens = GrobidAnalyzer.getInstance().tokenizeWithLayoutToken(input, new Language("en", 1.0)); Map<Mention, Mention> acronyms = processText.acronymCandidates(tokens); assertNotNull(acronyms); for (Map.Entry<Mention, Mention> entry : acronyms.entrySet()) { Mention base = entry.getValue(); Mention acronym = entry.getKey(); assertEquals(input.substring(acronym.getOffsetStart(), acronym.getOffsetEnd()).trim(), "CCA"); assertEquals(base.getRawName(), "Canonical Correspondence Analysis"); assertThat(acronym.getOffsetStart(), is(46)); assertThat(acronym.getOffsetEnd(), is(49)); } } @Test @Ignore("Failing test") public void testPropagateAcronyms_textSyncronisedWithLayoutTokens_shouldWork() { String input = "The Pulse Covariant Transmission (PCT) is a great deal. We are going to make it great again.\n " + "We propose a new methodology where the PCT results are improving in the gamma ray action matter."; final Language language = new Language("en"); List<LayoutToken> tokens = GrobidAnalyzer.getInstance().tokenizeWithLayoutToken(input, language); NerdQuery aQuery = new NerdQuery(); aQuery.setText(input); aQuery.setTokens(tokens); final HashMap<Mention, Mention> acronyms = new HashMap<>(); Mention base = new Mention("Pulse Covariant Transmission"); base.setOffsetStart(4); base.setOffsetEnd(32); final LayoutToken baseLayoutToken1 = new LayoutToken("Pulse"); baseLayoutToken1.setOffset(4); final LayoutToken baseLayoutToken2 = new LayoutToken(" "); baseLayoutToken2.setOffset(9); final LayoutToken baseLayoutToken3 = new LayoutToken("Covariant"); baseLayoutToken3.setOffset(10); final LayoutToken baseLayoutToken4 = new LayoutToken(" "); baseLayoutToken4.setOffset(19); final LayoutToken baseLayoutToken5 = new LayoutToken("Transmission"); baseLayoutToken5.setOffset(20); final LayoutToken baseLayoutToken6 = new LayoutToken(" "); baseLayoutToken6.setOffset(21); Mention acronym = new Mention("PCT"); acronym.setNormalisedName("Pulse Covariant Transmission"); acronym.setOffsetStart(34); acronym.setOffsetEnd(37); acronym.setIsAcronym(true); final LayoutToken acronymLayoutToken = new LayoutToken("PCT"); acronymLayoutToken.setOffset(34); acronym.setLayoutTokens(Arrays.asList(acronymLayoutToken)); acronyms.put(acronym, base); final NerdContext nerdContext = new NerdContext(); nerdContext.setAcronyms(acronyms); aQuery.setContext(nerdContext); final List<Mention> mentions = processText.propagateAcronyms(aQuery); assertThat(mentions, hasSize(1)); assertThat(mentions.get(0).getRawName(), is("PCT")); assertThat(mentions.get(0).getOffsetStart(), is(133)); assertThat(mentions.get(0).getOffsetEnd(), is(136)); assertThat(mentions.get(0).getLayoutTokens(), is(Arrays.asList(tokens.get(53)))); assertThat(mentions.get(0).getBoundingBoxes(), hasSize(greaterThan(0))); } @Test @Ignore("Failing test") public void testPropagateAcronyms_textNotSyncronisedWithLayoutTokens_shouldWork() { String input = "The Pulse Covariant Transmission (PCT) is a great deal. We are going to make it great again.\n " + "We propose a new methodology where the PCT results are improving in the gamma ray action matter."; final Language language = new Language("en"); List<LayoutToken> tokens = GrobidAnalyzer.getInstance().tokenizeWithLayoutToken(input, language); tokens = tokens.stream() .map(layoutToken -> { layoutToken.setOffset(layoutToken.getOffset() + 10); return layoutToken; }).collect(Collectors.toList()); NerdQuery aQuery = new NerdQuery(); aQuery.setText(input); aQuery.setTokens(tokens); processText.acronymCandidates(tokens); final HashMap<Mention, Mention> acronyms = new HashMap<>(); Mention base = new Mention("Pulse Covariant Transmission"); base.setOffsetStart(14); base.setOffsetEnd(42); final LayoutToken baseLayoutToken1 = new LayoutToken("Pulse"); baseLayoutToken1.setOffset(4); final LayoutToken baseLayoutToken2 = new LayoutToken(" "); baseLayoutToken2.setOffset(9); final LayoutToken baseLayoutToken3 = new LayoutToken("Covariant"); baseLayoutToken3.setOffset(10); final LayoutToken baseLayoutToken4 = new LayoutToken(" "); baseLayoutToken4.setOffset(19); final LayoutToken baseLayoutToken5 = new LayoutToken("Transmission"); baseLayoutToken5.setOffset(20); final LayoutToken baseLayoutToken6 = new LayoutToken(" "); baseLayoutToken6.setOffset(21); Mention acronym = new Mention("PCT"); acronym.setNormalisedName("Pulse Covariant Transmission"); acronym.setOffsetStart(44); acronym.setOffsetEnd(47); acronym.setIsAcronym(true); final LayoutToken acronymLayoutToken = new LayoutToken("PCT"); acronymLayoutToken.setOffset(44); acronym.setLayoutTokens(Arrays.asList(acronymLayoutToken)); acronyms.put(acronym, base); final NerdContext nerdContext = new NerdContext(); nerdContext.setAcronyms(acronyms); aQuery.setContext(nerdContext); final List<Mention> mentions = processText.propagateAcronyms(aQuery); assertThat(mentions, hasSize(1)); assertThat(mentions.get(0).getRawName(), is("PCT")); assertThat(mentions.get(0).getOffsetStart(), is(143)); assertThat(mentions.get(0).getOffsetEnd(), is(146)); assertThat(mentions.get(0).getBoundingBoxes(), hasSize(greaterThan(0))); assertThat(mentions.get(0).getLayoutTokens(), is(Arrays.asList(tokens.get(63)))); } @Test @Ignore("To be activated once propagateLayout has been patched") public void testPropagateAcronyms_textNotSyncronisedWithLayoutTokens2_shouldWork() { String input = "The Pulse Covariant Transmission (P.C.T.) is a great deal. We are going to make it great again.\n " + "We propose a new methodology where the P.C.T. results are improving in the gamma ray action matter. " + "P.C.T. is good for you"; final Language language = new Language("en"); List<LayoutToken> tokens = GrobidAnalyzer.getInstance().tokenizeWithLayoutToken(input, language); tokens = tokens.stream() .map(layoutToken -> { layoutToken.setOffset(layoutToken.getOffset() + 10); return layoutToken; }).collect(Collectors.toList()); NerdQuery aQuery = new NerdQuery(); aQuery.setText(input); aQuery.setTokens(tokens); processText.acronymCandidates(tokens); final HashMap<Mention, Mention> acronyms = new HashMap<>(); Mention base = new Mention("Pulse Covariant Transmission"); base.setOffsetStart(14); base.setOffsetEnd(42); final LayoutToken baseLayoutToken1 = new LayoutToken("Pulse"); baseLayoutToken1.setOffset(4); final LayoutToken baseLayoutToken2 = new LayoutToken(" "); baseLayoutToken2.setOffset(9); final LayoutToken baseLayoutToken3 = new LayoutToken("Covariant"); baseLayoutToken3.setOffset(10); final LayoutToken baseLayoutToken4 = new LayoutToken(" "); baseLayoutToken4.setOffset(19); final LayoutToken baseLayoutToken5 = new LayoutToken("Transmission"); baseLayoutToken5.setOffset(20); final LayoutToken baseLayoutToken6 = new LayoutToken(" "); baseLayoutToken6.setOffset(21); Mention acronym = new Mention("P.C.T."); acronym.setNormalisedName("Pulse Covariant Transmission"); acronym.setOffsetStart(44); acronym.setOffsetEnd(47); acronym.setIsAcronym(true); final LayoutToken acronymLayoutToken1 = new LayoutToken("P"); acronymLayoutToken1.setOffset(44); final LayoutToken acronymLayoutToken2 = new LayoutToken("."); acronymLayoutToken2.setOffset(45); final LayoutToken acronymLayoutToken3 = new LayoutToken("C"); acronymLayoutToken3.setOffset(46); final LayoutToken acronymLayoutToken4 = new LayoutToken("."); acronymLayoutToken4.setOffset(47); final LayoutToken acronymLayoutToken5 = new LayoutToken("T"); acronymLayoutToken5.setOffset(48); final LayoutToken acronymLayoutToken6 = new LayoutToken("."); acronymLayoutToken6.setOffset(49); acronym.setLayoutTokens(Arrays.asList(acronymLayoutToken1, acronymLayoutToken2, acronymLayoutToken3, acronymLayoutToken4, acronymLayoutToken5, acronymLayoutToken6)); acronyms.put(acronym, base); final NerdContext nerdContext = new NerdContext(); nerdContext.setAcronyms(acronyms); aQuery.setContext(nerdContext); final List<Mention> mentions = processText.propagateAcronyms(aQuery); assertThat(mentions, hasSize(2)); assertThat(mentions.get(0).getRawName(), is("P.C.T.")); assertThat(mentions.get(0).getOffsetStart(), is(146)); assertThat(mentions.get(0).getOffsetEnd(), is(152)); assertThat(mentions.get(0).getBoundingBoxes(), hasSize(greaterThan(0))); assertThat(mentions.get(0).getLayoutTokens(), hasSize(6)); assertThat(mentions.get(1).getRawName(), is("P.C.T.")); assertThat(mentions.get(1).getOffsetStart(), is(207)); assertThat(mentions.get(1).getOffsetEnd(), is(212)); assertThat(mentions.get(1).getBoundingBoxes(), hasSize(greaterThan(0))); assertThat(mentions.get(1).getLayoutTokens(), hasSize(6)); } @Test public void testAcronymsStringMixedCase() { String input = "Cigarette smoke (CS)-induced airway epithelial senescence has been implicated in " + "the pathogenesis of chronic obstructive pulmonary disease (COPD)."; Map<Mention, Mention> acronyms = processText.acronymCandidates(input, new Language("en", 1.0)); assertNotNull(acronyms); for (Map.Entry<Mention, Mention> entry : acronyms.entrySet()) { Mention base = entry.getValue(); Mention acronym = entry.getKey(); //System.out.println("acronym: " + input.substring(acronym.start, acronym.end) + " / base: " + base.getRawName()); if (input.substring(acronym.getOffsetStart(), acronym.getOffsetEnd()).trim().equals("CS")) { assertEquals(base.getRawName(), "Cigarette smoke"); } else { assertEquals(input.substring(acronym.getOffsetStart(), acronym.getOffsetEnd()).trim(), "COPD"); assertEquals(base.getRawName(), "chronic obstructive pulmonary disease"); } } } @Test public void testAcronymsTokensMixedCase() { String input = "Cigarette smoke (CS)-induced airway epithelial senescence has been implicated in " + "the pathogenesis of chronic obstructive pulmonary disease (COPD)."; List<LayoutToken> tokens = GrobidAnalyzer.getInstance().tokenizeWithLayoutToken(input, new Language("en", 1.0)); Map<Mention, Mention> acronyms = processText.acronymCandidates(tokens); assertNotNull(acronyms); for (Map.Entry<Mention, Mention> entry : acronyms.entrySet()) { Mention base = entry.getValue(); Mention acronym = entry.getKey(); //System.out.println("acronym: " + input.substring(acronym.start, acronym.end) + " / base: " + base.getRawName()); if (input.substring(acronym.getOffsetStart(), acronym.getOffsetEnd()).trim().equals("CS")) { assertEquals(base.getRawName(), "Cigarette smoke"); } else { assertEquals(input.substring(acronym.getOffsetStart(), acronym.getOffsetEnd()).trim(), "COPD"); assertEquals(base.getRawName(), "chronic obstructive pulmonary disease"); } } } @Test public void testDICECoefficient() throws Exception { String mention = "Setophaga ruticilla"; Double dice = ProcessText.getDICECoefficient(mention, "en"); System.out.println(mention + ": " + dice); mention = "Setophaga"; dice = ProcessText.getDICECoefficient(mention, "en"); System.out.println(mention + ": " + dice); mention = "ruticilla"; dice = ProcessText.getDICECoefficient(mention, "en"); System.out.println(mention + ": " + dice); mention = "bird"; dice = ProcessText.getDICECoefficient(mention, "en"); System.out.println(mention + ": " + dice); mention = "washing machine"; dice = ProcessText.getDICECoefficient(mention, "en"); System.out.println(mention + ": " + dice); mention = "washing"; dice = ProcessText.getDICECoefficient(mention, "en"); System.out.println(mention + ": " + dice); mention = "machine"; dice = ProcessText.getDICECoefficient(mention, "en"); System.out.println(mention + ": " + dice); } /*@Test public void testProcessSpecies() throws Exception { List<Mention> entities = processText.processSpecies("The mouse is here with us, beware not to be too aggressive.", new Language("en")); assertThat(entities, hasSize(1)); }*/ /*@Test public void testProcessSpecies2() { if (processText == null) { System.err.println("text processor was not properly initialised!"); } try { List<Mention> entities = processText.processSpecies("Morphological variation in hybrids between Salmo marmoratus and alien Salmo species in the Volarja stream, Soca River basin, Slovenia", new Language("en")); assertThat(entities, hasSize(1)); } catch(Exception e) { e.printStackTrace(); } }*/ @Test public void testParagraphSegmentation() { // create a dummy super long text to be segmented List<LayoutToken> tokens = new ArrayList<>(); for (int i = 0; i < 1000; i++) { if (i == 250) { tokens.add(new LayoutToken("\n")); } if (i == 500) { tokens.add(new LayoutToken("\n")); tokens.add(new LayoutToken("\n")); } tokens.add(new LayoutToken("blabla")); tokens.add(new LayoutToken(" ")); } List<List<LayoutToken>> segments = ProcessText.segmentInParagraphs(tokens); assertThat(segments, hasSize(5)); } @Test public void testParagraphSegmentationMonolithic() { // create a dummy super long text to be segmented List<LayoutToken> tokens = new ArrayList<>(); for (int i = 0; i < 1000; i++) { tokens.add(new LayoutToken("blabla")); tokens.add(new LayoutToken(" ")); } List<List<LayoutToken>> segments = ProcessText.segmentInParagraphs(tokens); assertThat(segments, hasSize(4)); } @Test @Ignore("This test is failing") public void testNGram_old_oneGram_shouldWork() throws Exception { final String input = "this is it."; final List<StringPos> result = processText.ngrams(input, 1, new Language("en")); System.out.println(result); assertThat(result, hasSize(6)); assertThat(result.get(0), is(new StringPos("this", 0))); assertThat(result.get(1), is(new StringPos(" ", 4))); assertThat(result.get(2), is(new StringPos("is", 5))); assertThat(result.get(3), is(new StringPos(" ", 7))); } @Test @Ignore("This test is failing too") public void testNGram_old_biGram_shouldWork() throws Exception { final String input = "this is it."; final List<StringPos> result = processText.ngrams(input, 2, new Language("en")); // System.out.println(result); assertThat(result, hasSize(15)); assertThat(result.get(0), is(new StringPos("this", 0))); assertThat(result.get(1), is(new StringPos("this ", 0))); assertThat(result.get(2), is(new StringPos("this is", 0))); assertThat(result.get(3), is(new StringPos(" ", 4))); } @Test public void testNGram_LayoutTokens_oneGram_shouldWork() throws Exception { final String input = "this is it."; final List<LayoutToken> inputLayoutTokens = GrobidAnalyzer.getInstance() .tokenizeWithLayoutToken(input, new Language("en")); final List<StringPos> result = processText.ngrams(inputLayoutTokens, 1); System.out.println(result); assertThat(result, hasSize(6)); assertThat(result.get(0), is(new StringPos("this", 0))); assertThat(result.get(1), is(new StringPos(" ", 4))); assertThat(result.get(2), is(new StringPos("is", 5))); assertThat(result.get(3), is(new StringPos(" ", 7))); } @Test @Ignore("This test is not testing anything") public void testNGram_twoGram_shouldWork() throws Exception { final String input = "this is it."; final List<StringPos> old = processText.ngrams(input, 2, new Language("en")); Collections.sort(old); old.remove(4); System.out.println(old); final List<StringPos> newd = processText.ngrams(GrobidAnalyzer.getInstance().tokenizeWithLayoutToken(input), 2); Collections.sort(newd); System.out.println(newd); } @Test @Ignore("This test is not testing anything") public void extractMentionsWikipedia() throws Exception { final String input = "this is it."; final Language language = new Language("en"); final List<LayoutToken> inputLayoutTokens = GrobidAnalyzer.getInstance() .tokenizeWithLayoutToken(input, language); System.out.println(processText.extractMentionsWikipedia(inputLayoutTokens, language)); System.out.println(processText.extractMentionsWikipedia(input, language)); } }
package org.apache.james.core; import java.io.*; import java.net.*; import java.util.*; import javax.mail.*; import javax.mail.internet.*; import org.apache.mailet.*; /** * Wrap a MimeMessage adding routing informations (from SMTP) and same simple API. * @author Federico Barbieri <[email protected]> * @author Serge Knystautas <[email protected]> * @version 0.9 */ public class MailImpl implements Mail { //We hardcode the serialVersionUID so that from James 1.2 on, // MailImpl will be deserializable (so your mail doesn't get lost) public static final long serialVersionUID = -4289663364703986260L; private String errorMessage; private String state; private MimeMessage message; private MailAddress sender; private Collection recipients; private String name; private String remoteHost = "localhost"; private String remoteAddr = "127.0.0.1"; private Date lastUpdated = new Date(); public MailImpl() { setState(Mail.DEFAULT); } public MailImpl(String name, MailAddress sender, Collection recipients) { this(); this.name = name; this.sender = sender; this.recipients = recipients; } public MailImpl(String name, MailAddress sender, Collection recipients, InputStream messageIn) throws MessagingException { this(name, sender, recipients); MimeMessageSource source = new MimeMessageInputStreamSource(name, messageIn); MimeMessageWrapper wrapper = new MimeMessageWrapper(source); this.setMessage(wrapper); } public MailImpl(String name, MailAddress sender, Collection recipients, MimeMessage message) { this(name, sender, recipients); this.setMessage(message); } public void clean() { message = null; } public Mail duplicate() { try { return new MailImpl(name, sender, recipients, getMessage()); } catch (MessagingException me) { } return (Mail) null; } public Mail duplicate(String newName) { try { return new MailImpl(newName, sender, recipients, getMessage()); } catch (MessagingException me) { } return (Mail) null; } public String getErrorMessage() { return errorMessage; } public MimeMessage getMessage() throws MessagingException { return message; } public void setName(String name) { this.name = name; } public String getName() { return name; } public Collection getRecipients() { return recipients; } public MailAddress getSender() { return sender; } public String getState() { return state; } public String getRemoteHost() { return remoteHost; } public String getRemoteAddr() { return remoteAddr; } public Date getLastUpdated() { return lastUpdated; } /** * <p>Return the size of the message including its headers. * MimeMessage.getSize() method only returns the size of the * message body.</p> * * <p>Note: this size is not guaranteed to be accurate - see Sun's * documentation of MimeMessage.getSize().</p> * * @return approximate size of full message including headers. * * @author Stuart Roebuck <[email protected]> */ public int getSize() throws MessagingException { //SK: Should probably eventually store this as a locally // maintained value (so we don't have to load and reparse // messages each time). int size = message.getSize(); Enumeration e = message.getAllHeaderLines(); while (e.hasMoreElements()) { size += ((String)e.nextElement()).length(); } return size; } private void readObject(java.io.ObjectInputStream in) throws IOException, ClassNotFoundException { try { Object obj = in.readObject(); if (obj == null) { sender = null; } else if (obj instanceof String) { sender = new MailAddress((String)obj); } else if (obj instanceof MailAddress) { sender = (MailAddress)obj; } } catch (ParseException pe) { throw new IOException("Error parsing sender address: " + pe.getMessage()); } recipients = (Collection) in.readObject(); state = (String) in.readObject(); errorMessage = (String) in.readObject(); name = (String) in.readObject(); remoteHost = (String) in.readObject(); remoteAddr = (String) in.readObject(); lastUpdated = (Date) in.readObject(); } public void setErrorMessage(String msg) { this.errorMessage = msg; } public void setMessage(MimeMessage message) { this.message = message; } public void setRecipients(Collection recipients) { this.recipients = recipients; } public void setSender(MailAddress sender) { this.sender = sender; } public void setState(String state) { this.state = state; } public void setRemoteHost(String remoteHost) { this.remoteHost = remoteHost; } public void setRemoteAddr(String remoteAddr) { this.remoteAddr = remoteAddr; } public void setLastUpdated(Date lastUpdated) { this.lastUpdated = lastUpdated; } public void writeMessageTo(OutputStream out) throws IOException, MessagingException { if (message != null) { message.writeTo(out); } else { throw new MessagingException("No message set for this MailImpl."); } } private void writeObject(java.io.ObjectOutputStream out) throws IOException { //System.err.println("saving object"); lastUpdated = new Date(); out.writeObject(sender); out.writeObject(recipients); out.writeObject(state); out.writeObject(errorMessage); out.writeObject(name); out.writeObject(remoteHost); out.writeObject(remoteAddr); out.writeObject(lastUpdated); } public Mail bounce(String message) throws MessagingException { //This sends a message to the james component that is a bounce of the sent message MimeMessage original = getMessage(); MimeMessage reply = (MimeMessage) original.reply(false); reply.setSubject("Re: " + original.getSubject()); Collection recipients = new HashSet(); recipients.add(getSender()); InternetAddress addr[] = {new InternetAddress(getSender().toString())}; reply.setRecipients(Message.RecipientType.TO, addr); reply.setFrom(new InternetAddress(getRecipients().iterator().next().toString())); reply.setText(message); reply.setHeader("Message-Id", "replyTo-" + getName()); return new MailImpl("replyTo-" + getName(), new MailAddress(getRecipients().iterator().next().toString()), recipients, reply); } public void writeContentTo(OutputStream out, int lines) throws IOException, MessagingException { String line; BufferedReader br; if(message != null) { br = new BufferedReader(new InputStreamReader(message.getInputStream())); while(lines if((line = br.readLine()) == null) break; line += "\r\n"; out.write(line.getBytes()); } } else { throw new MessagingException("No message set for this MailImpl."); } } }
package edu.ucdenver.ccp.common.string; import static org.junit.Assert.assertArrayEquals; import static org.junit.Assert.assertEquals; import static org.junit.Assert.assertFalse; import static org.junit.Assert.assertTrue; import static edu.ucdenver.ccp.common.string.StringUtil.*; import java.nio.charset.MalformedInputException; import java.util.List; import org.junit.Test; import edu.ucdenver.ccp.common.collections.CollectionsUtil; import edu.ucdenver.ccp.common.file.CharacterEncoding; import edu.ucdenver.ccp.common.string.StringUtil.RemoveFieldEnclosures; import edu.ucdenver.ccp.common.test.DefaultTestCase; public class StringUtilTest extends DefaultTestCase { @Test public void testIsInteger_validPositiveInput() { assertTrue(StringUtil.isInteger("0")); assertTrue(StringUtil.isInteger("00")); assertTrue(StringUtil.isInteger("1")); assertTrue(StringUtil.isInteger("10")); assertTrue(StringUtil.isInteger("1234567890")); assertFalse(StringUtil.isInteger("9876543211")); } @Test public void testIsInteger_validNegativeInput() { assertTrue(StringUtil.isInteger("-1")); assertTrue(StringUtil.isInteger("-10")); assertTrue(StringUtil.isInteger("-1234567890")); assertFalse(StringUtil.isInteger("-9876543211")); } @Test public void testIsInteger_invalidInput() { assertTrue(StringUtil.isInteger("-0")); assertTrue(StringUtil.isInteger("01")); assertFalse(StringUtil.isInteger("this is not a number")); assertFalse(StringUtil.isInteger("3.14159")); assertFalse(StringUtil.isInteger("-09876543211")); assertTrue(StringUtil.isInteger("-000005")); assertFalse(StringUtil.isInteger("")); assertFalse(StringUtil.isInteger(null)); } @Test public void testIsIntegerGreaterThanZero() { assertTrue(StringUtil.isIntegerGreaterThanZero("1")); assertTrue(StringUtil.isIntegerGreaterThanZero("10")); assertTrue(StringUtil.isIntegerGreaterThanZero("1234567890")); assertFalse(StringUtil.isIntegerGreaterThanZero("9876543211")); assertFalse(StringUtil.isIntegerGreaterThanZero("0")); assertFalse(StringUtil.isIntegerGreaterThanZero("-1")); assertFalse(StringUtil.isIntegerGreaterThanZero("this is not a number")); } @Test public void testIsNonNegativeInteger_validNonNegativeInput() { assertTrue(StringUtil.isNonNegativeInteger("1")); assertTrue(StringUtil.isNonNegativeInteger("10")); assertTrue(StringUtil.isNonNegativeInteger("1234567890")); assertFalse(StringUtil.isNonNegativeInteger("9876543211")); } @Test public void testIsNonNegativeInteger_negativeInput() { assertFalse(StringUtil.isNonNegativeInteger("-1")); assertFalse(StringUtil.isNonNegativeInteger("-10")); assertFalse(StringUtil.isNonNegativeInteger("-1234567890")); assertFalse(StringUtil.isNonNegativeInteger("-9876543211")); } @Test public void testIsNonNegativeInteger_invalidInput() { assertTrue(StringUtil.isNonNegativeInteger("-0")); assertTrue(StringUtil.isNonNegativeInteger("01")); assertFalse(StringUtil.isNonNegativeInteger("this is not a number")); assertFalse(StringUtil.isNonNegativeInteger("3.14159")); assertFalse(StringUtil.isNonNegativeInteger("-09876543211")); assertFalse(StringUtil.isNonNegativeInteger("-000005")); assertFalse(StringUtil.isNonNegativeInteger("")); assertFalse(StringUtil.isNonNegativeInteger(null)); } @Test public void testRemoveRegexSuffix_ValidInput() { assertEquals("Suffix should be stripped.", "myFile", StringUtil .removeSuffixRegex("myFile.txt.txt.txt.txt.txt", "(\\.txt)+")); assertEquals("Suffix should be stripped.", "myFile", StringUtil .removeSuffixRegex("myFile.tgz", "\\..gz")); } @Test public void testRemoveRegexSuffix_EmptyInput() { assertEquals("Suffix should be stripped.", "myFile.txt.txt.txt.txt.txt", StringUtil.removeSuffixRegex( "myFile.txt.txt.txt.txt.txt", "")); assertEquals("Suffix should be stripped.", "myFile.tgz", StringUtil .removeSuffixRegex("myFile.tgz", "")); } @Test public void testRemoveRegexPrefix_ValidInput() { assertEquals("Suffix should be stripped.", "e.txt.txt.txt.txt.txt", StringUtil.removePrefixRegex("myFile.txt.txt.txt.txt.txt", "(m?y?Fil)")); assertEquals("Suffix should be stripped.", "gz", StringUtil .removePrefixRegex("myFile.tgz", "my.*?t")); } /** * Checks that StringUtil.removeSuffix() works correctly when valid input is * used */ @Test public void testRemoveSuffix_ValidInput() { assertEquals("Suffix should be stripped.", "myFile.txt", StringUtil .removeSuffix("myFile.txt.gz", ".gz")); assertEquals("Suffix should be stripped.", "myFile", StringUtil .removeSuffix("myFile.txt.gz.abc.123.xyz-654", ".txt.gz.abc.123.xyz-654")); } /** * Checks for expected behavior of StringUtil.removeSuffix() if the suffix * string is empty */ @Test public void testRemoveSuffix_EmptyInput() { assertEquals("Suffix should be stripped.", "myFile.txt", StringUtil .removeSuffix("myFile.txt", "")); assertEquals("Suffix should be stripped.", "", StringUtil.removeSuffix( "", "")); } /** * Checks for proper exception if the input string is null when calling * StringUtil.removeSuffix() */ @Test(expected = IllegalArgumentException.class) public void testRemoveSuffix_NullInputString() { StringUtil.removeSuffix(null, ".gz"); } /** * Checks for proper exception if the suffix string is null when calling * StringUtil.removeSuffix() */ @Test(expected = IllegalArgumentException.class) public void testRemoveSuffix_NullSuffix() { StringUtil.removeSuffix("File.txt", null); } /** * Checks for proper exception if the input string does not end with the * suffix requested to be removed when calling StringUtil.removeSuffix() */ @Test(expected = IllegalArgumentException.class) public void testRemoveSuffix_InputStringDoesNotHaveSuffix() { StringUtil.removeSuffix("File.txt.zip", ".gz"); } @Test public void testReplaceSuffix_ValidInput() { assertEquals("Suffix should be replaced with .tar", "myTarball.tar", StringUtil.replaceSuffix("myTarball.tgz", ".tgz", ".tar")); } @Test public void testStartsWithRegex() { assertTrue(StringUtil.startsWithRegex("2010-04-06", RegExPatterns .getNDigitsPattern(4))); assertTrue(StringUtil.startsWithRegex("2010-04-06", RegExPatterns .getNDigitsPattern(3))); assertTrue(StringUtil.startsWithRegex("2010-04-06", RegExPatterns .getNDigitsPattern(2))); assertTrue(StringUtil.startsWithRegex("2010-04-06", RegExPatterns .getNDigitsPattern(1))); assertTrue(StringUtil.startsWithRegex("2010-04-06", "^" + RegExPatterns.getNDigitsPattern(4))); assertFalse(StringUtil.startsWithRegex("2010-04-06", RegExPatterns .getNDigitsPattern(5))); } @Test public void testContainsRegex() { assertTrue(StringUtil.containsRegex("2010-04-06", RegExPatterns .getNDigitsPattern(4))); assertFalse(StringUtil.containsRegex("2010-04-06", RegExPatterns .getNDigitsPattern(5))); } @Test public void testCreateRepeatingString() { String expectedStr = StringConstants.AMPERSAND + StringConstants.AMPERSAND + StringConstants.AMPERSAND; assertEquals(String.format("String should contain 3 ampersands"), expectedStr, StringUtil.createRepeatingString( StringConstants.AMPERSAND, 3)); assertEquals(String.format("String should contain 6 ampersands"), expectedStr + expectedStr, StringUtil.createRepeatingString( StringConstants.AMPERSAND + StringConstants.AMPERSAND, 3)); } @Test(expected = IllegalArgumentException.class) public void testSplitWithFieldDelimiter_ZeroInDelimiter() { StringUtil.splitWithFieldEnclosure("\"", String.format(".%s", StringConstants.DIGIT_ZERO), StringConstants.QUOTATION_MARK); } @Test public void testSplitWithFieldDelimiter() { String inputStr = "J Clin Invest,0021-9738,1558-8238,1940,19,\"Index, vol.1-17\",1,10.1172/JCI101100,PMC548872,0,,live"; String[] expectedTokens = new String[] { "J Clin Invest", "0021-9738", "1558-8238", "1940", "19", "\"Index, vol.1-17\"", "1", "10.1172/JCI101100", "PMC548872", "0", "", "live" }; assertArrayEquals(String.format("One token should include a comma"), expectedTokens, StringUtil.splitWithFieldEnclosure(inputStr, StringConstants.COMMA, StringConstants.QUOTATION_MARK)); } @Test public void testSplitWithFieldDelimiter_EmptyColumnsAtEnd() { String inputStr = "J Clin Invest,0021-9738,1558-8238,1940,19,\"Index, vol.1-17\",1,10.1172/JCI101100,PMC548872,0,,"; String[] expectedTokens = new String[] { "J Clin Invest", "0021-9738", "1558-8238", "1940", "19", "\"Index, vol.1-17\"", "1", "10.1172/JCI101100", "PMC548872", "0", "", "" }; assertArrayEquals(String.format("One token should include a comma"), expectedTokens, StringUtil.splitWithFieldEnclosure(inputStr, StringConstants.COMMA, StringConstants.QUOTATION_MARK)); } @Test public void testSplitWithFieldDelimiter_NoColumns() { String inputStr = "J Clin Invest,0021-9738,1558-8238,1940,19,\"Index, vol.1-17\",1,10.1172/JCI101100,PMC548872,0,,live"; assertArrayEquals(String.format("One token should include a comma"), new String[] { inputStr }, StringUtil.splitWithFieldEnclosure( inputStr, StringConstants.SEMICOLON, StringConstants.QUOTATION_MARK)); } @Test public void testSplitWithFieldDelimiter_FieldDelimiterNotPresentInText() { String inputStr = "J Clin Invest,0021-9738,1558-8238,1940,19,\"Index, vol.1-17\",1,10.1172/JCI101100,PMC548872,0,,live"; String[] expectedTokens = new String[] { "J Clin Invest", "0021-9738", "1558-8238", "1940", "19", "\"Index", " vol.1-17\"", "1", "10.1172/JCI101100", "PMC548872", "0", "", "live" }; assertArrayEquals(String.format("One token should include a comma"), expectedTokens, StringUtil.splitWithFieldEnclosure(inputStr, StringConstants.COMMA, StringConstants.SEMICOLON)); } @Test public void testSplitWithFieldDelimiter_FieldDelimiterNull() { String inputStr = "J Clin Invest,0021-9738,1558-8238,1940,19,\"Index, vol.1-17\",1,10.1172/JCI101100,PMC548872,0,,live"; String[] expectedTokens = new String[] { "J Clin Invest", "0021-9738", "1558-8238", "1940", "19", "\"Index", " vol.1-17\"", "1", "10.1172/JCI101100", "PMC548872", "0", "", "live" }; assertArrayEquals(String.format("One token should include a comma"), expectedTokens, StringUtil.splitWithFieldEnclosure(inputStr, StringConstants.COMMA, null)); } @Test public void testSplitWithFieldDelimiter_FieldDelimiterIsRegexSpecialCharacter() { String inputStr = "J Clin Invest,0021-9738,1558-8238,1940,19,*Index, vol.1-17*,1,10.1172/JCI101100,PMC548872,0,,live"; String[] expectedTokens = new String[] { "J Clin Invest", "0021-9738", "1558-8238", "1940", "19", "*Index, vol.1-17*", "1", "10.1172/JCI101100", "PMC548872", "0", "", "live" }; assertArrayEquals(String.format("One token should include a comma"), expectedTokens, StringUtil.splitWithFieldEnclosure(inputStr, StringConstants.COMMA, "\\*")); } @Test public void testStripNonAscii() { try { String none = "simple word"; // String one = "\u0031"; // 31 String o_umlaut = "\u00f6"; // c3-b6 o with diaeresis String devanagari_one = "\u0967"; // e0-a5-0a7 String one3byte = devanagari_one; String one3byteStripped = "?"; String two3byte = devanagari_one + devanagari_one; String two3byteStripped = "??"; String one2byte = o_umlaut; String one2byteStripped = "?"; String two2byte = o_umlaut + o_umlaut; String two2byteStripped = "??"; String twoAnd3 = o_umlaut + devanagari_one; String twoAnd3Stripped = "??"; String threeAnd2 = devanagari_one + o_umlaut; String threeAnd2Stripped = "??"; String mixed = devanagari_one + "foo and " + o_umlaut + " bar" + devanagari_one; String mixedStripped = "?foo and ? bar?"; String realData = "We thank Richelle Strom for generating the F2 intercross mice."; String realDataStripped = "We thank Richelle Strom for generating the F2 intercross mice."; // 01234567890123456789012345678901234567890123456789012345678901 assertTrue(StringUtil.stripNonAscii("").equals("")); assertTrue(StringUtil.stripNonAscii(none).equals(none)); assertTrue(StringUtil.stripNonAscii(one2byte).equals( one2byteStripped)); assertTrue(StringUtil.stripNonAscii(one3byte).equals( one3byteStripped)); assertTrue(StringUtil.stripNonAscii(two3byte).equals( two3byteStripped)); assertTrue(StringUtil.stripNonAscii(two2byte).equals( two2byteStripped)); assertTrue(StringUtil.stripNonAscii(twoAnd3) .equals(twoAnd3Stripped)); assertTrue(StringUtil.stripNonAscii(threeAnd2).equals( threeAnd2Stripped)); assertTrue(StringUtil.stripNonAscii(mixed).equals(mixedStripped)); assertTrue(StringUtil.stripNonAscii(realData).equals( realDataStripped)); } catch (java.io.UnsupportedEncodingException x) { System.err.println("error:" + x); x.printStackTrace(); } } @Test public void testDelimitAndTrim_WithTrailingDelimiter() { String inputStr = "\"D015430\","; List<String> expectedTokens = CollectionsUtil.createList("\"D015430\""); assertEquals(String.format("One token should be returned"), expectedTokens, StringUtil.delimitAndTrim(inputStr, StringConstants.COMMA, StringConstants.QUOTATION_MARK, RemoveFieldEnclosures.FALSE)); } @Test public void testDelimitAndTrim_WithTrailingDelimiter_RemoveFieldEnclosures() { String inputStr = "\"D015430\","; List<String> expectedTokens = CollectionsUtil.createList("D015430"); assertEquals(String.format("One token should be returned"), expectedTokens, StringUtil.delimitAndTrim(inputStr, StringConstants.COMMA, StringConstants.QUOTATION_MARK, RemoveFieldEnclosures.TRUE)); } @Test public void testByteArrayToString() throws Exception { String asciiString = "naive"; String utf8String = "nai\u0308ve"; byte[] asciiByteArray = asciiString.getBytes(); assertEquals( "ASCII bytes should be able to be read using ASCII encoding", asciiString, decode(asciiByteArray, CharacterEncoding.US_ASCII)); assertEquals( "ASCII bytes should be able to be read using UTF-8 encoding", asciiString, decode(asciiByteArray, CharacterEncoding.UTF_8)); assertEquals( "UTF-8 bytes should be able to be read using UTF-8 encoding", utf8String, decode(utf8String.getBytes(CharacterEncoding.UTF_8 .getCharacterSetName()), CharacterEncoding.UTF_8)); } @Test(expected = MalformedInputException.class) public void testByteArrayToString_WithEncodingMismatch() throws Exception { String utf8String = "nai\u0308ve"; StringUtil.decode(utf8String.getBytes(CharacterEncoding.UTF_8 .getCharacterSetName()), CharacterEncoding.US_ASCII); } }
package il.ac.bgu.cs.bp.bpjs.analysis; import il.ac.bgu.cs.bp.bpjs.internal.ExecutorServiceMaker; import il.ac.bgu.cs.bp.bpjs.model.*; import org.junit.Test; import java.util.ArrayList; import java.util.List; import java.util.concurrent.ExecutorService; import static org.junit.Assert.*; public class StateStoreTests { @Test public void ForgetfulStore() throws Exception { BProgram program = new SingleResourceBProgram("SnapshotTests/ABCDTrace.js"); ExecutorService execSvc = ExecutorServiceMaker.makeWithName("StoreSvc"); DfsBProgramVerifier sut = new DfsBProgramVerifier(); VisitedStateStore forgetful = new ForgetfulVisitedStateStore(); Node initial = Node.getInitialNode(program, execSvc); forgetful.store(initial); assertFalse(forgetful.isVisited(initial)); Node next = sut.getUnvisitedNextNode(initial, execSvc); assertFalse(forgetful.isVisited(next)); } @Test public void VisitedStateStoreNoHashBasic() throws Exception { VisitedStateStore noHash = new BThreadSnapshotVisitedStateStore(); TestAAABTraceStore(noHash); } @Test public void VisitedStateStoreHashBasic() throws Exception { VisitedStateStore useHash = new HashVisitedStateStore(); TestAAABTraceStore(useHash); } private void TestAAABTraceStore(VisitedStateStore storeToUse) throws Exception { BProgram program = new SingleResourceBProgram("SnapshotTests/ABCDTrace.js"); ExecutorService execSvc = ExecutorServiceMaker.makeWithName("StoreSvc"); DfsBProgramVerifier sut = new DfsBProgramVerifier(); Node initial = Node.getInitialNode(program, execSvc); storeToUse.store(initial); assertTrue(storeToUse.isVisited(initial)); Node next = sut.getUnvisitedNextNode(initial, execSvc); assertFalse(storeToUse.isVisited(next)); storeToUse.store(next); assertTrue(storeToUse.isVisited(next)); assertTrue(storeToUse.isVisited(initial)); storeToUse.clear(); assertFalse(storeToUse.isVisited(next)); assertFalse(storeToUse.isVisited(initial)); } @Test public void StateStoreNoHashTestDiffJSVar() throws Exception { VisitedStateStore noHash = new BThreadSnapshotVisitedStateStore(); TestDiffJSVar(noHash); } @Test public void StateStoreHashTestDiffJSVar() throws Exception { VisitedStateStore hashStore = new HashVisitedStateStore(); TestDiffJSVar(hashStore); } private void TestDiffJSVar(VisitedStateStore storeToUse) throws Exception { BProgram program = new StringBProgram("bp.registerBThread(function(){\n" + " for ( var i=0; i<4; i++ ) {\n" + " bp.sync({request:bp.Event(\"A\")});\n" + " bp.sync({request:bp.Event(\"B\")});\n" + " bp.sync({request:bp.Event(\"C\")});\n" + " bp.sync({request:bp.Event(\"D\")});\n" + " }\n" + "});"); ExecutorService execSvc = ExecutorServiceMaker.makeWithName("StoreSvcDiiffJSVar"); DfsBProgramVerifier sut = new DfsBProgramVerifier(); List<Node> snapshots = new ArrayList<>(); Node initial = Node.getInitialNode(program, execSvc); storeToUse.store(initial); snapshots.add(initial); assertTrue(storeToUse.isVisited(initial)); Node next = initial; //Iteration 1,starts already at request state A for (int i = 0; i < 4; i++) { next = sut.getUnvisitedNextNode(next, execSvc); storeToUse.store(next); } snapshots.add(next); assertTrue(storeToUse.isVisited(next)); for (int i = 0; i < 4; i++) { next = sut.getUnvisitedNextNode(next, execSvc); storeToUse.store(next); } snapshots.add(next); assertTrue(storeToUse.isVisited(next)); //now we want to compare specific states BProgramSyncSnapshot state1 = snapshots.get(1).getSystemState(); BProgramSyncSnapshot state2 = snapshots.get(2).getSystemState(); assertNotEquals(state1, state2); } @Test public void StateStoreNoHashTestEqualJSVar() throws Exception { VisitedStateStore noHash = new BThreadSnapshotVisitedStateStore(); TestEqualJSVar(noHash); } @Test public void StateStoreHashTestEqualJSVar() throws Exception { VisitedStateStore hashStore = new HashVisitedStateStore(); TestEqualJSVar(hashStore); } private void TestEqualJSVar(VisitedStateStore storeToUse) throws Exception { BProgram program = new StringBProgram("bp.registerBThread(function(){\n" + " for ( var i=0; i<4; ) {\n" + " bp.sync({request:bp.Event(\"A\")});\n" + " bp.sync({request:bp.Event(\"B\")});\n" + " bp.sync({request:bp.Event(\"C\")});\n" + " bp.sync({request:bp.Event(\"D\")});\n" + " }\n" + "});"); ExecutorService execSvc = ExecutorServiceMaker.makeWithName("StoreSvcEqualJSVar"); DfsBProgramVerifier sut = new DfsBProgramVerifier(); List<Node> snapshots = new ArrayList<>(); Node initial = Node.getInitialNode(program, execSvc); storeToUse.store(initial); snapshots.add(initial); assertTrue(storeToUse.isVisited(initial)); Node next = initial; //Iteration 1,starts already at request state A for (int i = 0; i < 4; i++) { next = sut.getUnvisitedNextNode(next, execSvc); storeToUse.store(next); } snapshots.add(next); assertTrue(storeToUse.isVisited(next)); for (int i = 0; i < 4; i++) { next = sut.getUnvisitedNextNode(next, execSvc); assertTrue(storeToUse.isVisited(next)); storeToUse.store(next); } snapshots.add(next); assertTrue(storeToUse.isVisited(next)); //now we want to compare specific BProgramSyncSnapshot state1 = snapshots.get(1).getSystemState(); BProgramSyncSnapshot state2 = snapshots.get(2).getSystemState(); assertEquals(state1, state2); } /* A bunch of tests from BProgramSyncSnapshot modified to check nodes. */ @Test public void StateStoreNoHashTestIdenticalRuns() throws Exception { VisitedStateStore noHash = new BThreadSnapshotVisitedStateStore(); testEqualRuns(noHash); } @Test public void StateStoreHashTestIdenticalRuns() throws Exception { VisitedStateStore hashStore = new HashVisitedStateStore(); testEqualRuns(hashStore); } /* This test makes sure we compare nodes/states properly. these two objects (by debugging) share program counter and frame index and should differ on variables only */ private void testEqualRuns(VisitedStateStore storeToUse) throws Exception { BProgram bprog = new SingleResourceBProgram("SnapshotTests/ABCDTrace.js"); BProgram bprog2 = new SingleResourceBProgram("SnapshotTests/ABCDTrace.js"); ExecutorService execSvc = ExecutorServiceMaker.makeWithName("StoreSvcEqualJSVar"); DfsBProgramVerifier sut = new DfsBProgramVerifier(); Node initial1 = Node.getInitialNode(bprog, execSvc); Node initial2 = Node.getInitialNode(bprog2, execSvc); assertEquals(initial1,initial2); Node next1 = initial1; Node next2 = initial2; storeToUse.store(next1); assertTrue(storeToUse.isVisited(next2)); for (int i = 0; i < 4; i++) { next1 = sut.getUnvisitedNextNode(next1, execSvc); storeToUse.store(next1); assertTrue(storeToUse.isVisited(next2)); } } }
package ru.salauyou.utils; import java.util.ArrayList; import java.util.Collection; import java.util.Iterator; import java.util.List; import java.util.NoSuchElementException; public class KCombinationIterator<T> implements Iterator<Collection<T>> { final private Collection<T> resultCollection; final private List<T> source; final int k, n; final private int[] subset; // indexes of combination's elements in source list private boolean started = false; private boolean hasNext = false; public KCombinationIterator(Collection<T> source, int k){ this(source, k, new ArrayList<T>()); } public KCombinationIterator(Collection<T> source, int k, Collection<T> resultCollection) { if (k < 1) throw new IllegalArgumentException("k cannot be less than 1"); if (k > source.size()) throw new IllegalArgumentException("k cannot be greater than size of source collection"); this.source = new ArrayList<T>(source); this.k = k; this.n = source.size(); this.resultCollection = resultCollection; subset = new int[k]; } @Override public boolean hasNext() { if (n == 0) return false; if (!started){ // if not started, generate first subset for (int i = 0; (subset[i] = i) < k - 1; i++); started = true; hasNext = true; return true; } else { // check if more subsets can be generated int i; for (i = k - 1; i >= 0 && subset[i] == n - k + i; i if (i < 0){ hasNext = false; return false; } else { subset[i]++; for (++i; i < k; i++) subset[i] = subset[i - 1] + 1; hasNext = true; return true; } } } @SuppressWarnings("unchecked") @Override public Collection<T> next() { if (!hasNext) throw new NoSuchElementException("No more subsets can be generated"); Collection<T> result; try { result = resultCollection.getClass().newInstance(); } catch (Exception e) { e.printStackTrace(); return null; } for (int i = 0; i < k; i++) result.add(source.get(subset[i])); return result; } /** * Not supported * * @throws UnsupportedOperationException */ @Override public void remove(){ throw new UnsupportedOperationException("remove() is not supported"); } static public <T> Iterable<Collection<T>> decorateForEach(final Collection<T> source, final int k){ return new Iterable<Collection<T>>(){ @Override public Iterator<Collection<T>> iterator() { return new KCombinationIterator<T>(source, k); } }; } }
package io.cozmic.usher.test.integration; import io.cozmic.usher.Start; import io.vertx.core.DeploymentOptions; import io.vertx.core.Handler; import io.vertx.core.Vertx; import io.vertx.core.buffer.Buffer; import io.vertx.core.json.JsonObject; import io.vertx.core.net.NetClient; import io.vertx.core.net.NetSocket; import io.vertx.ext.unit.Async; import io.vertx.ext.unit.TestContext; import io.vertx.ext.unit.junit.VertxUnitRunner; import org.junit.After; import org.junit.Before; import org.junit.Test; import org.junit.runner.RunWith; import java.util.Objects; import java.util.concurrent.atomic.AtomicInteger; import static org.junit.Assert.fail; @RunWith(VertxUnitRunner.class) public class RoutingTests { Vertx vertx; private FakeService fooService; private FakeService barService; @Before public void before(TestContext context) { vertx = Vertx.vertx(); fooService = new FakeService(Buffer.buffer("foo"), 9192); barService = new FakeService(Buffer.buffer("bar"), 9193); vertx.deployVerticle(fooService, context.asyncAssertSuccess(r -> vertx.deployVerticle(barService, context.asyncAssertSuccess()))); } @After public void after(TestContext context) { vertx.close(context.asyncAssertSuccess()); } /** * Two different Inputs with different ports each route to a different backout Output * @param context */ @Test public void testMessageMatchRouting(TestContext context) { final DeploymentOptions options = new DeploymentOptions(); final JsonObject config = new JsonObject(); config .put("PayloadEncoder", new JsonObject()) .put("FooRouter", buildFooInput()) .put("BarRouter", buildBarInput()) .put("FooBackend", buildFooOutput(2500)) .put("BarBackend", buildBarOutput(2501)); options.setConfig(config); vertx.deployVerticle(Start.class.getName(), options, context.asyncAssertSuccess(deploymentID -> { final Async async = context.async(); final NetClient netClient = vertx.createNetClient(); netClient.connect(2500, "localhost", context.asyncAssertSuccess(fooSocket -> { fooSocket.handler(fooBuffer -> { context.assertEquals("foo", fooBuffer.toString()); netClient.connect(2501, "localhost", context.asyncAssertSuccess(barSocket -> { barSocket.handler(barBuffer -> { context.assertEquals("bar", barBuffer.toString()); async.complete(); }); barSocket.write("Hello Bar"); })); }); fooSocket.write("Hello Foo"); })); vertx.setTimer(5000, new Handler<Long>() { @Override public void handle(Long event) { context.fail("timed out"); } }); })); } /** * One Input clones a message to two backends. Only the first backend will respond. * @param context */ @Test public void testMessageMatchCloning(TestContext context) { final DeploymentOptions options = new DeploymentOptions(); final JsonObject config = new JsonObject(); config .put("PayloadEncoder", new JsonObject()) .put("FooBarRouter", buildFooBarInput()) .put("FooBackend", buildFooOutput(2500)) .put("BarBackend", buildBarOutput(2500)); options.setConfig(config); vertx.deployVerticle(Start.class.getName(), options, context.asyncAssertSuccess(deploymentID -> { final Async async = context.async(); final NetClient netClient = vertx.createNetClient(); netClient.connect(2500, "localhost", context.asyncAssertSuccess(fooBarSocket -> { final String payload = "Hello Foo and Bar"; AtomicInteger responseCount = new AtomicInteger(); fooBarSocket.handler(fooBuffer -> { final String response = fooBuffer.toString(); int responses = 0; if (Objects.equals(response, "foo")) { context.assertEquals(payload, fooService.getLastBuffer().toString()); responses = responseCount.incrementAndGet(); } if (Objects.equals(response, "bar")) { context.assertEquals(payload, barService.getLastBuffer().toString()); responses = responseCount.incrementAndGet(); } if (responses == 2) { async.complete(); } }); fooBarSocket.write(payload); })); vertx.setTimer(5000, event -> context.fail("timed out")); })); } private JsonObject buildFooBarInput() { return new JsonObject().put("type", "TcpInput").put("host", "localhost").put("port", 2500).put("encoder", "PayloadEncoder"); } private JsonObject buildBarInput() { return new JsonObject().put("type", "TcpInput").put("host", "localhost").put("port", 2501).put("encoder", "PayloadEncoder"); } private JsonObject buildFooOutput(int inputFilterPort) { return new JsonObject().put("type", "TcpOutput").put("host", "localhost").put("port", 9192).put("encoder", "PayloadEncoder").put("messageMatcher", String.format("#{msg.localPort == %s}", inputFilterPort)); } private JsonObject buildBarOutput(int inputFilterPort) { return new JsonObject().put("type", "TcpOutput").put("host", "localhost").put("port", 9193).put("encoder", "PayloadEncoder").put("messageMatcher", String.format("#{msg.localPort == %s}", inputFilterPort)); } private JsonObject buildFooInput() { return new JsonObject().put("type", "TcpInput").put("host", "localhost").put("port", 2500).put("encoder", "PayloadEncoder"); } }
package io.github.benas.unixstream.components; import io.github.benas.unixstream.UnixStream; import org.junit.Test; import java.io.IOException; import java.nio.file.Path; import java.util.List; import java.util.stream.Collectors; import static org.assertj.core.api.Assertions.assertThat; public class PwdTest { @Test public void pwd() throws IOException { UnixStream<Path> stream = UnixStream.pwd(); List<Path> paths = stream.collect(Collectors.toList()); assertThat(paths.get(0).toString()).contains("unix-stream"); } }
package lpn.parser; import java.util.ArrayList; import java.util.HashMap; import java.util.HashSet; import java.util.Iterator; import java.util.LinkedList; import java.util.List; import java.util.Set; public class Transition { private String name; private boolean fail = false; private boolean persistent = false; private String enabling; private ExprTree enablingTree; private String delay; private ExprTree delayTree; private String priority; private ExprTree priorityTree; private ArrayList<Place> preset; private ArrayList<Place> postset; private HashMap<String, String> boolAssignments; private HashMap<String, ExprTree> boolAssignTrees; private HashMap<String, String> intAssignments; private HashMap<String, ExprTree> intAssignTrees; private HashMap<String, String> contAssignments; private HashMap<String, ExprTree> contAssignTrees; private HashMap<String, String> rateAssignments; private HashMap<String, ExprTree> rateAssignTrees; private LhpnFile lhpn; private int index; private boolean sticky; private boolean local; // TODO: Sort LPNs that share variables in the assignedVarSet of this transition. private List<LhpnFile> dstLpnList = new ArrayList<LhpnFile>(); public Transition(String name, ArrayList<Variable> variables, LhpnFile lhpn) { this.name = name; this.lhpn = lhpn; preset = new ArrayList<Place>(); postset = new ArrayList<Place>(); boolAssignments = new HashMap<String, String>(); boolAssignTrees = new HashMap<String, ExprTree>(); intAssignments = new HashMap<String, String>(); intAssignTrees = new HashMap<String, ExprTree>(); contAssignments = new HashMap<String, String>(); contAssignTrees = new HashMap<String, ExprTree>(); rateAssignments = new HashMap<String, String>(); rateAssignTrees = new HashMap<String, ExprTree>(); sticky = false; } public Transition(String name, int index, ArrayList<Variable> variables, LhpnFile lhpn, boolean local) { this.name = name; this.lhpn = lhpn; this.index = index; this.local = local; preset = new ArrayList<Place>(); postset = new ArrayList<Place>(); boolAssignments = new HashMap<String, String>(); boolAssignTrees = new HashMap<String, ExprTree>(); intAssignments = new HashMap<String, String>(); intAssignTrees = new HashMap<String, ExprTree>(); contAssignments = new HashMap<String, String>(); contAssignTrees = new HashMap<String, ExprTree>(); rateAssignments = new HashMap<String, String>(); rateAssignTrees = new HashMap<String, ExprTree>(); sticky = false; } public Transition() { } public void addPostset(Place place) { postset.add(place); } public void addPreset(Place place) { preset.add(place); } public boolean addEnabling(String newEnab) { boolean retVal = false; if (newEnab == null) { return false; } if (newEnab.equals("")) { enabling = ""; enablingTree = new ExprTree(); retVal = true; } ExprTree expr = new ExprTree(lhpn); if (newEnab != null && !newEnab.equals("")) { expr.token = expr.intexpr_gettok(newEnab); retVal = expr.intexpr_L(newEnab); if (retVal) { enablingTree = expr; enabling = newEnab; } } return retVal; } public boolean addIntAssign(String variable, String assignment) { boolean retVal; ExprTree expr = new ExprTree(lhpn); expr.token = expr.intexpr_gettok(assignment); retVal = expr.intexpr_L(assignment); if (retVal) { intAssignTrees.put(variable, expr); intAssignments.put(variable, assignment); } return retVal; } public boolean addContAssign(String variable, String assignment) { boolean retVal; ExprTree expr = new ExprTree(lhpn); expr.token = expr.intexpr_gettok(assignment); retVal = expr.intexpr_L(assignment); if (retVal) { contAssignTrees.put(variable, expr); contAssignments.put(variable, assignment); } return retVal; } public boolean addRateAssign(String variable, String assignment) { boolean retVal; ExprTree expr = new ExprTree(lhpn); expr.token = expr.intexpr_gettok(assignment); retVal = expr.intexpr_L(assignment); if (retVal) { rateAssignTrees.put(variable, expr); rateAssignments.put(variable, assignment); } return retVal; } public boolean addDelay(String delay) { if (delay.equals("")) { this.delay = null; delayTree = null; return true; } boolean retVal; if (delay.matches("\\d+?,\\d+?")) { delay = "uniform(" + delay + ")"; } ExprTree expr = new ExprTree(lhpn); expr.token = expr.intexpr_gettok(delay); retVal = expr.intexpr_L(delay); if (retVal) { delayTree = expr; this.delay = delay; } return retVal; } public boolean addPriority(String priority) { if (priority.equals("")) { this.priority = null; priorityTree = null; return true; } boolean retVal; ExprTree expr = new ExprTree(lhpn); expr.token = expr.intexpr_gettok(priority); retVal = expr.intexpr_L(priority); if (retVal) { priorityTree = expr; this.priority = priority; } return retVal; } public boolean addBoolAssign(String variable, String assignment) { boolean retVal; ExprTree expr = new ExprTree(lhpn); expr.token = expr.intexpr_gettok(assignment); retVal = expr.intexpr_L(assignment); if (retVal) { boolAssignTrees.put(variable, expr); boolAssignments.put(variable, assignment); } return retVal; } public void setName(String newName) { this.name = newName; } public void setFail(boolean fail) { this.fail = fail; } public void setIndex(int idx) { this.index = idx; } public void setPersistent(boolean persistent) { this.persistent = persistent; } public boolean isFail() { return fail; } public boolean isPersistent() { return persistent; } public boolean isConnected() { return (preset.size() > 0 || postset.size() > 0); } public boolean isInteresting(ArrayList<Transition> visited) { visited.add(this); if (boolAssignments.size() > 0 || intAssignments.size() > 0 || contAssignments.size() > 0 || rateAssignments.size() > 0 || fail) { return true; } for (Place p : postset) { for (Transition t : p.getPostset()) { if (visited.contains(t)) { continue; } if (t.isInteresting(visited)) { return true; } } } return false; } public boolean hasConflictSet() { for (Place p : getPreset()) { for (Transition t : p.getPostset()) { if (!this.toString().equals(t.toString())) { return true; } } } return false; } public int getIndex() { return this.index; } public String getName() { return name; } public String getDelay() { return delay; } public String getPriority() { return priority; } public ExprTree getDelayTree() { return delayTree; } public ExprTree getPriorityTree() { return priorityTree; } public String getTransitionRate() { if (delayTree != null) { if (delayTree.op.equals("exponential")) { return delayTree.r1.toString(); } } return null; } public ExprTree getTransitionRateTree() { if (delayTree.op.equals("exponential")) { return delayTree.r1; } return null; } public Place[] getPreset() { Place[] array = new Place[preset.size()]; int i = 0; for (Place p : preset) { array[i++] = p; } return array; } public Place[] getPostset() { Place[] array = new Place[postset.size()]; int i = 0; for (Place p : postset) { array[i++] = p; } return array; } public Transition[] getConflictSet() { ArrayList<Transition> conflictSet = new ArrayList<Transition>(); for (Place p : getPreset()) { for (Transition t : p.getPostset()) { if (!this.toString().equals(t.toString())) { conflictSet.add(t); } } } Transition[] returnSet = new Transition[conflictSet.size()]; int i = 0; for (Transition t : conflictSet) { returnSet[i] = t; i++; } return returnSet; } public Set<String> getConflictSetTransNames() { Set<String> conflictSet = new HashSet<String>(); for (Place p : getPreset()) { for (Transition t : p.getPostset()) { if (!this.toString().equals(t.toString())) { conflictSet.add(t.getName()); } } } return conflictSet; } public Set<Integer> getConflictSetTransIndices() { Set<Integer> conflictSet = new HashSet<Integer>(); for (Place p : getPreset()) { for (Transition t : p.getPostset()) { if (!this.toString().equals(t.toString())) { conflictSet.add(t.getIndex()); } } } return conflictSet; } public String getEnabling() { return enabling; } public ExprTree getEnablingTree() { return enablingTree; } public HashMap<String, String> getAssignments() { HashMap<String, String> assignments = new HashMap<String, String>(); assignments.putAll(boolAssignments); assignments.putAll(intAssignments); assignments.putAll(contAssignments); for (String var : rateAssignments.keySet()) { if (assignments.containsKey(var)) { assignments.put(var + "_rate", rateAssignments.get(var)); } else { assignments.put(var, rateAssignments.get(var)); } } return assignments; } public HashMap<String, ExprTree> getAssignTrees() { HashMap<String, ExprTree> assignments = new HashMap<String, ExprTree>(); assignments.putAll(boolAssignTrees); assignments.putAll(intAssignTrees); assignments.putAll(contAssignTrees); for (String var : rateAssignments.keySet()) { if (assignments.containsKey(var)) { assignments.put(var + "_rate", rateAssignTrees.get(var)); } else { assignments.put(var, rateAssignTrees.get(var)); } } return assignments; } public ExprTree getAssignTree(String var) { if (boolAssignTrees.containsKey(var)) { return getBoolAssignTree(var); } if (intAssignTrees.containsKey(var)) { return getIntAssignTree(var); } if (contAssignTrees.containsKey(var)) { return getContAssignTree(var); } if (rateAssignTrees.containsKey(var)) { return getRateAssignTree(var); } if (var.split("\\s").length > 1) { return getRateAssignTree(var.split("\\s")[0]); } return null; } public HashMap<String, String> getContAssignments() { return contAssignments; } public HashMap<String, ExprTree> getContAssignTrees() { return contAssignTrees; } public String getContAssignment(String variable) { return contAssignments.get(variable); } public ExprTree getContAssignTree(String variable) { return contAssignTrees.get(variable); } public HashMap<String, String> getIntAssignments() { return intAssignments; } public HashMap<String, ExprTree> getIntAssignTrees() { return intAssignTrees; } public String getIntAssignment(String variable) { return intAssignments.get(variable); } public ExprTree getIntAssignTree(String variable) { return intAssignTrees.get(variable); } public HashMap<String, String> getRateAssignments() { return rateAssignments; } public HashMap<String, ExprTree> getRateAssignTrees() { return rateAssignTrees; } public String getRateAssignment(String variable) { return rateAssignments.get(variable); } public ExprTree getRateAssignTree(String variable) { return rateAssignTrees.get(variable); } public HashMap<String, String> getBoolAssignments() { return boolAssignments; } public HashMap<String, ExprTree> getBoolAssignTrees() { return boolAssignTrees; } public String getBoolAssignment(String variable) { return boolAssignments.get(variable); } public ExprTree getBoolAssignTree(String variable) { return boolAssignTrees.get(variable); } public void renamePlace(Place oldPlace, Place newPlace) { if (preset.contains(oldPlace)) { preset.add(newPlace); preset.remove(oldPlace); } if (postset.contains(oldPlace)) { postset.add(newPlace); postset.remove(oldPlace); } } public void removeEnabling() { enabling = null; enablingTree = null; } public void removePreset(Place place) { preset.remove(place); } public void removePostset(Place place) { postset.remove(place); } public void removeAllAssign() { boolAssignments.clear(); contAssignments.clear(); rateAssignments.clear(); intAssignments.clear(); } public void removeAssignment(String variable) { if (contAssignments.containsKey(variable)) { removeContAssign(variable); } if (rateAssignments.containsKey(variable)) { removeRateAssign(variable); } if (intAssignments.containsKey(variable)) { removeIntAssign(variable); } if (boolAssignments.containsKey(variable)) { removeBoolAssign(variable); } if (variable.split("\\s").length > 1) { removeRateAssign(variable.split("\\s")[0]); } } public void removeBoolAssign(String variable) { boolAssignments.remove(variable); boolAssignTrees.remove(variable); } public void removeContAssign(String variable) { contAssignments.remove(variable); contAssignTrees.remove(variable); } public void removeRateAssign(String variable) { rateAssignments.remove(variable); rateAssignTrees.remove(variable); } public void removeIntAssign(String variable) { intAssignments.remove(variable); intAssignTrees.remove(variable); } public boolean containsDelay() { return ((delay != null) && !delay.equals("")); } public boolean containsEnabling() { return ((enabling != null) && !enabling.equals("")); } public boolean containsPriority() { return ((priority != null) && !priority.equals("")); } public boolean containsPreset(String name) { return preset.contains(name); } public boolean containsPostset(String name) { return postset.contains(name); } public boolean containsAssignment() { return (boolAssignments.size() > 0 || intAssignments.size() > 0 || contAssignments.size() > 0 || rateAssignments.size() > 0); } public boolean containsBooleanAssignment() { return boolAssignments.size() > 0; } public boolean containsIntegerAssignment() { return intAssignments.size() > 0; } public boolean containsContinuousAssignment() { return contAssignments.size() > 0; } public boolean containsRateAssignment() { return rateAssignments.size() > 0; } public boolean containsAssignment(String var) { if (boolAssignments.containsKey(var)) { return true; } if (intAssignments.containsKey(var)) { return true; } if (contAssignments.containsKey(var)) { return true; } if (rateAssignments.containsKey(var)) { return true; } return false; } public boolean simplifyExpr(boolean change) { if (enablingTree != null) { if (!enabling.equals(enablingTree.toString("LHPN"))) { change = true; } String newEnab = enablingTree.toString("LHPN"); addEnabling(newEnab); } if (delayTree != null) { if (!delay.equals(delayTree.toString("LHPN"))) { change = true; } String newDelay = delayTree.toString("LHPN"); addDelay(newDelay); } for (String var : boolAssignTrees.keySet()) { if (!boolAssignments.get(var).equals( boolAssignTrees.get(var).toString("boolean", "LHPN"))) { change = true; } boolAssignments.put(var, boolAssignTrees.get(var).toString( "boolean", "LHPN")); } for (String var : intAssignTrees.keySet()) { if (!intAssignments.get(var).equals( intAssignTrees.get(var).toString("integer", "LHPN"))) { change = true; } intAssignments.put(var, intAssignTrees.get(var).toString("integer", "LHPN")); } for (String var : contAssignTrees.keySet()) { if (!contAssignments.get(var).equals( contAssignTrees.get(var).toString("continuous", "LHPN"))) { change = true; } contAssignments.put(var, contAssignTrees.get(var).toString( "continuous", "LHPN")); } for (String var : rateAssignTrees.keySet()) { if (!rateAssignments.get(var).equals( rateAssignTrees.get(var).toString("continuous", "LHPN"))) { change = true; } rateAssignments.put(var, rateAssignTrees.get(var).toString( "continuous", "LHPN")); } return change; } public boolean minimizeUniforms(boolean change) { if (enablingTree != null) { if (!enabling.equals(enablingTree.minimizeUniforms().toString( "LHPN"))) { change = true; } enabling = enablingTree.minimizeUniforms().toString("LHPN"); } if (delayTree != null) { if (!delay.equals(delayTree.minimizeUniforms().toString("LHPN"))) { change = true; } delay = delayTree.minimizeUniforms().toString("LHPN"); } for (String var : boolAssignTrees.keySet()) { if (!boolAssignments.get(var).equals( boolAssignTrees.get(var).minimizeUniforms().toString( "boolean", "LHPN"))) { change = true; } boolAssignments.put(var, boolAssignTrees.get(var) .minimizeUniforms().toString("boolean", "LHPN")); } for (String var : intAssignTrees.keySet()) { if (!intAssignments.get(var).equals( intAssignTrees.get(var).minimizeUniforms().toString( "integer", "LHPN"))) { change = true; } intAssignments.put(var, intAssignTrees.get(var).minimizeUniforms() .toString("integer", "LHPN")); } for (String var : contAssignTrees.keySet()) { if (!contAssignments.get(var).equals( contAssignTrees.get(var).minimizeUniforms().toString( "continuous", "LHPN"))) { change = true; } contAssignments.put(var, contAssignTrees.get(var) .minimizeUniforms().toString("continuous", "LHPN")); } for (String var : rateAssignTrees.keySet()) { if (!rateAssignments.get(var).equals( rateAssignTrees.get(var).minimizeUniforms().toString( "continuous", "LHPN"))) { change = true; } rateAssignments.put(var, rateAssignTrees.get(var) .minimizeUniforms().toString("continuous", "LHPN")); } return change; } @Override public String toString() { return name; } public void changeName(String newName) { name = newName; } /** * @return LPN object containing this LPN transition. */ public LhpnFile getLpn() { return lhpn; } /** * @param lpn - Associated LPN containing this LPN transition. */ public void setLpn(LhpnFile lpn) { this.lhpn = lpn; } public boolean local() { // Returns true if LPNTran only modifies non-output variables. boolean isLocal = true; for (String assignVar : this.getAssignments().keySet()) { if (!this.getLpn().getAllInternals().keySet().contains(assignVar)) { isLocal = false; break; } } return isLocal; } public List<LhpnFile> getDstLpnList(){ return this.dstLpnList; } public void addDstLpn(LhpnFile lpn){ this.dstLpnList.add(lpn); } public String getFullLabel() { return this.lhpn.getLabel() + ":" + this.name; } /** * Check if firing 'fired_transition' causes a disabling error. * @param current_enabled_transitions * @param next_enabled_transitions * @return */ public Transition disablingError(final LinkedList<Transition> current_enabled_transitions, LinkedList<Transition> next_enabled_transitions) { if (current_enabled_transitions == null || current_enabled_transitions.size()==0) return null; for(Transition curTran : current_enabled_transitions) { if (curTran == this) continue; boolean disabled = true; if (next_enabled_transitions != null && next_enabled_transitions.size()!=0) { for(Transition nextTran : next_enabled_transitions) { if(curTran == nextTran) { disabled = false; break; } } } if (disabled == true) { Place[] preset1 = this.getPreset(); Place[] preset2 = curTran.getPreset(); Boolean share=false; for (int i=0; i < preset1.length && !share; i++) { for (int j=0; j < preset2.length && !share; j++) { if (preset1[i].getName().equals(preset2[j].getName())) share=true; } } if (!share) return curTran; // if(this.sharePreSet(curTran) == false) // return curTran; /* for (Iterator<String> confIter = this.getConflictSetTransNames().iterator(); confIter.hasNext();) { String tran = confIter.next(); if (curTran.getConflictSetTransNames().contains(tran)) return curTran; } */ } } return null; } public void setSticky(boolean sticky) { this.sticky = sticky; } public boolean isSticky() { return this.sticky; } public void setDstLpnList(LhpnFile curLPN) { String[] allVars = curLPN.getVariables(); boolean foundLPN = false; if (this.getAssignments() != null) { Set<String> assignedVars = this.getAssignments().keySet(); for (Iterator<String> assignedVarsIter = assignedVars.iterator(); assignedVarsIter.hasNext();) { String curVar = assignedVarsIter.next(); for (int i=0; i<allVars.length; i++) { if (curVar.equals(allVars[i]) && !this.dstLpnList.contains(curLPN)) { this.dstLpnList.add(curLPN); foundLPN = true; break; } } if (foundLPN) break; } } } /* Maybe copy method below is not needed. public Transition copy(HashMap<String, VarNode> variables){ return new Transition(this.name, this.index, this.preset, this.postset, this.enablingGuard.copy(variables), this.assignments.copy(variables), this.delayLB, this.delayUB, this.local); } */ }
package stategraph; import java.io.BufferedWriter; import java.io.FileWriter; import java.util.ArrayList; import java.util.HashMap; import java.util.LinkedList; import java.util.Stack; import lhpn2sbml.parser.ExprTree; import lhpn2sbml.parser.LHPNFile; public class StateGraph { private HashMap<String, LinkedList<Marking>> stateGraph; private LHPNFile lhpn; public StateGraph(LHPNFile lhpn) { this.lhpn = lhpn; stateGraph = new HashMap<String, LinkedList<Marking>>(); buildStateGraph(); } private void buildStateGraph() { ArrayList<String> variables = new ArrayList<String>(); for (String var : lhpn.getBooleanVars()) { variables.add(var); } boolean[] variableVector = new boolean[variables.size()]; for (int i = 0; i < variableVector.length; i++) { if (lhpn.getInitialVal(variables.get(i)).equals("true")) { variableVector[i] = true; } else { variableVector[i] = false; } } ArrayList<String> markedPlaces = new ArrayList<String>(); HashMap<String, Boolean> places = lhpn.getPlaces(); for (String place : places.keySet()) { if (places.get(place)) { markedPlaces.add(place); } } LinkedList<Marking> markings = new LinkedList<Marking>(); int counter = 0; Marking state = new Marking(markedPlaces.toArray(new String[0]), new Marking[0], "S" + counter); markings.add(state); counter++; stateGraph.put(vectorToString(variableVector), markings); Stack<Transition> transitionsToFire = new Stack<Transition>(); for (String transition : lhpn.getTransitionList()) { boolean addToStack = true; for (String place : lhpn.getPreset(transition)) { if (!markedPlaces.contains(place)) { addToStack = false; } } if (addToStack) { transitionsToFire.push(new Transition(transition, copyArrayList(markedPlaces), copyStateVector(variableVector), state)); } } while (transitionsToFire.size() != 0) { Transition fire = transitionsToFire.pop(); markedPlaces = fire.getMarkedPlaces(); variableVector = fire.getVariableVector(); for (String place : lhpn.getPreset(fire.getTransition())) { markedPlaces.remove(place); } for (String place : lhpn.getPostset(fire.getTransition())) { markedPlaces.add(place); } for (int i = 0; i < variables.size(); i++) { if (lhpn.getBoolAssignTree(fire.getTransition(), variables.get(i)) != null) { if (evaluateExp(lhpn.getBoolAssignTree(fire.getTransition(), variables.get(i))) .equals("true")) { variableVector[i] = true; } else { variableVector[i] = false; } } } if (!stateGraph.containsKey(vectorToString(variableVector))) { markings = new LinkedList<Marking>(); state = new Marking(markedPlaces.toArray(new String[0]), new Marking[0], "S" + counter); markings.add(state); fire.getParent().addNextState(state); counter++; stateGraph.put(vectorToString(variableVector), markings); for (String transition : lhpn.getTransitionList()) { boolean addToStack = true; for (String place : lhpn.getPreset(transition)) { if (!markedPlaces.contains(place)) { addToStack = false; } } if (addToStack) { transitionsToFire .push(new Transition(transition, copyArrayList(markedPlaces), copyStateVector(variableVector), state)); } } } else { markings = stateGraph.get(vectorToString(variableVector)); boolean add = true; boolean same = true; for (Marking mark : markings) { for (String place : mark.getMarkings()) { if (!markedPlaces.contains(place)) { same = false; } } for (String place : markedPlaces) { boolean contains = false; for (String place2 : mark.getMarkings()) { if (place2.equals(place)) { contains = true; } } if (!contains) { same = false; } } if (same) { add = false; fire.getParent().addNextState(mark); } same = true; } if (add) { state = new Marking(markedPlaces.toArray(new String[0]), new Marking[0], "S" + counter); markings.add(state); fire.getParent().addNextState(state); counter++; stateGraph.put(vectorToString(variableVector), markings); for (String transition : lhpn.getTransitionList()) { boolean addToStack = true; for (String place : lhpn.getPreset(transition)) { if (!markedPlaces.contains(place)) { addToStack = false; } } if (addToStack) { transitionsToFire.push(new Transition(transition, copyArrayList(markedPlaces), copyStateVector(variableVector), state)); } } } } } } private String evaluateExp(ExprTree[] exprTrees) { return "false"; } private ArrayList<String> copyArrayList(ArrayList<String> original) { ArrayList<String> copy = new ArrayList<String>(); for (String element : original) { copy.add(element); } return copy; } private boolean[] copyStateVector(boolean[] original) { boolean[] copy = new boolean[original.length]; for (int i = 0; i < original.length; i++) { copy[i] = original[i]; } return copy; } private String vectorToString(boolean[] vector) { String string = ""; for (boolean b : vector) { if (b) { string += "1"; } else { string += "0"; } } return string; } public void outputStateGraph(String file) { try { BufferedWriter out = new BufferedWriter(new FileWriter(file)); out.write("digraph G {\n"); for (String state : stateGraph.keySet()) { for (Marking m : stateGraph.get(state)) { out.write(m.getID() + " [shape=\"ellipse\",label=\"" + state + "\"]\n"); for (Marking next : m.getNextStates()) { out.write(m.getID() + " -> " + next.getID() + "\n"); } } } out.write("}"); out.close(); } catch (Exception e) { System.err.println("Error outputting state graph as dot file."); } } private class Transition { private String transition; private boolean[] variableVector; private ArrayList<String> markedPlaces; private Marking parent; private Transition(String transition, ArrayList<String> markedPlaces, boolean[] variableVector, Marking parent) { this.transition = transition; this.markedPlaces = markedPlaces; this.variableVector = variableVector; this.parent = parent; } private String getTransition() { return transition; } private ArrayList<String> getMarkedPlaces() { return markedPlaces; } private boolean[] getVariableVector() { return variableVector; } private Marking getParent() { return parent; } } private class Marking { private String[] markings; private Marking[] nextStates; private String id; private Marking(String[] markings, Marking[] nextStates, String id) { this.markings = markings; this.nextStates = nextStates; this.id = id; } private String getID() { return id; } private String[] getMarkings() { return markings; } private Marking[] getNextStates() { return nextStates; } private void addNextState(Marking nextState) { Marking[] newNextStates = new Marking[nextStates.length + 1]; for (int i = 0; i < nextStates.length; i++) { newNextStates[i] = nextStates[i]; } newNextStates[newNextStates.length - 1] = nextState; nextStates = newNextStates; } } }
package jp.sf.fess.suggest.service; import jp.sf.fess.suggest.FessSuggestTestCase; import jp.sf.fess.suggest.SpellChecker; import jp.sf.fess.suggest.SuggestConstants; import jp.sf.fess.suggest.Suggester; import jp.sf.fess.suggest.entity.SuggestResponse; import jp.sf.fess.suggest.server.SuggestSolrServer; import org.apache.solr.client.solrj.impl.HttpSolrServer; import org.apache.solr.common.SolrDocumentList; import java.net.URLEncoder; import java.util.HashSet; import java.util.List; import java.util.Set; public class SuggestServiceTest extends FessSuggestTestCase { protected SuggestService service; SuggestSolrServer suggestSolrServer; public void setUp() throws Exception { super.setUp(); startSolr(); Suggester suggester = new Suggester(); suggester.setConverter(createConverter()); suggester.setNormalizer(createNormalizer()); SpellChecker spellChecker = new SpellChecker(); spellChecker.setConverter(createConverter()); spellChecker.setNormalizer(createNormalizer()); suggestSolrServer = new SuggestSolrServer(new HttpSolrServer(SOLR_URL)); service = new SuggestService(suggester, spellChecker, suggestSolrServer); suggestSolrServer.deleteByQuery("*:*"); } @Override public void tearDown() throws Exception { super.tearDown(); stopSolr(); } public void test_addSolrParams() throws Exception { service.addSolrParams("q=content:hoge"); service.commit(); Thread.sleep(2 * 1000); SolrDocumentList list = suggestSolrServer.select("*:*"); assertEquals(1, list.getNumFound()); } public void test_addSolrParamsJapanese() throws Exception { String query = "q=content:" + URLEncoder.encode("", SuggestConstants.UTF_8); service.addSolrParams(query); service.commit(); Thread.sleep(2 * 1000); SolrDocumentList list = suggestSolrServer.select("*:*"); assertEquals(1, list.getNumFound()); SuggestResponse response = service.getSuggestResponse("", null, null, null, 20); List sList = response.get(""); assertEquals("", sList.get(0)); } public void test_addMultipleWords() throws Exception { service.addSolrParams("q=content:hoge AND content:fuga"); service.addSolrParams("q=content:hoge AND content:zzz"); service.addSolrParams("q=content:hoge AND content:zzz"); service.commit(); Thread.sleep(2 * 1000); assertEquals(2, service.getSearchLogDocumentNum()); assertEquals(0, service.getContentDocumentNum()); SuggestResponse response = service.getSuggestResponse("hoge", null, null, null, 20); List sList = response.get("hoge"); assertEquals("hoge zzz", sList.get(0)); assertEquals("hoge fuga", sList.get(1)); response = service.getSuggestResponse("hoge f", null, null, null, 20); sList = response.get("hoge f"); assertEquals(1, sList.size()); assertEquals("hoge fuga", sList.get(0)); } public void test_addElevateWord() throws Exception { service.addElevateWord("hoge", null, null, null, 0); service.commit(); Thread.sleep(2 * 1000); SuggestResponse response = service.getSuggestResponse("hoge", null, null, null, 20); List sList = response.get("hoge"); assertEquals("hoge", sList.get(0)); } public void test_updateBadWords() throws Exception { Set<String> badWords = new HashSet<>(); badWords.add("hoge"); service.updateBadWords(badWords); service.addSolrParams("q=content:hoge"); service.addSolrParams("q=content:hoge AND content:zzz"); service.commit(); Thread.sleep(2 * 1000); SolrDocumentList list = suggestSolrServer.select("*:*"); assertEquals(0, list.getNumFound()); } public void test_deleteBadWords() throws Exception { service.addSolrParams("q=content:hoge"); service.addSolrParams("q=content:zzz"); service.addSolrParams("q=content:hoge AND content:zzz"); service.addSolrParams("q=content:fuga AND content:zzz"); service.commit(); Thread.sleep(2 * 1000); SolrDocumentList list = suggestSolrServer.select("*:*"); assertEquals(4, list.getNumFound()); Set<String> badWords = new HashSet<>(); badWords.add("hoge"); service.updateBadWords(badWords); service.deleteBadWords(); service.commit(); Thread.sleep(2 * 1000); list = suggestSolrServer.select("*:*"); assertEquals(2, list.getNumFound()); badWords.add("zzz"); service.updateBadWords(badWords); service.deleteBadWords(); service.commit(); Thread.sleep(2 * 1000); list = suggestSolrServer.select("*:*"); assertEquals(0, list.getNumFound()); } }
package kodkod.test.pardinus.temporal; import static org.junit.Assert.assertEquals; import static org.junit.Assert.assertFalse; import static org.junit.Assert.assertTrue; import java.util.Iterator; import org.junit.Test; import kodkod.ast.Expression; import kodkod.ast.Formula; import kodkod.ast.IntConstant; import kodkod.ast.Relation; import kodkod.engine.Evaluator; import kodkod.engine.PardinusSolver; import kodkod.engine.Solution; import kodkod.engine.config.ExtendedOptions; import kodkod.instance.PardinusBounds; import kodkod.instance.TupleFactory; import kodkod.instance.TupleSet; import kodkod.instance.Universe; /** * Tests for mutable integer relations. * * @author Nuno Macedo // [HASLab] temporal model finding */ public class VarIntegerTests { @Test public void test0() { Relation a = Relation.unary_variable("a"); Universe uni = new Universe("-2", "-1", "0", "1"); TupleFactory f = uni.factory(); TupleSet as = f.range(f.tuple("-2"), f.tuple("1")); PardinusBounds bounds = new PardinusBounds(uni); bounds.boundExactly(-2, f.range(f.tuple("-2"), f.tuple("-2"))); bounds.boundExactly(-1, f.range(f.tuple("-1"), f.tuple("-1"))); bounds.boundExactly(0, f.range(f.tuple("0"), f.tuple("0"))); bounds.boundExactly(1, f.range(f.tuple("1"), f.tuple("1"))); bounds.bound(a, as); Formula formula = a.sum().eq(IntConstant.constant(1)).always(); ExtendedOptions opt = new ExtendedOptions(); // opt.setReporter(new SLF4JReporter()); opt.setBitwidth(2); opt.setRunTemporal(true); opt.setRunDecomposed(false); opt.setMaxTraceLength(2); opt.setNoOverflow(false); PardinusSolver solver = new PardinusSolver(opt); assertTrue("expected sat", solver.solve(formula, bounds).sat()); Iterator<Solution> sols = solver.solveAll(formula, bounds); Solution sol = sols.next(); int c = 1; while (sol.sat()) { sol = sols.next(); c++; if (sol.sat()) { opt.reporter().debug(sol.instance().toString()); } } assertEquals(29, c); solver.free(); } @Test public void test1() { Relation a = Relation.unary_variable("a"); Universe uni = new Universe("-2", "-1", "0", "1"); TupleFactory f = uni.factory(); TupleSet as = f.range(f.tuple("-2"), f.tuple("1")); PardinusBounds bounds = new PardinusBounds(uni); bounds.boundExactly(-2, f.range(f.tuple("-2"), f.tuple("-2"))); bounds.boundExactly(-1, f.range(f.tuple("-1"), f.tuple("-1"))); bounds.boundExactly(0, f.range(f.tuple("0"), f.tuple("0"))); bounds.boundExactly(1, f.range(f.tuple("1"), f.tuple("1"))); bounds.bound(a, as); Formula formula = (a.sum().eq(IntConstant.constant(1)).and(a.count().eq(IntConstant.constant(-2)))).always(); ExtendedOptions opt = new ExtendedOptions(); opt.setBitwidth(2); opt.setRunTemporal(true); opt.setRunDecomposed(false); opt.setMaxTraceLength(2); opt.setNoOverflow(false); PardinusSolver solver = new PardinusSolver(opt); assertTrue("expected sat", solver.solve(formula, bounds).sat()); Iterator<Solution> sols = solver.solveAll(formula, bounds); Solution sol = sols.next(); int c = 1; while (sol.sat()) { sol = sols.next(); c++; if (sol.sat()) { opt.reporter().debug(sol.instance().toString()); } } assertEquals(7, c); solver.free(); } @Test public void testU() { Relation a = Relation.unary_variable("a"); Universe uni = new Universe("-2", "-1", "0", "1"); TupleFactory f = uni.factory(); TupleSet as = f.range(f.tuple("-2"), f.tuple("1")); PardinusBounds bounds = new PardinusBounds(uni); bounds.boundExactly(-2, f.range(f.tuple("-2"), f.tuple("-2"))); bounds.boundExactly(-1, f.range(f.tuple("-1"), f.tuple("-1"))); bounds.boundExactly(0, f.range(f.tuple("0"), f.tuple("0"))); bounds.boundExactly(1, f.range(f.tuple("1"), f.tuple("1"))); bounds.bound(a, as); Formula formula = a.sum().eq(IntConstant.constant(2)).always(); ExtendedOptions opt = new ExtendedOptions(); opt.setBitwidth(2); opt.setRunTemporal(true); opt.setRunDecomposed(false); opt.setMaxTraceLength(3); opt.setNoOverflow(true); // opt.setReporter(new ConsoleReporter()); PardinusSolver solver = new PardinusSolver(opt); assertFalse("expected unsat", solver.solve(formula, bounds).sat()); } @Test public void testEnc() { Relation a = Relation.unary_variable("a"); Universe uni = new Universe("-2", "-1", "0", "1"); TupleFactory f = uni.factory(); TupleSet as = f.range(f.tuple("-2"), f.tuple("1")); PardinusBounds bounds = new PardinusBounds(uni); bounds.boundExactly(-2, f.range(f.tuple("-2"), f.tuple("-2"))); bounds.boundExactly(-1, f.range(f.tuple("-1"), f.tuple("-1"))); bounds.boundExactly(0, f.range(f.tuple("0"), f.tuple("0"))); bounds.boundExactly(1, f.range(f.tuple("1"), f.tuple("1"))); bounds.bound(a, as); Formula formula = a.sum().eq(IntConstant.constant(1)).always(); ExtendedOptions opt = new ExtendedOptions(); // opt.setReporter(new SLF4JReporter()); opt.setBitwidth(2); opt.setRunTemporal(true); opt.setRunDecomposed(false); opt.setMaxTraceLength(2); opt.setNoOverflow(false); PardinusSolver solver = new PardinusSolver(opt); assertTrue("expected sat", solver.solve(formula, bounds).sat()); Solution sol = solver.solveAll(formula, bounds).next(); assertEquals(4,sol.instance().ints().size()); Evaluator eval = new Evaluator(sol.instance()); assertEquals(4,eval.evaluate(Expression.INTS).size()); assertEquals(4,eval.evaluate(Expression.INTS,2).size()); assertEquals(2,eval.evaluate(a).size()); assertEquals(2,eval.evaluate(a,3).size()); solver.free(); } }
package nl.yacht.lakesideresort.domain; import org.junit.Assert; import org.junit.Test; import java.lang.reflect.Field; import java.lang.reflect.InvocationTargetException; import java.lang.reflect.Method; import java.util.ArrayList; import java.util.List; public class BoatRentalTest { /** * Testing a private method using reflection */ @Test public void testGetNewTripNumber(){ BoatRental rental = new BoatRental(); List<Trip> tripsMock = new ArrayList<>(); Trip trip1 = new Trip(5); Trip trip2 = new Trip(2); Trip trip3 = new Trip(8); Trip trip4 = new Trip(1); try { Field field = rental.getClass().getDeclaredField("trips"); field.setAccessible(true); field.set(rental, tripsMock); Method method = rental.getClass().getDeclaredMethod("getNewTripNumber", null); method.setAccessible(true); int tripNr = (int) method.invoke(rental); Assert.assertTrue(tripNr == 9); } catch (NoSuchFieldException e) { e.printStackTrace(); } catch (IllegalAccessException e){ e.printStackTrace(); } catch (NoSuchMethodException e) { e.printStackTrace(); } catch (InvocationTargetException e) { e.printStackTrace(); } } }
package org.jnosql.javaone.gameon.map; import org.apache.tinkerpop.gremlin.structure.Edge; import org.apache.tinkerpop.gremlin.structure.Graph; import org.apache.tinkerpop.gremlin.structure.Vertex; import org.jnosql.artemis.graph.EdgeEntity; import org.jnosql.artemis.graph.GraphTemplate; import org.jnosql.javaone.gameon.map.infrastructure.CDIExtension; import org.junit.jupiter.api.Assertions; import org.junit.jupiter.api.BeforeEach; import org.junit.jupiter.api.Test; import org.junit.jupiter.api.extension.ExtendWith; import javax.inject.Inject; import java.util.Arrays; import java.util.Collection; import java.util.HashSet; import java.util.Optional; import java.util.Set; import static org.apache.tinkerpop.gremlin.structure.Direction.OUT; import static org.jnosql.javaone.gameon.map.Site.builder; import static org.junit.jupiter.api.Assertions.assertEquals; import static org.junit.jupiter.api.Assertions.assertFalse; import static org.junit.jupiter.api.Assertions.assertNotNull; import static org.junit.jupiter.api.Assertions.assertThrows; import static org.junit.jupiter.api.Assertions.assertTrue; @ExtendWith(CDIExtension.class) public class SiteServiceTest { @Inject private SiteService siteService; @Inject private Graph graph; @Inject private GraphTemplate template; @BeforeEach public void before() { graph.traversal().V().toList().forEach(Vertex::remove); graph.traversal().E().toList().forEach(Edge::remove); } @Test public void shouldCreate() { Site site = builder().withName("main").withFullName("Main room site").build(); siteService.create(site); assertTrue(siteService.findByName(site.getName()).isPresent()); } @Test public void shouldReturnErrorWhenThereIsDoubleRoom() { Site site = builder().withName("main").withFullName("Main room site").build(); siteService.create(site); IllegalArgumentException exception = assertThrows(IllegalArgumentException.class, () -> siteService.create(site)); assertEquals("The site name already does exist: main", exception.getMessage()); } @Test public void shouldUpdateSite() { String newFullName = "update Main room site"; Site site = builder().withName("main").withFullName("Main room site").build(); siteService.create(site); siteService.update(builder().withName("main").withFullName(newFullName).build()); Site updatedSite = siteService.findByName("main").orElseThrow(() -> new NullPointerException("Cannot be null")); assertEquals(newFullName, updatedSite.getFullName()); } @Test public void shouldCreateNewSite() { assertNotNull(siteService.createSite()); } @Test public void shouldGoTo() { String forward = "west gate description"; String backward = "back gate description"; Site main = builder().withName("main").withFullName("Main room site").withCoordinate(Coordinate.MAIN).build(); siteService.create(main); Site site = builder().withName("second").withFullName("Main room site").build(); siteService.createSite().to(site).from("main").by(Direction.WEST); Site eastSite = siteService.findByName("second").get(); main = siteService.findByName("main").get(); Site result = siteService.goTo(main, Direction.WEST).get(); Site resultB = siteService.goTo(eastSite, Direction.EAST).get(); assertEquals(eastSite.getId(), result.getId()); assertEquals(main.getId(), resultB.getId()); } @Test public void shouldReturnMainRoom() { Site main = builder().withName("main").withFullName("Main room site").withCoordinate(Coordinate.MAIN).build(); siteService.create(main); Optional<Site> recentRoom = siteService.getRecentRoom(); Assertions.assertEquals("main", recentRoom.map(Site::getName).orElse("")); } @Test public void shouldCreateWhenSiteAreNull() { Site main = builder().withName("main").withFullName("Main room site").build(); siteService.place(main); main = siteService.findByName("main") .orElseThrow(() -> new RuntimeException("Should return the main room")); assertEquals("main", main.getName()); assertEquals("Main room site", main.getFullName()); assertEquals(Coordinate.MAIN, main.getCoordinate()); assertNotNull(main.getId()); } @Test public void shouldCreateNextRoom() { Site main = builder().withName("main").withFullName("Main room site").withCoordinate(Coordinate.MAIN).build(); siteService.create(main); main = siteService.findByName("main").get(); Site second = builder().withName("second").withFullName("second room").build(); siteService.place(second); Site site = siteService.goTo(main, Direction.NORTH).get(); Assertions.assertEquals(site.getName(), second.getName()); } @Test public void shouldDoMap() { Site main = builder().withName("main").withFullName("Main room site").withCoordinate(Coordinate.MAIN).build(); siteService.create(main); Site second = builder().withName("second").withFullName("second room").build(); Site third = builder().withName("third").withFullName("third room").build(); Site fourth = builder().withName("fourth").withFullName("fourth room").build(); Site fifth = builder().withName("fifth").withFullName("fifth room").build(); Set<Site> sites = new HashSet<>(Arrays.asList(second, third, fourth, fifth)); siteService.place(second); siteService.place(third); siteService.place(fourth); siteService.place(fifth); main = siteService.findByName(main.getName()).get(); for (Direction direction : Direction.values()) { Optional<Site> site = siteService.goTo(main, direction); Assertions.assertTrue(site.isPresent()); sites.remove(site.get()); } Assertions.assertTrue(sites.isEmpty()); } @Test public void shouldBecameUnavailable() { Site main = builder().withName("main").withFullName("Main room site").withCoordinate(Coordinate.MAIN).build(); siteService.create(main); Site second = builder().withName("second").withFullName("second room").build(); Site third = builder().withName("third").withFullName("third room").build(); Site fourth = builder().withName("fourth").withFullName("fourth room").build(); Site fifth = builder().withName("fifth").withFullName("fifth room").build(); siteService.place(second); siteService.place(third); siteService.place(fourth); siteService.place(fifth); main = siteService.findByName("main").get(); assertFalse(main.isDoorAvailable()); } @Test public void shouldGoLevelTwo() { Site main = builder().withName("main").withFullName("Main room site").withCoordinate(Coordinate.MAIN).build(); siteService.create(main); for (int index = 0; index < 12; index++) { Site site = builder().withName("room_" + index).withFullName("room_" + index).build(); siteService.place(site); site = siteService.findByName(site.getName()).get(); } Coordinate[][] coordinates = new Coordinate[5][5]; Site[][] sites = new Site[5][5]; for (int x = -2; x <= 2; x++) { for (int y = -2; y <= 2; y++) { coordinates[x + 2][y + 2] = Coordinate.builder().withX(x).withY(y).build(); Optional<Site> siteXY = siteService.findByCoordinate(coordinates[x + 2][y + 2]); if (siteXY.isPresent()) { sites[x + 2][y + 2] = siteXY.get(); } } } //y = -2 Assertions.assertNull(sites[0][0]); Assertions.assertNull(sites[1][0]); Assertions.assertNotNull(sites[2][0]); Assertions.assertNull(sites[3][0]); Assertions.assertNull(sites[4][0]); //y = -1 Assertions.assertNull(sites[0][1]); Assertions.assertNotNull(sites[1][1]); Assertions.assertNotNull(sites[2][1]); Assertions.assertNotNull(sites[3][1]); Assertions.assertNull(sites[4][1]); //y = -0 Assertions.assertNotNull(sites[0][2]); Assertions.assertNotNull(sites[1][2]); Assertions.assertNotNull(sites[2][2]); Assertions.assertNotNull(sites[3][2]); Assertions.assertNotNull(sites[4][2]); //y = 1 Assertions.assertNull(sites[0][3]); Assertions.assertNotNull(sites[1][3]); Assertions.assertNotNull(sites[2][3]); Assertions.assertNotNull(sites[3][3]); Assertions.assertNull(sites[4][3]); //y = 2 Assertions.assertNull(sites[0][4]); Assertions.assertNull(sites[1][4]); Assertions.assertNotNull(sites[2][4]); Assertions.assertNull(sites[3][4]); Assertions.assertNull(sites[4][4]); //x = 0, y = 1 { Site zp1 = sites[2][3]; Collection<EdgeEntity> edges_zp1 = template.getEdges(zp1, OUT); Assertions.assertEquals(4, edges_zp1.size()); Assertions.assertEquals(sites[1][3], siteService.goTo(zp1, Direction.WEST).get()); Assertions.assertEquals(sites[3][3], siteService.goTo(zp1, Direction.EAST).get()); Assertions.assertEquals(sites[2][4], siteService.goTo(zp1, Direction.NORTH).get()); Assertions.assertEquals(sites[2][2], siteService.goTo(zp1, Direction.SOUTH).get()); } //x = 0, y = 2 { Site zp2 = sites[2][4]; Collection<EdgeEntity> edges_zp2 = template.getEdges(zp2, OUT); Assertions.assertEquals(1, edges_zp2.size()); Assertions.assertEquals(sites[2][3], siteService.goTo(zp2, Direction.SOUTH).get()); assertFalse(siteService.goTo(zp2, Direction.NORTH).isPresent()); assertFalse(siteService.goTo(zp2, Direction.EAST).isPresent()); assertFalse(siteService.goTo(zp2, Direction.WEST).isPresent()); } //x = -1, y = -1 { Site m1m1 = sites[1][1]; Collection<EdgeEntity> edges_m1m1 = template.getEdges(m1m1, OUT); Assertions.assertEquals(2, edges_m1m1.size()); Assertions.assertEquals(sites[1][2], siteService.goTo(m1m1, Direction.NORTH).get()); Assertions.assertEquals(sites[2][1], siteService.goTo(m1m1, Direction.EAST).get()); assertFalse(siteService.goTo(m1m1, Direction.WEST).isPresent()); assertFalse(siteService.goTo(m1m1, Direction.SOUTH).isPresent()); } } @Test public void shouldDelete() { Site main = builder().withName("main").withFullName("Main room site").withCoordinate(Coordinate.MAIN).build(); siteService.create(main); siteService.deleteByName("main"); assertFalse(siteService.findByName("main").isPresent()); Optional<Site> site = siteService.findByName("0:0"); Assertions.assertTrue(site.isPresent()); Assertions.assertTrue(site.map(Site::isEmpty).orElse(false)); } }
package biomodel.gui.sbmlcore; import java.awt.BorderLayout; import java.awt.Dimension; import java.awt.GridLayout; import java.awt.event.ActionEvent; import java.awt.event.ActionListener; import java.awt.event.MouseEvent; import java.awt.event.MouseListener; import java.net.URI; import java.util.ArrayList; import java.util.LinkedList; import java.util.List; import javax.swing.JButton; import javax.swing.JCheckBox; import javax.swing.JComboBox; import javax.swing.JLabel; import javax.swing.JList; import javax.swing.JOptionPane; import javax.swing.JPanel; import javax.swing.JScrollPane; import javax.swing.JTextArea; import javax.swing.JTextField; import javax.swing.ListSelectionModel; import main.Gui; import main.util.Utility; import org.sbml.jsbml.ASTNode; import org.sbml.jsbml.Compartment; import org.sbml.jsbml.InitialAssignment; import org.sbml.jsbml.KineticLaw; import org.sbml.jsbml.ListOf; import org.sbml.jsbml.LocalParameter; import org.sbml.jsbml.Model; import org.sbml.jsbml.ModifierSpeciesReference; import org.sbml.jsbml.Parameter; import org.sbml.jsbml.Reaction; import org.sbml.jsbml.SBMLDocument; import org.sbml.jsbml.SBase; import org.sbml.jsbml.SimpleSpeciesReference; import org.sbml.jsbml.Species; import org.sbml.jsbml.SpeciesReference; import org.sbml.jsbml.UnitDefinition; import org.sbml.jsbml.ext.arrays.ArraysSBasePlugin; import org.sbml.jsbml.ext.arrays.Index; import org.sbml.jsbml.ext.comp.Port; import org.sbml.jsbml.ext.fbc.FluxBound; import biomodel.annotation.AnnotationUtility; import biomodel.annotation.SBOLAnnotation; import biomodel.gui.sbol.SBOLField; import biomodel.gui.schematic.ModelEditor; import biomodel.parser.BioModel; import biomodel.util.GlobalConstants; import biomodel.util.SBMLutilities; /** * This is a class for creating SBML parameters * * @author Chris Myers * */ public class Reactions extends JPanel implements ActionListener, MouseListener { private static final long serialVersionUID = 1L; private JComboBox stoiciLabel; private JComboBox reactionComp; // compartment combo box private JList reactions; // JList of reactions private String[] reacts; // array of reactions /* * reactions buttons */ private JButton addReac, removeReac, editReac; private JList reacParameters; // JList of reaction parameters private String[] reacParams; // array of reaction parameters /* * reaction parameters buttons */ private JButton reacAddParam, reacRemoveParam, reacEditParam; private ArrayList<LocalParameter> changedParameters; // ArrayList of parameters /* * reaction parameters text fields */ private JTextField reacParamID, reacParamValue, reacParamName; private JComboBox reacParamUnits; private JTextField reacID, reacName; // reaction name and id text private JCheckBox onPort, paramOnPort; // fields private JComboBox reacReverse, reacFast; // reaction reversible, fast combo // boxes /* * reactant buttons */ private JButton addReactant, removeReactant, editReactant; private JList reactants; // JList for reactants private String[] reacta; // array for reactants private JComboBox reactantConstant; /* * ArrayList of reactants */ private ArrayList<SpeciesReference> changedReactants; /* * product buttons */ private JButton addProduct, removeProduct, editProduct; private JList products; // JList for products private String[] proda; // array for products private JComboBox productConstant; /* * ArrayList of products */ private ArrayList<SpeciesReference> changedProducts; /* * modifier buttons */ private JButton addModifier, removeModifier, editModifier; private JList modifiers; // JList for modifiers private String[] modifierArray; // array for modifiers /* * ArrayList of modifiers */ private ArrayList<ModifierSpeciesReference> changedModifiers; private JComboBox productSpecies; // ComboBox for product editing private JComboBox modifierSpecies; // ComboBox for modifier editing private JTextField productId; private JTextField productName; private JTextField modifierName; private JTextField productStoichiometry; // text field for editing products private JComboBox reactantSpecies; // ComboBox for reactant editing private JTextField RiIndex; private JTextField PiIndex; private JTextField MiIndex, modifierId; private JTextField CiIndex; /* * text field for editing reactants */ private JTextField reactantId; private JTextField reactantName; private SBOLField sbolField; private JTextField reactantStoichiometry; private JTextArea kineticLaw; // text area for editing kinetic law private ArrayList<String> thisReactionParams; private JButton useMassAction, clearKineticLaw; private BioModel bioModel; private Boolean paramsOnly; private String file; private ArrayList<String> parameterChanges; private InitialAssignments initialsPanel; private Rules rulesPanel; private String selectedReaction; private ModelEditor modelEditor; private Reaction complex = null; private Reaction production = null; private JComboBox SBOTerms = null; private JTextField repCooperativity, actCooperativity, repBinding, actBinding; public Reactions(BioModel gcm, Boolean paramsOnly, ArrayList<String> getParams, String file, ArrayList<String> parameterChanges, ModelEditor gcmEditor) { super(new BorderLayout()); this.bioModel = gcm; this.paramsOnly = paramsOnly; this.file = file; this.parameterChanges = parameterChanges; this.modelEditor = gcmEditor; Model model = gcm.getSBMLDocument().getModel(); JPanel addReacs = new JPanel(); addReac = new JButton("Add Reaction"); removeReac = new JButton("Remove Reaction"); editReac = new JButton("Edit Reaction"); addReacs.add(addReac); addReacs.add(removeReac); addReacs.add(editReac); addReac.addActionListener(this); removeReac.addActionListener(this); editReac.addActionListener(this); if (paramsOnly) { addReac.setEnabled(false); removeReac.setEnabled(false); } JLabel reactionsLabel = new JLabel("List of Reactions:"); reactions = new JList(); reactions.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); JScrollPane scroll2 = new JScrollPane(); scroll2.setViewportView(reactions); ListOf<Reaction> listOfReactions = model.getListOfReactions(); reacts = new String[model.getReactionCount()]; for (int i = 0; i < model.getReactionCount(); i++) { Reaction reaction = listOfReactions.get(i); reacts[i] = reaction.getId(); if (paramsOnly && reaction.getKineticLaw()!=null) { ListOf<LocalParameter> params = reaction.getKineticLaw().getListOfLocalParameters(); for (int j = 0; j < reaction.getKineticLaw().getLocalParameterCount(); j++) { LocalParameter paramet = (params.get(j)); for (int k = 0; k < getParams.size(); k++) { if (getParams.get(k).split(" ")[0].equals(reaction.getId() + "/" + paramet.getId())) { parameterChanges.add(getParams.get(k)); String[] splits = getParams.get(k).split(" "); if (splits[splits.length - 2].equals("Modified") || splits[splits.length - 2].equals("Custom")) { String value = splits[splits.length - 1]; paramet.setValue(Double.parseDouble(value)); } else if (splits[splits.length - 2].equals("Sweep")) { String value = splits[splits.length - 1]; paramet.setValue(Double.parseDouble(value.split(",")[0].substring(1).trim())); } if (!reacts[i].contains("Modified")) { reacts[i] += " Modified"; } } } } } } Utility.sort(reacts); reactions.setListData(reacts); reactions.setSelectedIndex(0); reactions.addMouseListener(this); this.add(reactionsLabel, "North"); this.add(scroll2, "Center"); this.add(addReacs, "South"); } /** * Creates a frame used to edit reactions or create new ones. */ public void reactionsEditor(BioModel bioModel, String option, String reactionId, boolean inSchematic) { /* * if (option.equals("OK") && reactions.getSelectedIndex() == -1) { * JOptionPane.showMessageDialog(Gui.frame, "No reaction selected.", * "Must Select A Reaction", JOptionPane.ERROR_MESSAGE); return; } */ selectedReaction = reactionId; JLabel id = new JLabel("ID:"); reacID = new JTextField(15); JLabel name = new JLabel("Name:"); if (bioModel.getSBMLDocument().getLevel() < 3) { reacName = new JTextField(50); } else { reacName = new JTextField(30); } JLabel onPortLabel = new JLabel("Is Mapped to a Port:"); onPort = new JCheckBox(); JLabel reactionCompLabel = new JLabel("Compartment:"); ListOf<Compartment> listOfCompartments = bioModel.getSBMLDocument().getModel().getListOfCompartments(); String[] addC = new String[bioModel.getSBMLDocument().getModel().getCompartmentCount()]; for (int i = 0; i < bioModel.getSBMLDocument().getModel().getCompartmentCount(); i++) { addC[i] = listOfCompartments.get(i).getId(); } reactionComp = new JComboBox(addC); reactionComp.addActionListener(this); JLabel reverse = new JLabel("Reversible:"); String[] options = { "true", "false" }; reacReverse = new JComboBox(options); reacReverse.setSelectedItem("false"); JLabel fast = new JLabel("Fast:"); reacFast = new JComboBox(options); reacFast.setSelectedItem("false"); String selectedID = ""; Reaction copyReact = null; JPanel param = new JPanel(new BorderLayout()); JPanel addParams = new JPanel(); reacAddParam = new JButton("Add Parameter"); reacRemoveParam = new JButton("Remove Parameter"); reacEditParam = new JButton("Edit Parameter"); addParams.add(reacAddParam); addParams.add(reacRemoveParam); addParams.add(reacEditParam); reacAddParam.addActionListener(this); reacRemoveParam.addActionListener(this); reacEditParam.addActionListener(this); JLabel parametersLabel = new JLabel("List Of Local Parameters:"); reacParameters = new JList(); reacParameters.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); JScrollPane scroll = new JScrollPane(); scroll.setMinimumSize(new Dimension(260, 220)); scroll.setPreferredSize(new Dimension(276, 152)); scroll.setViewportView(reacParameters); reacParams = new String[0]; changedParameters = new ArrayList<LocalParameter>(); thisReactionParams = new ArrayList<String>(); if (option.equals("OK")) { Reaction reac = bioModel.getSBMLDocument().getModel().getReaction(reactionId); if (reac.getKineticLaw()!=null) { //reac.createKineticLaw(); ListOf<LocalParameter> listOfParameters = reac.getKineticLaw().getListOfLocalParameters(); reacParams = new String[reac.getKineticLaw().getLocalParameterCount()]; for (int i = 0; i < reac.getKineticLaw().getLocalParameterCount(); i++) { /* * This code is a hack to get around a local parameter * conversion bug in libsbml */ LocalParameter pp = listOfParameters.get(i); LocalParameter parameter = new LocalParameter(bioModel.getSBMLDocument().getLevel(), bioModel.getSBMLDocument().getVersion()); parameter.setId(pp.getId()); SBMLutilities.setMetaId(parameter, pp.getMetaId()); parameter.setName(pp.getName()); parameter.setValue(pp.getValue()); parameter.setUnits(pp.getUnits()); changedParameters.add(parameter); thisReactionParams.add(parameter.getId()); String p; if (parameter.isSetUnits()) { p = parameter.getId() + " " + parameter.getValue() + " " + parameter.getUnits(); } else { p = parameter.getId() + " " + parameter.getValue(); } if (paramsOnly) { for (int j = 0; j < parameterChanges.size(); j++) { if (parameterChanges.get(j).split(" ")[0].equals(selectedReaction + "/" + parameter.getId())) { p = parameterChanges.get(j).split("/")[1]; } } } reacParams[i] = p; } } } else { // Parameter p = new Parameter(BioSim.SBML_LEVEL, // BioSim.SBML_VERSION); LocalParameter p = new LocalParameter(bioModel.getSBMLDocument().getLevel(), bioModel.getSBMLDocument().getVersion()); p.setId("kf"); p.setValue(0.1); changedParameters.add(p); // p = new Parameter(BioSim.SBML_LEVEL, BioSim.SBML_VERSION); p = new LocalParameter(bioModel.getSBMLDocument().getLevel(), bioModel.getSBMLDocument().getVersion()); p.setId("kr"); p.setValue(1.0); changedParameters.add(p); reacParams = new String[2]; reacParams[0] = "kf 0.1"; reacParams[1] = "kr 1.0"; thisReactionParams.add("kf"); thisReactionParams.add("kr"); } Utility.sort(reacParams); reacParameters.setListData(reacParams); reacParameters.setSelectedIndex(0); reacParameters.addMouseListener(this); param.add(parametersLabel, "North"); param.add(scroll, "Center"); param.add(addParams, "South"); JPanel reactantsPanel = new JPanel(new BorderLayout()); JPanel addReactants = new JPanel(); addReactant = new JButton("Add Reactant"); removeReactant = new JButton("Remove Reactant"); editReactant = new JButton("Edit Reactant"); addReactants.add(addReactant); addReactants.add(removeReactant); addReactants.add(editReactant); addReactant.addActionListener(this); removeReactant.addActionListener(this); editReactant.addActionListener(this); JLabel reactantsLabel = new JLabel("List Of Reactants:"); reactants = new JList(); reactants.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); JScrollPane scroll2 = new JScrollPane(); scroll2.setMinimumSize(new Dimension(260, 220)); scroll2.setPreferredSize(new Dimension(276, 152)); scroll2.setViewportView(reactants); reacta = new String[0]; changedReactants = new ArrayList<SpeciesReference>(); if (option.equals("OK")) { Reaction reac = bioModel.getSBMLDocument().getModel().getReaction(reactionId); ListOf<SpeciesReference> listOfReactants = reac.getListOfReactants(); reacta = new String[reac.getReactantCount()]; for (int i = 0; i < reac.getReactantCount(); i++) { SpeciesReference reactant = listOfReactants.get(i); changedReactants.add(reactant); reacta[i] = reactant.getSpecies() + " " + reactant.getStoichiometry(); } } Utility.sort(reacta); reactants.setListData(reacta); reactants.setSelectedIndex(0); reactants.addMouseListener(this); reactantsPanel.add(reactantsLabel, "North"); reactantsPanel.add(scroll2, "Center"); reactantsPanel.add(addReactants, "South"); JPanel productsPanel = new JPanel(new BorderLayout()); JPanel addProducts = new JPanel(); addProduct = new JButton("Add Product"); removeProduct = new JButton("Remove Product"); editProduct = new JButton("Edit Product"); addProducts.add(addProduct); addProducts.add(removeProduct); addProducts.add(editProduct); addProduct.addActionListener(this); removeProduct.addActionListener(this); editProduct.addActionListener(this); JLabel productsLabel = new JLabel("List Of Products:"); products = new JList(); products.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); JScrollPane scroll3 = new JScrollPane(); scroll3.setMinimumSize(new Dimension(260, 220)); scroll3.setPreferredSize(new Dimension(276, 152)); scroll3.setViewportView(products); proda = new String[0]; changedProducts = new ArrayList<SpeciesReference>(); if (option.equals("OK")) { Reaction reac = bioModel.getSBMLDocument().getModel().getReaction(reactionId); ListOf<SpeciesReference> listOfProducts = reac.getListOfProducts(); proda = new String[reac.getProductCount()]; for (int i = 0; i < reac.getProductCount(); i++) { SpeciesReference product = listOfProducts.get(i); changedProducts.add(product); this.proda[i] = product.getSpecies() + " " + product.getStoichiometry(); } } Utility.sort(proda); products.setListData(proda); products.setSelectedIndex(0); products.addMouseListener(this); productsPanel.add(productsLabel, "North"); productsPanel.add(scroll3, "Center"); productsPanel.add(addProducts, "South"); JPanel modifierPanel = new JPanel(new BorderLayout()); JPanel addModifiers = new JPanel(); addModifier = new JButton("Add Modifier"); removeModifier = new JButton("Remove Modifier"); editModifier = new JButton("Edit Modifier"); addModifiers.add(addModifier); addModifiers.add(removeModifier); addModifiers.add(editModifier); addModifier.addActionListener(this); removeModifier.addActionListener(this); editModifier.addActionListener(this); JLabel modifiersLabel = new JLabel("List Of Modifiers:"); modifiers = new JList(); modifiers.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); JScrollPane scroll5 = new JScrollPane(); scroll5.setMinimumSize(new Dimension(260, 220)); scroll5.setPreferredSize(new Dimension(276, 152)); scroll5.setViewportView(modifiers); modifierArray = new String[0]; changedModifiers = new ArrayList<ModifierSpeciesReference>(); if (option.equals("OK")) { Reaction reac = bioModel.getSBMLDocument().getModel().getReaction(reactionId); ListOf<ModifierSpeciesReference> listOfModifiers = reac.getListOfModifiers(); modifierArray = new String[reac.getModifierCount()]; for (int i = 0; i < reac.getModifierCount(); i++) { ModifierSpeciesReference modifier = listOfModifiers.get(i); changedModifiers.add(modifier); this.modifierArray[i] = modifier.getSpecies(); } } Utility.sort(modifierArray); modifiers.setListData(modifierArray); modifiers.setSelectedIndex(0); modifiers.addMouseListener(this); modifierPanel.add(modifiersLabel, "North"); modifierPanel.add(scroll5, "Center"); modifierPanel.add(addModifiers, "South"); JComboBox kineticFluxLabel = new JComboBox(new String[] {"Kinetic Law:","Flux Bounds:"}); kineticLaw = new JTextArea(); kineticLaw.setLineWrap(true); kineticLaw.setWrapStyleWord(true); useMassAction = new JButton("Use Mass Action"); clearKineticLaw = new JButton("Clear"); useMassAction.addActionListener(this); clearKineticLaw.addActionListener(this); JPanel kineticButtons = new JPanel(); kineticButtons.add(useMassAction); kineticButtons.add(clearKineticLaw); JScrollPane scroll4 = new JScrollPane(); scroll4.setMinimumSize(new Dimension(100, 100)); scroll4.setPreferredSize(new Dimension(100, 100)); scroll4.setViewportView(kineticLaw); if (option.equals("OK")) { if (bioModel.getSBMLDocument().getModel().getReaction(reactionId).getKineticLaw()!=null) { kineticFluxLabel.setSelectedIndex(0); kineticLaw.setText(bioModel.removeBooleans(bioModel.getSBMLDocument().getModel().getReaction(reactionId).getKineticLaw().getMath())); } else { kineticFluxLabel.setSelectedIndex(1); String fluxbounds = ""; for(int i = 0; i < bioModel.getSBMLFBC().getListOfFluxBounds().size(); i++){ if(bioModel.getSBMLFBC().getListOfFluxBounds().get(i).getReaction().equals(reactionId)){ if(bioModel.getSBMLFBC().getListOfFluxBounds().get(i).getOperation().toString().equals("greaterEqual")){ fluxbounds = bioModel.getSBMLFBC().getListOfFluxBounds().get(i).getValue() + "<=" + fluxbounds; if(!fluxbounds.contains(reactionId)){ fluxbounds += reactionId; } } if(bioModel.getSBMLFBC().getListOfFluxBounds().get(i).getOperation().toString().equals("lessEqual")){ fluxbounds += "<=" + bioModel.getSBMLFBC().getListOfFluxBounds().get(i).getValue(); if(!fluxbounds.contains(reactionId)){ fluxbounds = reactionId + fluxbounds; } } if(bioModel.getSBMLFBC().getListOfFluxBounds().get(i).getOperation().toString().equals("equal")){ double value = bioModel.getSBMLFBC().getListOfFluxBounds().get(i).getValue(); fluxbounds = value + "<=" + reactionId + "<=" + value; } } } kineticLaw.setText(fluxbounds); } } JPanel kineticPanel = new JPanel(new BorderLayout()); kineticPanel.add(kineticFluxLabel, "North"); kineticPanel.add(scroll4, "Center"); kineticPanel.add(kineticButtons, "South"); JPanel reactionPanel = new JPanel(new BorderLayout()); JPanel reactionPanelNorth = new JPanel(); reactionPanelNorth.setLayout(new GridLayout(3, 1)); JPanel reactionPanelNorth1 = new JPanel(); JPanel reactionPanelNorth3 = new JPanel(); JPanel reactionPanelNorth4 = new JPanel(); CiIndex = new JTextField(20); reactionPanelNorth1.add(id); reactionPanelNorth1.add(reacID); reactionPanelNorth1.add(name); reactionPanelNorth1.add(reacName); reactionPanelNorth1.add(onPortLabel); reactionPanelNorth1.add(onPort); reactionPanelNorth3.add(reactionCompLabel); reactionPanelNorth3.add(reactionComp); reactionPanelNorth3.add(new JLabel("Compartment Indices:")); reactionPanelNorth3.add(CiIndex); reactionPanelNorth4.add(reverse); reactionPanelNorth4.add(reacReverse); reactionPanelNorth4.add(fast); reactionPanelNorth4.add(reacFast); // Parse out SBOL annotations and add to SBOL field if (!paramsOnly) { // Field for annotating reaction with SBOL DNA components List<URI> sbolURIs = new LinkedList<URI>(); String sbolStrand = ""; if (option.equals("OK")) { Reaction reac = bioModel.getSBMLDocument().getModel().getReaction(reactionId); sbolStrand = AnnotationUtility.parseSBOLAnnotation(reac, sbolURIs); } sbolField = new SBOLField(sbolURIs, sbolStrand, GlobalConstants.SBOL_DNA_COMPONENT, modelEditor, 2, false); reactionPanelNorth4.add(sbolField); } reactionPanelNorth.add(reactionPanelNorth1); reactionPanelNorth.add(reactionPanelNorth3); reactionPanelNorth.add(reactionPanelNorth4); if (inSchematic) { reactionPanel.add(reactionPanelNorth, "North"); reactionPanel.add(param, "Center"); reactionPanel.add(kineticPanel, "South"); } else { JPanel reactionPanelCentral = new JPanel(new GridLayout(1, 3)); JPanel reactionPanelSouth = new JPanel(new GridLayout(1, 2)); reactionPanelCentral.add(reactantsPanel); reactionPanelCentral.add(productsPanel); reactionPanelCentral.add(modifierPanel); reactionPanelSouth.add(param); reactionPanelSouth.add(kineticPanel); reactionPanel.add(reactionPanelNorth, "North"); reactionPanel.add(reactionPanelCentral, "Center"); reactionPanel.add(reactionPanelSouth, "South"); } if (option.equals("OK")) { Reaction reac = bioModel.getSBMLDocument().getModel().getReaction(reactionId); copyReact = reac.clone(); ArraysSBasePlugin sBasePlugin = SBMLutilities.getArraysSBasePlugin(reac); String dimInID = ""; for(int i = sBasePlugin.getDimensionCount()-1; i>=0; i org.sbml.jsbml.ext.arrays.Dimension dimX = sBasePlugin.getDimensionByArrayDimension(i); dimInID += "[" + dimX.getSize() + "]"; } String freshIndex = ""; for(int i = sBasePlugin.getIndexCount()-1; i>=0; i Index indie = sBasePlugin.getIndex(i); freshIndex += "[" + SBMLutilities.myFormulaToString(indie.getMath()) + "]"; } CiIndex.setText(freshIndex); reacID.setText(reac.getId()+dimInID); selectedID = reac.getId(); reacName.setText(reac.getName()); if (bioModel.getPortByIdRef(reac.getId())!=null) { onPort.setSelected(true); } else { onPort.setSelected(false); } if (reac.getReversible()) { reacReverse.setSelectedItem("true"); } else { reacReverse.setSelectedItem("false"); } if (reac.getFast()) { reacFast.setSelectedItem("true"); } else { reacFast.setSelectedItem("false"); } if (bioModel.getSBMLDocument().getLevel() > 2) { reactionComp.setSelectedItem(reac.getCompartment()); } complex = null; production = null; if (reac.isSetSBOTerm()) { if (BioModel.isComplexReaction(reac)) { complex = reac; reacID.setEnabled(false); reacName.setEnabled(false); onPort.setEnabled(false); reacReverse.setEnabled(false); reacFast.setEnabled(false); reactionComp.setEnabled(false); reacAddParam.setEnabled(false); reacRemoveParam.setEnabled(false); reacEditParam.setEnabled(false); addProduct.setEnabled(false); removeProduct.setEnabled(false); editProduct.setEnabled(false); products.removeMouseListener(this); addModifier.setEnabled(false); removeModifier.setEnabled(false); editModifier.setEnabled(false); modifiers.removeMouseListener(this); kineticLaw.setEditable(false); clearKineticLaw.setEnabled(false); reacParameters.setEnabled(false); useMassAction.setEnabled(false); } else if (BioModel.isConstitutiveReaction(reac) || BioModel.isDegradationReaction(reac) || BioModel.isDiffusionReaction(reac)) { reacID.setEnabled(false); reacName.setEnabled(false); onPort.setEnabled(false); reacReverse.setEnabled(false); reacFast.setEnabled(false); reactionComp.setEnabled(false); reacAddParam.setEnabled(false); reacRemoveParam.setEnabled(false); reacEditParam.setEnabled(false); addReactant.setEnabled(false); removeReactant.setEnabled(false); editReactant.setEnabled(false); reactants.removeMouseListener(this); addProduct.setEnabled(false); removeProduct.setEnabled(false); editProduct.setEnabled(false); products.removeMouseListener(this); addModifier.setEnabled(false); removeModifier.setEnabled(false); editModifier.setEnabled(false); modifiers.removeMouseListener(this); kineticLaw.setEditable(false); useMassAction.setEnabled(false); clearKineticLaw.setEnabled(false); reacParameters.setEnabled(false); } else if (BioModel.isProductionReaction(reac)) { production = reac; reacID.setEnabled(false); reacName.setEnabled(false); onPort.setEnabled(false); reacReverse.setEnabled(false); reacFast.setEnabled(false); reactionComp.setEnabled(false); reacAddParam.setEnabled(false); reacRemoveParam.setEnabled(false); reacEditParam.setEnabled(false); addReactant.setEnabled(false); removeReactant.setEnabled(false); editReactant.setEnabled(false); reactants.removeMouseListener(this); kineticLaw.setEditable(false); clearKineticLaw.setEnabled(false); reacParameters.setEnabled(false); useMassAction.setEnabled(false); } } } else { String NEWreactionId = "r0"; int i = 0; while (bioModel.isSIdInUse(NEWreactionId)) { i++; NEWreactionId = "r" + i; } Reaction reac = bioModel.getSBMLDocument().getModel().getReaction(reactionId); ArraysSBasePlugin sBasePlugin = SBMLutilities.getArraysSBasePlugin(reac); String dimInID = ""; for(int i1 = 0; i1<sBasePlugin.getDimensionCount(); i1++){ org.sbml.jsbml.ext.arrays.Dimension dimX = sBasePlugin.getDimensionByArrayDimension(i1); dimInID += "[" + dimX.getSize() + "]"; } reacID.setText(NEWreactionId+dimInID); } if (paramsOnly) { reacID.setEditable(false); reacName.setEditable(false); reacReverse.setEnabled(false); reacFast.setEnabled(false); reacAddParam.setEnabled(false); reacRemoveParam.setEnabled(false); addReactant.setEnabled(false); removeReactant.setEnabled(false); editReactant.setEnabled(false); addProduct.setEnabled(false); removeProduct.setEnabled(false); editProduct.setEnabled(false); addModifier.setEnabled(false); removeModifier.setEnabled(false); editModifier.setEnabled(false); kineticLaw.setEditable(false); useMassAction.setEnabled(false); clearKineticLaw.setEnabled(false); reactionComp.setEnabled(false); onPort.setEnabled(false); } Object[] options1 = { option, "Cancel" }; int value = JOptionPane.showOptionDialog(Gui.frame, reactionPanel, "Reaction Editor", JOptionPane.YES_NO_OPTION, JOptionPane.PLAIN_MESSAGE, null, options1, options1[0]); String[] dimID = new String[]{""}; String[] dex = new String[]{""}; String[] dimensionIds = new String[]{""}; boolean error = true; while (error && value == JOptionPane.YES_OPTION) { error = false; dimID = SBMLutilities.checkSizeParameters(bioModel.getSBMLDocument(), reacID.getText(), false); if(dimID!=null){ dimensionIds = SBMLutilities.getDimensionIds("",dimID.length-1); error = SBMLutilities.checkID(bioModel.getSBMLDocument(), dimID[0].trim(), reactionId.trim(), false); } else{ error = true; } if(reactionComp.isEnabled() && !error){ SBase variable = SBMLutilities.getElementBySId(bioModel.getSBMLDocument(), (String)reactionComp.getSelectedItem()); dex = SBMLutilities.checkIndices(CiIndex.getText().trim(), variable, bioModel.getSBMLDocument(), dimensionIds, "compartment", dimID); error = (dex==null); } if (!error) { if (complex==null && production==null && kineticLaw.getText().trim().equals("")) { JOptionPane.showMessageDialog(Gui.frame, "A reaction must have a kinetic law.", "Enter A Kinetic Law", JOptionPane.ERROR_MESSAGE); error = true; } else if ((changedReactants.size() == 0) && (changedProducts.size() == 0)) { JOptionPane.showMessageDialog(Gui.frame, "A reaction must have at least one reactant or product.", "No Reactants or Products", JOptionPane.ERROR_MESSAGE); error = true; } else if(kineticFluxLabel.getSelectedItem().equals("Kinetic Law:")){ if (complex==null && production==null && SBMLutilities.myParseFormula(kineticLaw.getText().trim()) == null) { JOptionPane.showMessageDialog(Gui.frame, "Unable to parse kinetic law.", "Kinetic Law Error", JOptionPane.ERROR_MESSAGE); error = true; } else if (complex==null && production==null){ ArrayList<String> invalidKineticVars = getInvalidVariablesInReaction(kineticLaw.getText().trim(), dimensionIds, true, "", false); if (invalidKineticVars.size() > 0) { String invalid = ""; for (int i = 0; i < invalidKineticVars.size(); i++) { if (i == invalidKineticVars.size() - 1) { invalid += invalidKineticVars.get(i); } else { invalid += invalidKineticVars.get(i) + "\n"; } } String message; message = "Kinetic law contains unknown variables.\n\n" + "Unknown variables:\n" + invalid; JTextArea messageArea = new JTextArea(message); messageArea.setLineWrap(true); messageArea.setWrapStyleWord(true); messageArea.setEditable(false); JScrollPane scrolls = new JScrollPane(); scrolls.setMinimumSize(new Dimension(300, 300)); scrolls.setPreferredSize(new Dimension(300, 300)); scrolls.setViewportView(messageArea); JOptionPane.showMessageDialog(Gui.frame, scrolls, "Kinetic Law Error", JOptionPane.ERROR_MESSAGE); error = true; } if (!error) { error = SBMLutilities.checkNumFunctionArguments(bioModel.getSBMLDocument(), SBMLutilities.myParseFormula(kineticLaw.getText().trim())); } } else { error = !fluxBoundisGood(kineticLaw.getText().replaceAll("\\s",""), reactionId); } } } if(kineticFluxLabel.getSelectedItem().equals("Kinetic Law:")){ if (!error && complex==null && production==null) { if (SBMLutilities.returnsBoolean(bioModel.addBooleans(kineticLaw.getText().trim()), bioModel.getSBMLDocument().getModel())) { JOptionPane.showMessageDialog(Gui.frame, "Kinetic law must evaluate to a number.", "Number Expected", JOptionPane.ERROR_MESSAGE); error = true; } } } if (!error) { if (option.equals("OK")) { int index = reactions.getSelectedIndex(); String val = reactionId; Reaction react = bioModel.getSBMLDocument().getModel().getReaction(val); ListOf remove; long size; if (react.getKineticLaw()==null) { react.createKineticLaw(); } remove = react.getKineticLaw().getListOfLocalParameters(); size = react.getKineticLaw().getLocalParameterCount(); for (int i = 0; i < size; i++) { remove.remove(0); } for (int i = 0; i < changedParameters.size(); i++) { react.getKineticLaw().addLocalParameter(changedParameters.get(i)); } remove = react.getListOfProducts(); size = react.getProductCount(); for (int i = 0; i < size; i++) { remove.remove(0); } for (int i = 0; i < changedProducts.size(); i++) { react.addProduct(changedProducts.get(i)); } remove = react.getListOfModifiers(); size = react.getModifierCount(); for (int i = 0; i < size; i++) { remove.remove(0); } for (int i = 0; i < changedModifiers.size(); i++) { react.addModifier(changedModifiers.get(i)); } remove = react.getListOfReactants(); size = react.getReactantCount(); for (int i = 0; i < size; i++) { remove.remove(0); } for (int i = 0; i < changedReactants.size(); i++) { react.addReactant(changedReactants.get(i)); } if (reacReverse.getSelectedItem().equals("true")) { react.setReversible(true); } else { react.setReversible(false); } if (bioModel.getSBMLDocument().getLevel() > 2) { react.setCompartment((String) reactionComp.getSelectedItem()); } if (reacFast.getSelectedItem().equals("true")) { react.setFast(true); } else { react.setFast(false); } react.setId(dimID[0].trim()); react.setName(reacName.getText().trim()); Port port = bioModel.getPortByIdRef(val); if (port!=null) { if (onPort.isSelected()) { port.setId(GlobalConstants.SBMLREACTION+"__"+react.getId()); port.setIdRef(react.getId()); } else { bioModel.getSBMLCompModel().removePort(port); } } else { if (onPort.isSelected()) { port = bioModel.getSBMLCompModel().createPort(); port.setId(GlobalConstants.SBMLREACTION+"__"+react.getId()); port.setIdRef(react.getId()); } } if(kineticFluxLabel.getSelectedItem().equals("Kinetic Law:")){ if (complex==null && production==null) { react.getKineticLaw().setMath(bioModel.addBooleans(kineticLaw.getText().trim())); } else if (complex!=null) { react.getKineticLaw().setMath(SBMLutilities.myParseFormula(BioModel.createComplexKineticLaw(complex))); } else { react.getKineticLaw().setMath(SBMLutilities.myParseFormula(BioModel.createProductionKineticLaw(production))); } error = checkKineticLawUnits(react.getKineticLaw()); int i = 0; while (i < bioModel.getSBMLFBC().getListOfFluxBounds().size()) { if(bioModel.getSBMLFBC().getListOfFluxBounds().get(i).getReaction().equals(reactionId)){ bioModel.getSBMLFBC().removeFluxBound(i); } else { i++; } } } else{ react.unsetKineticLaw(); int i = 0; while(i < bioModel.getSBMLFBC().getListOfFluxBounds().size()){ if(bioModel.getSBMLFBC().getListOfFluxBounds().get(i).getReaction().equals(reactionId)){ bioModel.getSBMLFBC().removeFluxBound(i); } else { i++; } } if(kineticLaw.getText().contains("<=")){ String[] userInput = kineticLaw.getText().replaceAll("\\s","").split("<="); if (userInput.length==3) { double greaterValue = Double.parseDouble(userInput[0]); FluxBound fxGreater = bioModel.getSBMLFBC().createFluxBound(); fxGreater.setOperation(FluxBound.Operation.GREATER_EQUAL); fxGreater.setValue(greaterValue); fxGreater.setReaction(reactionId); double lessValue = Double.parseDouble(userInput[2]); FluxBound fxLess = bioModel.getSBMLFBC().createFluxBound(); fxLess.setOperation(FluxBound.Operation.LESS_EQUAL); fxLess.setValue(lessValue); fxLess.setReaction(reactionId); } else { try{ double lessValue = Double.parseDouble(userInput[1]); FluxBound fxLess = bioModel.getSBMLFBC().createFluxBound(); fxLess.setOperation(FluxBound.Operation.LESS_EQUAL); fxLess.setValue(lessValue); fxLess.setReaction(reactionId); } catch(Exception e){ double greaterValue = Double.parseDouble(userInput[0]); FluxBound fxGreater = bioModel.getSBMLFBC().createFluxBound(); fxGreater.setOperation(FluxBound.Operation.GREATER_EQUAL); fxGreater.setValue(greaterValue); fxGreater.setReaction(reactionId); } } } else if(kineticLaw.getText().contains(">=")){ String[] userInput = kineticLaw.getText().replaceAll("\\s","").split(">="); if (userInput.length==3) { double greaterValue = Double.parseDouble(userInput[2]); FluxBound fxGreater = bioModel.getSBMLFBC().createFluxBound(); fxGreater.setOperation(FluxBound.Operation.GREATER_EQUAL); fxGreater.setValue(greaterValue); fxGreater.setReaction(reactionId); double lessValue = Double.parseDouble(userInput[0]); FluxBound fxLess = bioModel.getSBMLFBC().createFluxBound(); fxLess.setOperation(FluxBound.Operation.LESS_EQUAL); fxLess.setValue(lessValue); fxLess.setReaction(reactionId); } else { try{ double greaterValue = Double.parseDouble(userInput[1]); FluxBound fxGreater = bioModel.getSBMLFBC().createFluxBound(); fxGreater.setOperation(FluxBound.Operation.GREATER_EQUAL); fxGreater.setValue(greaterValue); fxGreater.setReaction(reactionId); } catch(Exception e){ double lessValue = Double.parseDouble(userInput[0]); FluxBound fxLess = bioModel.getSBMLFBC().createFluxBound(); fxLess.setOperation(FluxBound.Operation.LESS_EQUAL); fxLess.setValue(lessValue); fxLess.setReaction(reactionId); } } } else{ String[] userInput = kineticLaw.getText().replaceAll("\\s","").split("="); FluxBound fxEqual = bioModel.getSBMLFBC().createFluxBound(); fxEqual.setOperation(FluxBound.Operation.EQUAL); fxEqual.setReaction(reactionId); if(userInput[0].equals(reactionId)){ fxEqual.setValue(Double.parseDouble(userInput[1])); } else{ fxEqual.setValue(Double.parseDouble(userInput[0])); } } } if (!error) { error = SBMLutilities.checkCycles(bioModel.getSBMLDocument()); if (error) { JOptionPane.showMessageDialog(Gui.frame, "Cycle detected within initial assignments, assignment rules, and rate laws.", "Cycle Detected", JOptionPane.ERROR_MESSAGE); } } if (!error) { if (index >= 0) { if (!paramsOnly) { reacts[index] = dimID[0]; } reactions.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); reacts = Utility.getList(reacts, reactions); reactions.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); Utility.sort(reacts); reactions.setListData(reacts); reactions.setSelectedIndex(index); } } else { changedParameters = new ArrayList<LocalParameter>(); ListOf<LocalParameter> listOfParameters = react.getKineticLaw().getListOfLocalParameters(); for (int i = 0; i < react.getKineticLaw().getLocalParameterCount(); i++) { LocalParameter parameter = listOfParameters.get(i); changedParameters.add(new LocalParameter(parameter)); } changedProducts = new ArrayList<SpeciesReference>(); ListOf<SpeciesReference> listOfProducts = react.getListOfProducts(); for (int i = 0; i < react.getProductCount(); i++) { SpeciesReference product = listOfProducts.get(i); changedProducts.add(product); } changedReactants = new ArrayList<SpeciesReference>(); ListOf<SpeciesReference> listOfReactants = react.getListOfReactants(); for (int i = 0; i < react.getReactantCount(); i++) { SpeciesReference reactant = listOfReactants.get(i); changedReactants.add(reactant); } changedModifiers = new ArrayList<ModifierSpeciesReference>(); ListOf<ModifierSpeciesReference> listOfModifiers = react.getListOfModifiers(); for (int i = 0; i < react.getModifierCount(); i++) { ModifierSpeciesReference modifier = listOfModifiers.get(i); changedModifiers.add(modifier); } } // Handle SBOL data if (!error && inSchematic && !paramsOnly) { if (!error) { // Add SBOL annotation to reaction if (sbolField.getSBOLURIs().size() > 0) { SBOLAnnotation sbolAnnot = new SBOLAnnotation(react.getMetaId(), sbolField.getSBOLURIs(), sbolField.getSBOLStrand()); AnnotationUtility.setSBOLAnnotation(react, sbolAnnot); } else AnnotationUtility.removeSBOLAnnotation(react); } } // TODO: Scott - change for Plugin writing if(!error){ ArraysSBasePlugin sBasePlugin = SBMLutilities.getArraysSBasePlugin(react); sBasePlugin.unsetListOfDimensions(); for(int i = 0; i<dimID.length-1; i++){ org.sbml.jsbml.ext.arrays.Dimension dimX = sBasePlugin.createDimension(dimensionIds[i]); dimX.setSize(dimID[i+1]); dimX.setArrayDimension(i); } // Add the indices sBasePlugin.unsetListOfIndices(); for(int i = 0; i<dex.length-1; i++){ Index indexRule = new Index(); indexRule.setArrayDimension(i); indexRule.setReferencedAttribute("variable"); ASTNode indexMath = SBMLutilities.myParseFormula(dex[i+1]); indexRule.setMath(indexMath); sBasePlugin.addIndex(indexRule); } } } else { Reaction react = bioModel.getSBMLDocument().getModel().createReaction(); int index = reactions.getSelectedIndex(); if(kineticFluxLabel.getSelectedItem().equals("Kinetic Law:")){ react.createKineticLaw(); for (int i = 0; i < changedParameters.size(); i++) { react.getKineticLaw().addLocalParameter(changedParameters.get(i)); } } for (int i = 0; i < changedProducts.size(); i++) { react.addProduct(changedProducts.get(i)); } for (int i = 0; i < changedModifiers.size(); i++) { react.addModifier(changedModifiers.get(i)); } for (int i = 0; i < changedReactants.size(); i++) { react.addReactant(changedReactants.get(i)); } if (reacReverse.getSelectedItem().equals("true")) { react.setReversible(true); } else { react.setReversible(false); } if (reacFast.getSelectedItem().equals("true")) { react.setFast(true); } else { react.setFast(false); } if (bioModel.getSBMLDocument().getLevel() > 2) { react.setCompartment((String) reactionComp.getSelectedItem()); } react.setId(dimID[0]); react.setName(reacName.getText().trim()); if (onPort.isSelected()) { Port port = bioModel.getSBMLCompModel().createPort(); port.setId(GlobalConstants.SBMLREACTION+"__"+react.getId()); port.setIdRef(react.getId()); } if(kineticFluxLabel.getSelectedItem().equals("Kinetic Law:")){ if (complex==null && production==null) { react.getKineticLaw().setMath(bioModel.addBooleans(kineticLaw.getText().trim())); } else if (complex!=null) { react.getKineticLaw().setMath(SBMLutilities.myParseFormula(BioModel.createComplexKineticLaw(complex))); } else { react.getKineticLaw().setMath(SBMLutilities.myParseFormula(BioModel.createProductionKineticLaw(production))); } error = checkKineticLawUnits(react.getKineticLaw()); } else{ error = !fluxBoundisGood(kineticLaw.getText().replaceAll("\\s",""), reactionId); } if (!error) { error = SBMLutilities.checkCycles(bioModel.getSBMLDocument()); if (error) { JOptionPane.showMessageDialog(Gui.frame, "Cycle detected within initial assignments, assignment rules, and rate laws.", "Cycle Detected", JOptionPane.ERROR_MESSAGE); } } if (!error) { JList add = new JList(); Object[] adding = { dimID[0] }; add.setListData(adding); add.setSelectedIndex(0); reactions.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); adding = Utility.add(reacts, reactions, add); reacts = new String[adding.length]; for (int i = 0; i < adding.length; i++) { reacts[i] = (String) adding[i]; } Utility.sort(reacts); reactions.setListData(reacts); reactions.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); if (bioModel.getSBMLDocument().getModel().getReactionCount() == 1) { reactions.setSelectedIndex(0); } else { reactions.setSelectedIndex(index); } } else { removeTheReaction(bioModel, dimID[0]); } // TODO: Scott - change for Plugin writing if(!error){ ArraysSBasePlugin sBasePlugin = SBMLutilities.getArraysSBasePlugin(react); sBasePlugin.unsetListOfDimensions(); for(int i = 0; i<dimID.length-1; i++){ org.sbml.jsbml.ext.arrays.Dimension dimX = sBasePlugin.createDimension(dimensionIds[i]); dimX.setSize(dimID[i+1]); dimX.setArrayDimension(i); } // Add the indices sBasePlugin.unsetListOfIndices(); for(int i = 0; i<dex.length-1; i++){ Index indexRule = new Index(); indexRule.setArrayDimension(i); indexRule.setReferencedAttribute("variable"); ASTNode indexMath = SBMLutilities.myParseFormula(dex[i+1]); indexRule.setMath(indexMath); sBasePlugin.addIndex(indexRule); } } } modelEditor.setDirty(true); bioModel.makeUndoPoint(); } if (error) { value = JOptionPane.showOptionDialog(Gui.frame, reactionPanel, "Reaction Editor", JOptionPane.YES_NO_OPTION, JOptionPane.PLAIN_MESSAGE, null, options1, options1[0]); } } if (value == JOptionPane.NO_OPTION) { if (option.equals("OK")) { String reactId = reactionId; removeTheReaction(bioModel, reactId); bioModel.getSBMLDocument().getModel().addReaction(copyReact); } return; } } /** * Find invalid reaction variables in a formula */ private ArrayList<String> getInvalidVariablesInReaction(String formula, String[] dimensionIds, boolean isReaction, String arguments, boolean isFunction) { ArrayList<String> validVars = new ArrayList<String>(); ArrayList<String> invalidVars = new ArrayList<String>(); Model model = bioModel.getSBMLDocument().getModel(); for (int i = 0; i < bioModel.getSBMLDocument().getModel().getFunctionDefinitionCount(); i++) { validVars.add(model.getFunctionDefinition(i).getId()); } if (isReaction) { for (int i = 0; i < changedParameters.size(); i++) { validVars.add(changedParameters.get(i).getId()); } for (int i = 0; i < changedReactants.size(); i++) { validVars.add(changedReactants.get(i).getSpecies()); validVars.add(changedReactants.get(i).getId()); } for (int i = 0; i < changedProducts.size(); i++) { validVars.add(changedProducts.get(i).getSpecies()); validVars.add(changedProducts.get(i).getId()); } for (int i = 0; i < changedModifiers.size(); i++) { validVars.add(changedModifiers.get(i).getSpecies()); } if (dimensionIds != null) { for (int i = 0; i < dimensionIds.length; i++) { validVars.add(dimensionIds[i]); } } } else if (!isFunction) { for (int i = 0; i < bioModel.getSBMLDocument().getModel().getSpeciesCount(); i++) { validVars.add(model.getSpecies(i).getId()); } } if (isFunction) { String[] args = arguments.split(" |\\,"); for (int i = 0; i < args.length; i++) { validVars.add(args[i]); } } else { for (int i = 0; i < bioModel.getSBMLDocument().getModel().getCompartmentCount(); i++) { if (bioModel.getSBMLDocument().getLevel() > 2 || (model.getCompartment(i).getSpatialDimensions() != 0)) { validVars.add(model.getCompartment(i).getId()); } } for (int i = 0; i < bioModel.getSBMLDocument().getModel().getParameterCount(); i++) { validVars.add(model.getParameter(i).getId()); } for (int i = 0; i < bioModel.getSBMLDocument().getModel().getReactionCount(); i++) { Reaction reaction = model.getReaction(i); validVars.add(reaction.getId()); for (int j = 0; j < reaction.getReactantCount(); j++) { SpeciesReference reactant = reaction.getReactant(j); if ((reactant.isSetId()) && (!reactant.getId().equals(""))) { validVars.add(reactant.getId()); } } for (int j = 0; j < reaction.getProductCount(); j++) { SpeciesReference product = reaction.getProduct(j); if ((product.isSetId()) && (!product.getId().equals(""))) { validVars.add(product.getId()); } } } String[] kindsL3V1 = { "ampere", "avogadro", "becquerel", "candela", "celsius", "coulomb", "dimensionless", "farad", "gram", "gray", "henry", "hertz", "item", "joule", "katal", "kelvin", "kilogram", "litre", "lumen", "lux", "metre", "mole", "newton", "ohm", "pascal", "radian", "second", "siemens", "sievert", "steradian", "tesla", "volt", "watt", "weber" }; for (int i = 0; i < kindsL3V1.length; i++) { validVars.add(kindsL3V1[i]); } for (int i = 0; i < model.getUnitDefinitionCount(); i++) { validVars.add(model.getUnitDefinition(i).getId()); } } String[] splitLaw = formula.split(" |\\(|\\)|\\,|\\*|\\+|\\/|\\-|>|=|<|\\^|%|&|\\||!|\\[|\\]|\\{|\\}"); for (int i = 0; i < splitLaw.length; i++) { if (splitLaw[i].equals("abs") || splitLaw[i].equals("arccos") || splitLaw[i].equals("arccosh") || splitLaw[i].equals("arcsin") || splitLaw[i].equals("arcsinh") || splitLaw[i].equals("arctan") || splitLaw[i].equals("arctanh") || splitLaw[i].equals("arccot") || splitLaw[i].equals("arccoth") || splitLaw[i].equals("arccsc") || splitLaw[i].equals("arccsch") || splitLaw[i].equals("arcsec") || splitLaw[i].equals("arcsech") || splitLaw[i].equals("acos") || splitLaw[i].equals("acosh") || splitLaw[i].equals("asin") || splitLaw[i].equals("asinh") || splitLaw[i].equals("atan") || splitLaw[i].equals("atanh") || splitLaw[i].equals("acot") || splitLaw[i].equals("acoth") || splitLaw[i].equals("acsc") || splitLaw[i].equals("acsch") || splitLaw[i].equals("asec") || splitLaw[i].equals("asech") || splitLaw[i].equals("cos") || splitLaw[i].equals("cosh") || splitLaw[i].equals("cot") || splitLaw[i].equals("coth") || splitLaw[i].equals("csc") || splitLaw[i].equals("csch") || splitLaw[i].equals("ceil") || splitLaw[i].equals("factorial") || splitLaw[i].equals("exp") || splitLaw[i].equals("floor") || splitLaw[i].equals("ln") || splitLaw[i].equals("log") || splitLaw[i].equals("sqr") || splitLaw[i].equals("log10") || splitLaw[i].equals("pow") || splitLaw[i].equals("sqrt") || splitLaw[i].equals("root") || splitLaw[i].equals("piecewise") || splitLaw[i].equals("sec") || splitLaw[i].equals("sech") || splitLaw[i].equals("sin") || splitLaw[i].equals("sinh") || splitLaw[i].equals("tan") || splitLaw[i].equals("tanh") || splitLaw[i].equals("") || splitLaw[i].equals("and") || splitLaw[i].equals("or") || splitLaw[i].equals("xor") || splitLaw[i].equals("not") || splitLaw[i].equals("eq") || splitLaw[i].equals("geq") || splitLaw[i].equals("leq") || splitLaw[i].equals("gt") || splitLaw[i].equals("neq") || splitLaw[i].equals("lt") || splitLaw[i].equals("delay") || splitLaw[i].equals("t") || splitLaw[i].equals("time") || splitLaw[i].equals("true") || splitLaw[i].equals("false") || splitLaw[i].equals("pi") || splitLaw[i].equals("exponentiale") || ((bioModel.getSBMLDocument().getLevel() > 2) && (splitLaw[i].equals("avogadro")))) { } else { String temp = splitLaw[i]; if (splitLaw[i].substring(splitLaw[i].length() - 1, splitLaw[i].length()).equals("e")) { temp = splitLaw[i].substring(0, splitLaw[i].length() - 1); } try { Double.parseDouble(temp); } catch (Exception e1) { if (!validVars.contains(splitLaw[i])) { invalidVars.add(splitLaw[i]); } } } } return invalidVars; } /** * Creates a frame used to edit reactions parameters or create new ones. */ private void reacParametersEditor(BioModel bioModel,String option) { if (option.equals("OK") && reacParameters.getSelectedIndex() == -1) { JOptionPane.showMessageDialog(Gui.frame, "No parameter selected.", "Must Select A Parameter", JOptionPane.ERROR_MESSAGE); return; } JPanel parametersPanel; if (paramsOnly) { parametersPanel = new JPanel(new GridLayout(7, 2)); } else { parametersPanel = new JPanel(new GridLayout(5, 2)); } JLabel idLabel = new JLabel("ID:"); JLabel nameLabel = new JLabel("Name:"); JLabel valueLabel = new JLabel("Value:"); JLabel unitsLabel = new JLabel("Units:"); JLabel onPortLabel = new JLabel("Is Mapped to a Port:"); paramOnPort = new JCheckBox(); reacParamID = new JTextField(); reacParamName = new JTextField(); reacParamValue = new JTextField(); reacParamUnits = new JComboBox(); reacParamUnits.addItem("( none )"); Model model = bioModel.getSBMLDocument().getModel(); ListOf<UnitDefinition> listOfUnits = model.getListOfUnitDefinitions(); String[] units = new String[model.getUnitDefinitionCount()]; for (int i = 0; i < model.getUnitDefinitionCount(); i++) { UnitDefinition unit = listOfUnits.get(i); units[i] = unit.getId(); // GET OTHER THINGS } for (int i = 0; i < units.length; i++) { if (bioModel.getSBMLDocument().getLevel() > 2 || (!units[i].equals("substance") && !units[i].equals("volume") && !units[i].equals("area") && !units[i].equals("length") && !units[i] .equals("time"))) { reacParamUnits.addItem(units[i]); } } String[] unitIdsL2V4 = { "substance", "volume", "area", "length", "time", "ampere", "becquerel", "candela", "celsius", "coulomb", "dimensionless", "farad", "gram", "gray", "henry", "hertz", "item", "joule", "katal", "kelvin", "kilogram", "litre", "lumen", "lux", "metre", "mole", "newton", "ohm", "pascal", "radian", "second", "siemens", "sievert", "steradian", "tesla", "volt", "watt", "weber" }; String[] unitIdsL3V1 = { "ampere", "avogadro", "becquerel", "candela", "celsius", "coulomb", "dimensionless", "farad", "gram", "gray", "henry", "hertz", "item", "joule", "katal", "kelvin", "kilogram", "litre", "lumen", "lux", "metre", "mole", "newton", "ohm", "pascal", "radian", "second", "siemens", "sievert", "steradian", "tesla", "volt", "watt", "weber" }; String[] unitIds; if (bioModel.getSBMLDocument().getLevel() < 3) { unitIds = unitIdsL2V4; } else { unitIds = unitIdsL3V1; } for (int i = 0; i < unitIds.length; i++) { reacParamUnits.addItem(unitIds[i]); } String[] list = { "Original", "Modified" }; String[] list1 = { "1", "2" }; final JComboBox type = new JComboBox(list); final JTextField start = new JTextField(); final JTextField stop = new JTextField(); final JTextField step = new JTextField(); final JComboBox level = new JComboBox(list1); final JButton sweep = new JButton("Sweep"); sweep.addActionListener(new ActionListener() { @Override public void actionPerformed(ActionEvent e) { Object[] options = { "Ok", "Close" }; JPanel p = new JPanel(new GridLayout(4, 2)); JLabel startLabel = new JLabel("Start:"); JLabel stopLabel = new JLabel("Stop:"); JLabel stepLabel = new JLabel("Step:"); JLabel levelLabel = new JLabel("Level:"); p.add(startLabel); p.add(start); p.add(stopLabel); p.add(stop); p.add(stepLabel); p.add(step); p.add(levelLabel); p.add(level); int i = JOptionPane.showOptionDialog(Gui.frame, p, "Sweep", JOptionPane.YES_NO_OPTION, JOptionPane.PLAIN_MESSAGE, null, options, options[0]); if (i == JOptionPane.YES_OPTION) { double startVal = 0.0; double stopVal = 0.0; double stepVal = 0.0; try { startVal = Double.parseDouble(start.getText().trim()); stopVal = Double.parseDouble(stop.getText().trim()); stepVal = Double.parseDouble(step.getText().trim()); } catch (Exception e1) { } reacParamValue.setText("(" + startVal + "," + stopVal + "," + stepVal + "," + level.getSelectedItem() + ")"); } } }); if (paramsOnly) { reacParamID.setEditable(false); reacParamName.setEditable(false); reacParamValue.setEnabled(false); reacParamUnits.setEnabled(false); sweep.setEnabled(false); paramOnPort.setEnabled(false); } String selectedID = ""; if (option.equals("OK")) { String v = ((String) reacParameters.getSelectedValue()).split(" ")[0]; LocalParameter paramet = null; for (LocalParameter p : changedParameters) { if (p.getId().equals(v)) { paramet = p; } } if (paramet==null) return; reacParamID.setText(paramet.getId()); selectedID = paramet.getId(); reacParamName.setText(paramet.getName()); reacParamValue.setText("" + paramet.getValue()); if (paramet.isSetUnits()) { reacParamUnits.setSelectedItem(paramet.getUnits()); } if (bioModel.getPortByMetaIdRef(paramet.getMetaId())!=null) { paramOnPort.setSelected(true); } else { paramOnPort.setSelected(false); } if (paramsOnly && (((String) reacParameters.getSelectedValue()).contains("Modified")) || (((String) reacParameters.getSelectedValue()).contains("Custom")) || (((String) reacParameters.getSelectedValue()).contains("Sweep"))) { type.setSelectedItem("Modified"); sweep.setEnabled(true); reacParamValue.setText(((String) reacParameters.getSelectedValue()).split(" ")[((String) reacParameters.getSelectedValue()) .split(" ").length - 1]); reacParamValue.setEnabled(true); reacParamUnits.setEnabled(false); if (reacParamValue.getText().trim().startsWith("(")) { try { start.setText((reacParamValue.getText().trim()).split(",")[0].substring(1).trim()); stop.setText((reacParamValue.getText().trim()).split(",")[1].trim()); step.setText((reacParamValue.getText().trim()).split(",")[2].trim()); int lev = Integer.parseInt((reacParamValue.getText().trim()).split(",")[3].replace(")", "").trim()); if (lev == 1) { level.setSelectedIndex(0); } else { level.setSelectedIndex(1); } } catch (Exception e1) { } } } } parametersPanel.add(idLabel); parametersPanel.add(reacParamID); parametersPanel.add(nameLabel); parametersPanel.add(reacParamName); if (paramsOnly) { JLabel typeLabel = new JLabel("Value Type:"); type.addActionListener(new ActionListener() { @Override public void actionPerformed(ActionEvent e) { if (!((String) type.getSelectedItem()).equals("Original")) { sweep.setEnabled(true); reacParamValue.setEnabled(true); reacParamUnits.setEnabled(false); } else { sweep.setEnabled(false); reacParamValue.setEnabled(false); reacParamUnits.setEnabled(false); SBMLDocument d = SBMLutilities.readSBML(file); KineticLaw KL = d.getModel().getReaction(selectedReaction).getKineticLaw(); ListOf<LocalParameter> list = KL.getListOfLocalParameters(); int number = -1; for (int i = 0; i < KL.getLocalParameterCount(); i++) { if (list.get(i).getId().equals(((String) reacParameters.getSelectedValue()).split(" ")[0])) { number = i; } } reacParamValue.setText(d.getModel().getReaction(selectedReaction).getKineticLaw() .getLocalParameter(number).getValue() + ""); if (d.getModel().getReaction(selectedReaction).getKineticLaw().getLocalParameter(number) .isSetUnits()) { reacParamUnits.setSelectedItem(d.getModel().getReaction(selectedReaction) .getKineticLaw().getLocalParameter(number).getUnits()); } reacParamValue.setText(d.getModel().getReaction(selectedReaction).getKineticLaw().getLocalParameter(number).getValue() + ""); } } }); parametersPanel.add(typeLabel); parametersPanel.add(type); } parametersPanel.add(valueLabel); parametersPanel.add(reacParamValue); if (paramsOnly) { parametersPanel.add(new JLabel()); parametersPanel.add(sweep); } parametersPanel.add(unitsLabel); parametersPanel.add(reacParamUnits); parametersPanel.add(onPortLabel); parametersPanel.add(paramOnPort); Object[] options = { option, "Cancel" }; int value = JOptionPane.showOptionDialog(Gui.frame, parametersPanel, "Parameter Editor", JOptionPane.YES_NO_OPTION, JOptionPane.PLAIN_MESSAGE, null, options, options[0]); boolean error = true; while (error && value == JOptionPane.YES_OPTION) { error = SBMLutilities.checkID(bioModel.getSBMLDocument(), reacParamID.getText().trim(), selectedID, true); if (!error) { if (thisReactionParams.contains(reacParamID.getText().trim()) && (!reacParamID.getText().trim().equals(selectedID))) { JOptionPane.showMessageDialog(Gui.frame, "ID is not unique.", "ID Not Unique", JOptionPane.ERROR_MESSAGE); error = true; } } if (!error) { double val = 0; if (reacParamValue.getText().trim().startsWith("(") && reacParamValue.getText().trim().endsWith(")")) { try { Double.parseDouble((reacParamValue.getText().trim()).split(",")[0].substring(1).trim()); Double.parseDouble((reacParamValue.getText().trim()).split(",")[1].trim()); Double.parseDouble((reacParamValue.getText().trim()).split(",")[2].trim()); int lev = Integer.parseInt((reacParamValue.getText().trim()).split(",")[3].replace(")", "").trim()); if (lev != 1 && lev != 2) { error = true; JOptionPane.showMessageDialog(Gui.frame, "The level can only be 1 or 2.", "Error", JOptionPane.ERROR_MESSAGE); } } catch (Exception e1) { error = true; JOptionPane.showMessageDialog(Gui.frame, "Invalid sweeping parameters.", "Error", JOptionPane.ERROR_MESSAGE); } } else { try { val = Double.parseDouble(reacParamValue.getText().trim()); } catch (Exception e1) { JOptionPane .showMessageDialog(Gui.frame, "The value must be a real number.", "Enter A Valid Value", JOptionPane.ERROR_MESSAGE); error = true; } } if (!error) { String unit = (String) reacParamUnits.getSelectedItem(); String param = ""; if (paramsOnly && !((String) type.getSelectedItem()).equals("Original")) { int index = reacParameters.getSelectedIndex(); String[] splits = reacParams[index].split(" "); for (int i = 0; i < splits.length - 2; i++) { param += splits[i] + " "; } if (!splits[splits.length - 2].equals("Modified") && !splits[splits.length - 2].equals("Custom") && !splits[splits.length - 2].equals("Sweep")) { param += splits[splits.length - 2] + " " + splits[splits.length - 1] + " "; } if (reacParamValue.getText().trim().startsWith("(") && reacParamValue.getText().trim().endsWith(")")) { double startVal = Double.parseDouble((reacParamValue.getText().trim()).split(",")[0].substring(1).trim()); double stopVal = Double.parseDouble((reacParamValue.getText().trim()).split(",")[1].trim()); double stepVal = Double.parseDouble((reacParamValue.getText().trim()).split(",")[2].trim()); int lev = Integer.parseInt((reacParamValue.getText().trim()).split(",")[3].replace(")", "").trim()); param += "Sweep (" + startVal + "," + stopVal + "," + stepVal + "," + lev + ")"; } else { param += "Modified " + val; } } else { if (unit.equals("( none )")) { param = reacParamID.getText().trim() + " " + val; } else { param = reacParamID.getText().trim() + " " + val + " " + unit; } } if (option.equals("OK")) { int index = reacParameters.getSelectedIndex(); String v = ((String) reacParameters.getSelectedValue()).split(" ")[0]; LocalParameter paramet = null; for (LocalParameter p : changedParameters) { if (p.getId().equals(v)) { paramet = p; } } if (paramet==null) return; reacParameters.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); reacParams = Utility.getList(reacParams, reacParameters); reacParameters.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); paramet.setId(reacParamID.getText().trim()); paramet.setName(reacParamName.getText().trim()); SBMLutilities.setMetaId(paramet, reacID.getText()+"___"+reacParamID.getText().trim()); for (int i = 0; i < thisReactionParams.size(); i++) { if (thisReactionParams.get(i).equals(v)) { thisReactionParams.set(i, reacParamID.getText().trim()); } } paramet.setValue(val); if (unit.equals("( none )")) { paramet.unsetUnits(); } else { paramet.setUnits(unit); } reacParams[index] = param; Utility.sort(reacParams); reacParameters.setListData(reacParams); reacParameters.setSelectedIndex(index); if (paramsOnly) { int remove = -1; for (int i = 0; i < parameterChanges.size(); i++) { if (parameterChanges.get(i).split(" ")[0].equals(selectedReaction + "/" + reacParamID.getText().trim())) { remove = i; } } String reacValue = selectedReaction; int index1 = reactions.getSelectedIndex(); if (remove != -1) { parameterChanges.remove(remove); reactions.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); reacts = Utility.getList(reacts, reactions); reactions.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); reacts[index1] = reacValue.split(" ")[0]; Utility.sort(reacts); reactions.setListData(reacts); reactions.setSelectedIndex(index1); } if (!((String) type.getSelectedItem()).equals("Original")) { parameterChanges.add(reacValue + "/" + param); reactions.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); reacts = Utility.getList(reacts, reactions); reactions.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); reacts[index1] = reacValue + " Modified"; Utility.sort(reacts); reactions.setListData(reacts); reactions.setSelectedIndex(index1); } } else { kineticLaw.setText(SBMLutilities.updateFormulaVar(kineticLaw.getText().trim(), v, reacParamID.getText().trim())); } Port port = bioModel.getPortByMetaIdRef(paramet.getMetaId()); if (port!=null) { if (paramOnPort.isSelected()) { port.setId(GlobalConstants.LOCALPARAMETER+"__"+paramet.getMetaId()); port.setMetaIdRef(paramet.getMetaId()); } else { bioModel.getSBMLCompModel().removePort(port); } } else { if (paramOnPort.isSelected()) { port = bioModel.getSBMLCompModel().createPort(); port.setId(GlobalConstants.LOCALPARAMETER+"__"+paramet.getMetaId()); port.setMetaIdRef(paramet.getMetaId()); } } } else { int index = reacParameters.getSelectedIndex(); // Parameter paramet = new Parameter(BioSim.SBML_LEVEL, // BioSim.SBML_VERSION); LocalParameter paramet = new LocalParameter(bioModel.getSBMLDocument().getLevel(), bioModel.getSBMLDocument().getVersion()); changedParameters.add(paramet); paramet.setId(reacParamID.getText().trim()); paramet.setName(reacParamName.getText().trim()); SBMLutilities.setMetaId(paramet, reacID.getText()+"___"+reacParamID.getText().trim()); thisReactionParams.add(reacParamID.getText().trim()); paramet.setValue(val); if (!unit.equals("( none )")) { paramet.setUnits(unit); } if (paramOnPort.isSelected()) { Port port = bioModel.getSBMLCompModel().createPort(); port.setId(GlobalConstants.LOCALPARAMETER+"__"+paramet.getMetaId()); port.setMetaIdRef(paramet.getMetaId()); } JList add = new JList(); Object[] adding = { param }; add.setListData(adding); add.setSelectedIndex(0); reacParameters.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); adding = Utility.add(reacParams, reacParameters, add); reacParams = new String[adding.length]; for (int i = 0; i < adding.length; i++) { reacParams[i] = (String) adding[i]; } Utility.sort(reacParams); reacParameters.setListData(reacParams); reacParameters.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); try { if (bioModel.getSBMLDocument().getModel().getReaction(selectedReaction).getKineticLaw() .getLocalParameterCount() == 1) { reacParameters.setSelectedIndex(0); } else { reacParameters.setSelectedIndex(index); } } catch (Exception e2) { reacParameters.setSelectedIndex(0); } } modelEditor.setDirty(true); bioModel.makeUndoPoint(); } } if (error) { value = JOptionPane.showOptionDialog(Gui.frame, parametersPanel, "Parameter Editor", JOptionPane.YES_NO_OPTION, JOptionPane.PLAIN_MESSAGE, null, options, options[0]); } } if (value == JOptionPane.NO_OPTION) { return; } } private void addLocalParameter(String id,double val) { LocalParameter paramet = new LocalParameter(bioModel.getSBMLDocument().getLevel(), bioModel.getSBMLDocument().getVersion()); changedParameters.add(paramet); paramet.setId(id); paramet.setName(id); SBMLutilities.setMetaId(paramet, reacID.getText()+"___"+id); thisReactionParams.add(id); paramet.setValue(val); JList add = new JList(); String param = id + " " + val; Object[] adding = { param }; add.setListData(adding); add.setSelectedIndex(0); reacParameters.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); adding = Utility.add(reacParams, reacParameters, add); reacParams = new String[adding.length]; for (int i = 0; i < adding.length; i++) { reacParams[i] = (String) adding[i]; } Utility.sort(reacParams); reacParameters.setListData(reacParams); reacParameters.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); reacParameters.setSelectedIndex(0); modelEditor.setDirty(true); bioModel.makeUndoPoint(); } /** * Creates a frame used to edit products or create new ones. */ public void productsEditor(BioModel bioModel, String option, String selectedProductId, SpeciesReference product, boolean inSchematic) { JPanel productsPanel; if (bioModel.getSBMLDocument().getLevel() < 3) { productsPanel = new JPanel(new GridLayout(5, 2)); } else { productsPanel = new JPanel(new GridLayout(6, 2)); } JLabel productIdLabel = new JLabel("Id:"); JLabel productNameLabel = new JLabel("Name:"); JLabel speciesLabel = new JLabel("Species:"); Object[] stoiciOptions = { "Stoichiometry", "Stoichiometry Math" }; stoiciLabel = new JComboBox(stoiciOptions); JLabel stoichiometryLabel = new JLabel("Stoichiometry:"); JLabel constantLabel = new JLabel("Constant:"); Object[] productConstantOptions = { "true", "false" }; productConstant = new JComboBox(productConstantOptions); ListOf<Species> listOfSpecies = bioModel.getSBMLDocument().getModel().getListOfSpecies(); String[] speciesList = new String[bioModel.getSBMLDocument().getModel().getSpeciesCount()]; for (int i = 0; i < bioModel.getSBMLDocument().getModel().getSpeciesCount(); i++) { speciesList[i] = listOfSpecies.get(i).getId(); } Utility.sort(speciesList); productSpecies = new JComboBox(); PiIndex = new JTextField(10); PiIndex.setEnabled(true); productSpecies.addActionListener(this); if (inSchematic) { productSpecies.setEnabled(false); } else { productSpecies.setEnabled(true); } for (int i = 0; i < speciesList.length; i++) { Species species = bioModel.getSBMLDocument().getModel().getSpecies(speciesList[i]); if (species.getBoundaryCondition() || (!species.getConstant() && Rules.keepVarRateRule(bioModel, "", speciesList[i]))) { productSpecies.addItem(speciesList[i]); } } productId = new JTextField(""); /* * int j = 0; while (usedIDs.contains("product"+j)) { j++; } * productId.setText("product"+j); */ productName = new JTextField(""); productStoichiometry = new JTextField("1"); String selectedID = ""; if (option.equals("OK")) { String v = selectedProductId; if (product == null || !inSchematic) { for (SpeciesReference p : changedProducts) { if (p.getSpecies().equals(v)) { product = p; } } } if (product==null) return; if (product.isSetName()) { productName.setText(product.getName()); } productSpecies.setSelectedItem(product.getSpecies()); productStoichiometry.setText("" + product.getStoichiometry()); if (product.isSetId()) { selectedID = product.getId(); productId.setText(product.getId()); InitialAssignment init = bioModel.getSBMLDocument().getModel().getInitialAssignment(selectedID); if (init!=null) { productStoichiometry.setText("" + bioModel.removeBooleans(init.getMath())); } } if (!product.getConstant()) { productConstant.setSelectedItem("false"); } ArraysSBasePlugin sBasePlugin = SBMLutilities.getArraysSBasePlugin(product); //TODO: Make sure it reads correctly String dimInID = ""; for(int i = sBasePlugin.getDimensionCount()-1; i>=0; i org.sbml.jsbml.ext.arrays.Dimension dimX = sBasePlugin.getDimensionByArrayDimension(i); dimInID += "[" + dimX.getSize() + "]"; } productId.setText(productId.getText()+dimInID); // TODO: Scott - change for Plugin reading String freshIndex = ""; for(int i = sBasePlugin.getIndexCount()-1; i>=0; i Index indie = sBasePlugin.getIndex(i); freshIndex += "[" + SBMLutilities.myFormulaToString(indie.getMath()) + "]"; } PiIndex.setText(freshIndex); } if (production!=null) { double np = bioModel.getSBMLDocument().getModel().getParameter(GlobalConstants.STOICHIOMETRY_STRING).getValue(); if (production.getKineticLaw().getLocalParameter(GlobalConstants.STOICHIOMETRY_STRING)!=null) { np = production.getKineticLaw().getLocalParameter(GlobalConstants.STOICHIOMETRY_STRING).getValue(); } productStoichiometry.setText(""+np); productStoichiometry.setEnabled(false); } productsPanel.add(productIdLabel); productsPanel.add(productId); productsPanel.add(productNameLabel); productsPanel.add(productName); productsPanel.add(speciesLabel); productsPanel.add(productSpecies); productsPanel.add(new JLabel("Indices:")); productsPanel.add(PiIndex); if (bioModel.getSBMLDocument().getLevel() < 3) { productsPanel.add(stoiciLabel); } else { productsPanel.add(stoichiometryLabel); } productsPanel.add(productStoichiometry); if (bioModel.getSBMLDocument().getLevel() > 2) { productsPanel.add(constantLabel); productsPanel.add(productConstant); } if (speciesList.length == 0) { JOptionPane.showMessageDialog(Gui.frame, "There are no species availiable to be products." + "\nAdd species to this sbml file first.", "No Species", JOptionPane.ERROR_MESSAGE); return; } Object[] options = { option, "Cancel" }; int value = JOptionPane.showOptionDialog(Gui.frame, productsPanel, "Products Editor", JOptionPane.YES_NO_OPTION, JOptionPane.PLAIN_MESSAGE, null, options, options[0]); String[] dimID = new String[]{""}; String[] dex = new String[]{""}; String[] dimensionIds = new String[]{""}; boolean error = true; while (error && value == JOptionPane.YES_OPTION) { error = false; String prod = ""; double val = 1.0; dimID = SBMLutilities.checkSizeParameters(bioModel.getSBMLDocument(), productId.getText(), true); if(dimID!=null){ dimensionIds = SBMLutilities.getDimensionIds("p",dimID.length-1); if (dimID[0].equals("")) { error = SBMLutilities.variableInUse(bioModel.getSBMLDocument(), selectedID, false, true, true); } else { error = SBMLutilities.checkID(bioModel.getSBMLDocument(), dimID[0], selectedID, false); } } else{ error = true; } if(!error){ SBase variable = SBMLutilities.getElementBySId(bioModel.getSBMLDocument(), (String)productSpecies.getSelectedItem()); dex = SBMLutilities.checkIndices(PiIndex.getText(), variable, bioModel.getSBMLDocument(), dimensionIds, "variable", dimID); error = (dex==null); } if (!error) { if (stoiciLabel.getSelectedItem().equals("Stoichiometry")) { InitialAssignments.removeInitialAssignment(bioModel, selectedID); try { val = Double.parseDouble(productStoichiometry.getText().trim()); } catch (Exception e1) { if (productId.getText().equals("")) { JOptionPane.showMessageDialog(Gui.frame, "The stoichiometry must be a real number if no id is provided.", "Enter A Valid Value", JOptionPane.ERROR_MESSAGE); error = true; } else { // TODO: this needs to send product dimension when it exists error = InitialAssignments.addInitialAssignment(bioModel, dimID[0], productStoichiometry.getText().trim(),dimID); val = 1.0; } } if (val <= 0) { JOptionPane.showMessageDialog(Gui.frame, "The stoichiometry value must be greater than 0.", "Enter A Valid Value", JOptionPane.ERROR_MESSAGE); error = true; } prod = productSpecies.getSelectedItem() + " " + val; } else { prod = productSpecies.getSelectedItem() + " " + productStoichiometry.getText().trim(); } } int index = -1; if (!error) { if (product == null || !inSchematic) { if (option.equals("OK")) { index = products.getSelectedIndex(); } products.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); proda = Utility.getList(proda, products); products.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); if (index >= 0) { products.setSelectedIndex(index); } for (int i = 0; i < proda.length; i++) { if (i != index) { if (proda[i].split(" ")[0].equals(productSpecies.getSelectedItem())) { error = true; JOptionPane.showMessageDialog(Gui.frame, "Unable to add species as a product.\n" + "Each species can only be used as a product once.", "Species Can Only Be Used Once", JOptionPane.ERROR_MESSAGE); } } } } } if (!error) { if (stoiciLabel.getSelectedItem().equals("Stoichiometry Math")) { if (productStoichiometry.getText().trim().equals("")) { JOptionPane.showMessageDialog(Gui.frame, "Stoichiometry math must have formula.", "Enter Stoichiometry Formula", JOptionPane.ERROR_MESSAGE); error = true; } else if (SBMLutilities.myParseFormula(productStoichiometry.getText().trim()) == null) { JOptionPane.showMessageDialog(Gui.frame, "Stoichiometry formula is not valid.", "Enter Valid Formula", JOptionPane.ERROR_MESSAGE); error = true; } else { ArrayList<String> invalidVars = getInvalidVariablesInReaction(productStoichiometry.getText().trim(), dimensionIds, true, "", false); if (invalidVars.size() > 0) { String invalid = ""; for (int i = 0; i < invalidVars.size(); i++) { if (i == invalidVars.size() - 1) { invalid += invalidVars.get(i); } else { invalid += invalidVars.get(i) + "\n"; } } String message; message = "Stoiciometry math contains unknown variables.\n\n" + "Unknown variables:\n" + invalid; JTextArea messageArea = new JTextArea(message); messageArea.setLineWrap(true); messageArea.setWrapStyleWord(true); messageArea.setEditable(false); JScrollPane scrolls = new JScrollPane(); scrolls.setMinimumSize(new Dimension(300, 300)); scrolls.setPreferredSize(new Dimension(300, 300)); scrolls.setViewportView(messageArea); JOptionPane.showMessageDialog(Gui.frame, scrolls, "Stoiciometry Math Error", JOptionPane.ERROR_MESSAGE); error = true; } if (!error) { error = SBMLutilities.checkNumFunctionArguments(bioModel.getSBMLDocument(), SBMLutilities.myParseFormula(productStoichiometry.getText().trim())); } if (!error) { if (SBMLutilities.returnsBoolean(SBMLutilities.myParseFormula(productStoichiometry.getText().trim()), bioModel.getSBMLDocument().getModel())) { JOptionPane.showMessageDialog(Gui.frame, "Stoichiometry math must evaluate to a number.", "Number Expected", JOptionPane.ERROR_MESSAGE); error = true; } } } } } if (!error && option.equals("OK") && productConstant.getSelectedItem().equals("true")) { String id = selectedID; error = SBMLutilities.checkConstant(bioModel.getSBMLDocument(), "Product stoiciometry", id); } if (!error) { if (option.equals("OK")) { String v = selectedProductId; SpeciesReference produ = product; if (product == null || !inSchematic) { for (SpeciesReference p : changedProducts) { if (p.getSpecies().equals(v)) { produ = p; } } products.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); proda = Utility.getList(proda, products); products.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); } if (produ==null) return; produ.setId(dimID[0]); produ.setName(productName.getText().trim()); produ.setSpecies((String) productSpecies.getSelectedItem()); produ.setStoichiometry(val); if (productConstant.getSelectedItem().equals("true")) { produ.setConstant(true); } else { produ.setConstant(false); } // TODO: Scott - change for Plugin writing if(!error){ ArraysSBasePlugin sBasePlugin = SBMLutilities.getArraysSBasePlugin(produ); sBasePlugin.unsetListOfDimensions(); for(int i = 0; i<dimID.length-1; i++){ org.sbml.jsbml.ext.arrays.Dimension dimX = sBasePlugin.createDimension(dimensionIds[i]); dimX.setSize(dimID[i+1]); dimX.setArrayDimension(i); } // Add the indices sBasePlugin.unsetListOfIndices(); for(int i = 0; i<dex.length-1; i++){ Index indexRule = new Index(); indexRule.setArrayDimension(i); indexRule.setReferencedAttribute("variable"); ASTNode indexMath = SBMLutilities.myParseFormula(dex[i+1]); indexRule.setMath(indexMath); sBasePlugin.addIndex(indexRule); } } if (product == null || !inSchematic) { proda[index] = prod; Utility.sort(proda); products.setListData(proda); products.setSelectedIndex(index); } SBMLutilities.updateVarId(bioModel.getSBMLDocument(), false, selectedID, dimID[0]); if (product == null || !inSchematic) { kineticLaw.setText(SBMLutilities.updateFormulaVar(kineticLaw.getText().trim(), selectedID, dimID[0])); } } else { // SpeciesReference produ = new // SpeciesReference(BioSim.SBML_LEVEL, BioSim.SBML_VERSION); SpeciesReference produ = new SpeciesReference(bioModel.getSBMLDocument().getLevel(), bioModel.getSBMLDocument().getVersion()); produ.setId(dimID[0]); produ.setName(productName.getText().trim()); changedProducts.add(produ); produ.setSpecies((String) productSpecies.getSelectedItem()); produ.setStoichiometry(val); if (productConstant.getSelectedItem().equals("true")) { produ.setConstant(true); } else { produ.setConstant(false); } if(!error){ ArraysSBasePlugin sBasePlugin = SBMLutilities.getArraysSBasePlugin(produ); for(int i = 0; i<dimID.length-1; i++){ org.sbml.jsbml.ext.arrays.Dimension dimX = sBasePlugin.createDimension(dimensionIds[i]); dimX.setSize(dimID[i+1]); dimX.setArrayDimension(i); } // Add the indices for(int i = 0; i<dex.length-1; i++){ Index indexRule = new Index(); indexRule.setArrayDimension(i); indexRule.setReferencedAttribute("variable"); ASTNode indexMath = SBMLutilities.myParseFormula(dex[i+1]); indexRule.setMath(indexMath); sBasePlugin.addIndex(indexRule); } } JList add = new JList(); Object[] adding = { prod }; add.setListData(adding); add.setSelectedIndex(0); products.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); adding = Utility.add(proda, products, add); proda = new String[adding.length]; for (int i = 0; i < adding.length; i++) { proda[i] = (String) adding[i]; } Utility.sort(proda); products.setListData(proda); products.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); products.setSelectedIndex(0); } modelEditor.setDirty(true); bioModel.makeUndoPoint(); } if (error) { value = JOptionPane.showOptionDialog(Gui.frame, productsPanel, "Products Editor", JOptionPane.YES_NO_OPTION, JOptionPane.PLAIN_MESSAGE, null, options, options[0]); } } if (value == JOptionPane.NO_OPTION) { return; } } private LocalParameter getChangedParameter(String paramStr) { for (LocalParameter r : changedParameters) { if (r.getId().equals(paramStr)) { return r; } } return null; } /** * Creates a frame used to edit modifiers or create new ones. */ public void modifiersEditor(BioModel bioModel,String option,String selectedModifierId, ModifierSpeciesReference modifier, boolean inSchematic) { JPanel modifiersPanel; MiIndex = new JTextField(10); modifierId = new JTextField(10); modifierName = new JTextField(10); JLabel speciesLabel = new JLabel("Species:"); ListOf<Species> listOfSpecies = bioModel.getSBMLDocument().getModel().getListOfSpecies(); String[] speciesList = new String[bioModel.getSBMLDocument().getModel().getSpeciesCount()]; for (int i = 0; i < bioModel.getSBMLDocument().getModel().getSpeciesCount(); i++) { speciesList[i] = listOfSpecies.get(i).getId(); } Utility.sort(speciesList); Object[] choices = speciesList; modifierSpecies = new JComboBox(choices); modifierSpecies.addActionListener(this); if (inSchematic) { modifierSpecies.setEnabled(false); } else { modifierSpecies.setEnabled(true); } JLabel SBOTermsLabel = new JLabel("Type"); JLabel RepStoichiometryLabel = new JLabel("Stoichiometry of repression (nc)"); JLabel RepBindingLabel = new JLabel("Repression binding equilibrium (Kr)"); JLabel ActStoichiometryLabel = new JLabel("Stoichiometry of activation (nc)"); JLabel ActBindingLabel = new JLabel("Activation binding equilibrium (Ka)"); String selectedID = ""; if (option.equals("OK")) { String v = selectedModifierId; if (modifier == null || !inSchematic) { for (ModifierSpeciesReference p : changedModifiers) { if (p.getSpecies().equals(v)) { modifier = p; } } } if (modifier==null) return; if (modifier.isSetName()) { modifierName.setText(modifier.getName()); } if (modifier.isSetId()) { selectedID = modifier.getId(); modifierId.setText(modifier.getId()); } // TODO: Scott - change for Plugin reading ArraysSBasePlugin sBasePlugin = SBMLutilities.getArraysSBasePlugin(modifier); String dimInID = ""; for(int i = sBasePlugin.getDimensionCount()-1; i>=0; i org.sbml.jsbml.ext.arrays.Dimension dimX = sBasePlugin.getDimensionByArrayDimension(i); dimInID += "[" + dimX.getSize() + "]"; } modifierId.setText(modifierId.getText()+dimInID); String freshIndex = ""; for(int i = sBasePlugin.getIndexCount()-1; i>=0; i Index indie = sBasePlugin.getIndex(i); freshIndex += "[" + SBMLutilities.myFormulaToString(indie.getMath()) + "]"; } MiIndex.setText(freshIndex); modifierSpecies.setSelectedItem(modifier.getSpecies()); if (production!=null) { if (BioModel.isPromoter(modifier)) { String [] sboTerms = new String[1]; sboTerms[0] = "Promoter"; SBOTerms = new JComboBox(sboTerms); SBOTerms.setSelectedItem("Promoter"); } else { String [] sboTerms = new String[4]; sboTerms[0] = "Repression"; sboTerms[1] = "Activation"; sboTerms[2] = "Dual activity"; sboTerms[3] = "No influence"; SBOTerms = new JComboBox(sboTerms); if (BioModel.isRepressor(modifier)) { SBOTerms.setSelectedItem("Repression"); } else if (BioModel.isActivator(modifier)) { SBOTerms.setSelectedItem("Activation"); } else if (BioModel.isRegulator(modifier)) { SBOTerms.setSelectedItem("Dual activity"); } else if (BioModel.isNeutral(modifier)) { SBOTerms.setSelectedItem("No influence"); } } } } else { String [] sboTerms = new String[4]; sboTerms[0] = "Repression"; sboTerms[1] = "Activation"; sboTerms[2] = "Dual activity"; sboTerms[3] = "No influence"; SBOTerms = new JComboBox(sboTerms); } if (production==null) { modifiersPanel = new JPanel(new GridLayout(4, 2)); } else { if (SBOTerms.getSelectedItem().equals("Promoter")) { modifiersPanel = new JPanel(new GridLayout(5, 2)); } else { modifiersPanel = new JPanel(new GridLayout(9, 2)); } } modifiersPanel.add(new JLabel("Id:")); modifiersPanel.add(modifierId); modifiersPanel.add(new JLabel("Name:")); modifiersPanel.add(modifierName); modifiersPanel.add(speciesLabel); modifiersPanel.add(modifierSpecies); modifiersPanel.add(new JLabel("Indices:")); modifiersPanel.add(MiIndex); if (production!=null) { modifiersPanel.add(SBOTermsLabel); modifiersPanel.add(SBOTerms); if (SBOTerms.getSelectedItem().equals("Promoter")) { modifierSpecies.setEnabled(false); SBOTerms.setEnabled(false); } else { String selectedSpecies = (String)modifierSpecies.getSelectedItem(); modifiersPanel.add(RepStoichiometryLabel); repCooperativity = new JTextField(); double nc = bioModel.getSBMLDocument().getModel().getParameter(GlobalConstants.COOPERATIVITY_STRING).getValue(); repCooperativity.setText(""+nc); LocalParameter p = getChangedParameter(GlobalConstants.COOPERATIVITY_STRING+"_"+selectedSpecies+"_r"); if (p!=null) { repCooperativity.setText(""+p.getValue()); } modifiersPanel.add(repCooperativity); modifiersPanel.add(RepBindingLabel); repBinding = new JTextField(bioModel.getParameter(GlobalConstants.FORWARD_KREP_STRING) + "/" + bioModel.getParameter(GlobalConstants.REVERSE_KREP_STRING)); LocalParameter kr_f = getChangedParameter(GlobalConstants.FORWARD_KREP_STRING.replace("_","_" + selectedSpecies + "_")); LocalParameter kr_r = getChangedParameter(GlobalConstants.REVERSE_KREP_STRING.replace("_","_" + selectedSpecies + "_")); if (kr_f!=null && kr_r!=null) { repBinding.setText(""+kr_f.getValue()+"/"+kr_r.getValue()); } modifiersPanel.add(repBinding); modifiersPanel.add(ActStoichiometryLabel); actCooperativity = new JTextField(); nc = bioModel.getSBMLDocument().getModel().getParameter(GlobalConstants.COOPERATIVITY_STRING).getValue(); actCooperativity.setText(""+nc); p = getChangedParameter(GlobalConstants.COOPERATIVITY_STRING+"_"+selectedSpecies+"_a"); if (p!=null) { actCooperativity.setText(""+p.getValue()); } modifiersPanel.add(actCooperativity); modifiersPanel.add(ActBindingLabel); actBinding = new JTextField(bioModel.getParameter(GlobalConstants.FORWARD_KACT_STRING) + "/" + bioModel.getParameter(GlobalConstants.REVERSE_KACT_STRING)); LocalParameter ka_f = getChangedParameter(GlobalConstants.FORWARD_KACT_STRING.replace("_","_" + selectedSpecies + "_")); LocalParameter ka_r = getChangedParameter(GlobalConstants.REVERSE_KACT_STRING.replace("_","_" + selectedSpecies + "_")); if (ka_f!=null && ka_r!=null) { actBinding.setText(""+ka_f.getValue()+"/"+ka_r.getValue()); } modifiersPanel.add(actBinding); } } if (choices.length == 0) { JOptionPane.showMessageDialog(Gui.frame, "There are no species availiable to be modifiers." + "\nAdd species to this sbml file first.", "No Species", JOptionPane.ERROR_MESSAGE); return; } Object[] options = { option, "Cancel" }; int value = JOptionPane.showOptionDialog(Gui.frame, modifiersPanel, "Modifiers Editor", JOptionPane.YES_NO_OPTION, JOptionPane.PLAIN_MESSAGE, null, options, options[0]); String[] dex = new String[]{""}; String[] dimensionIds = new String[]{""}; String[] dimID = new String[]{""}; boolean error = true; while (error && value == JOptionPane.YES_OPTION) { error = false; int index = -1; dimID = SBMLutilities.checkSizeParameters(bioModel.getSBMLDocument(), modifierId.getText(), true); if(dimID!=null){ dimensionIds = SBMLutilities.getDimensionIds("m",dimID.length-1); if (dimID[0].trim().equals("")) { error = SBMLutilities.variableInUse(bioModel.getSBMLDocument(), selectedID, false, true, true); } else { error = SBMLutilities.checkID(bioModel.getSBMLDocument(), dimID[0].trim(), selectedID, false); } } else{ error = true; } if(!error){ SBase variable = SBMLutilities.getElementBySId(bioModel.getSBMLDocument(), (String)modifierSpecies.getSelectedItem()); dex = SBMLutilities.checkIndices(MiIndex.getText(), variable, bioModel.getSBMLDocument(), dimensionIds, "variable", dimID); error = (dex==null); } if (modifier == null || !inSchematic) { if (option.equals("OK")) { index = modifiers.getSelectedIndex(); } modifiers.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); modifierArray = Utility.getList(modifierArray, modifiers); modifiers.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); if (index >= 0) { modifiers.setSelectedIndex(index); } for (int i = 0; i < modifierArray.length; i++) { if (i != index) { if (modifierArray[i].split(" ")[0].equals(modifierSpecies.getSelectedItem())) { error = true; JOptionPane.showMessageDialog(Gui.frame, "Unable to add species as a modifier.\n" + "Each species can only be used as a modifier once.", "Species Can Only Be Used Once", JOptionPane.ERROR_MESSAGE); } } } } String mod = (String) modifierSpecies.getSelectedItem(); double repCoop = 0.0; double actCoop = 0.0; double repBindf = 0.0; double repBindr = 1.0; double actBindf = 0.0; double actBindr = 1.0; if (production!=null) { try { repCoop = Double.parseDouble(repCooperativity.getText().trim()); } catch (Exception e1) { JOptionPane.showMessageDialog(Gui.frame, "The repression cooperativity must be a real number.", "Enter A Valid Value", JOptionPane.ERROR_MESSAGE); error = true; } try { repBindf = Double.parseDouble(repBinding.getText().trim().split("/")[0]); repBindr = Double.parseDouble(repBinding.getText().trim().split("/")[1]); } catch (Exception e1) { JOptionPane.showMessageDialog(Gui.frame, "The repression binding must be a forward rate / reverse rate.", "Enter A Valid Value", JOptionPane.ERROR_MESSAGE); error = true; } try { actCoop = Double.parseDouble(actCooperativity.getText().trim()); } catch (Exception e1) { JOptionPane.showMessageDialog(Gui.frame, "The activation cooperativity must be a real number.", "Enter A Valid Value", JOptionPane.ERROR_MESSAGE); error = true; } try { actBindf = Double.parseDouble(actBinding.getText().trim().split("/")[0]); actBindr = Double.parseDouble(actBinding.getText().trim().split("/")[1]); } catch (Exception e1) { JOptionPane.showMessageDialog(Gui.frame, "The activation binding must be a forward rate / reverse rate.", "Enter A Valid Value", JOptionPane.ERROR_MESSAGE); error = true; } } if (!error) { if (option.equals("OK")) { String v = selectedModifierId; ModifierSpeciesReference modi = modifier; modi.setId(dimID[0]); modi.setName(modifierName.getText()); if (modifier == null || !inSchematic) { for (ModifierSpeciesReference p : changedModifiers) { if (p.getSpecies().equals(mod)) { modi = p; } } modifiers.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); modifierArray = Utility.getList(modifierArray, modifiers); modifiers.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); //modifiers.setSelectedIndex(index); } modi.setSpecies((String) modifierSpecies.getSelectedItem()); if (production!=null) { if (SBOTerms.getSelectedItem().equals("Repression")) { modi.setSBOTerm(GlobalConstants.SBO_REPRESSION); } else if (SBOTerms.getSelectedItem().equals("Activation")) { modi.setSBOTerm(GlobalConstants.SBO_ACTIVATION); } else if (SBOTerms.getSelectedItem().equals("Dual activity")) { modi.setSBOTerm(GlobalConstants.SBO_DUAL_ACTIVITY); } else if (SBOTerms.getSelectedItem().equals("No influence")) { modi.setSBOTerm(GlobalConstants.SBO_NEUTRAL); } else if (SBOTerms.getSelectedItem().equals("Promoter")) { modi.setSBOTerm(GlobalConstants.SBO_PROMOTER_MODIFIER); } } if (production!=null) { double nc = bioModel.getSBMLDocument().getModel().getParameter(GlobalConstants.COOPERATIVITY_STRING).getValue(); String ncStr = GlobalConstants.COOPERATIVITY_STRING+"_"+mod+"_r"; LocalParameter paramet = getChangedParameter(ncStr); if (paramet != null) { removeLocalParameter(ncStr); } if (nc!=repCoop) { addLocalParameter(ncStr,repCoop); } ncStr = GlobalConstants.COOPERATIVITY_STRING+"_"+mod+"_a"; paramet = getChangedParameter(ncStr); if (paramet != null) { removeLocalParameter(ncStr); } if (nc!=actCoop) { addLocalParameter(ncStr,actCoop); } double bindf = bioModel.getSBMLDocument().getModel().getParameter(GlobalConstants.FORWARD_KREP_STRING).getValue(); double bindr = bioModel.getSBMLDocument().getModel().getParameter(GlobalConstants.REVERSE_KREP_STRING).getValue(); LocalParameter kr_f = getChangedParameter(GlobalConstants.FORWARD_KREP_STRING.replace("_","_" + mod + "_")); LocalParameter kr_r = getChangedParameter(GlobalConstants.REVERSE_KREP_STRING.replace("_","_" + mod + "_")); if (kr_f != null) { removeLocalParameter(GlobalConstants.FORWARD_KREP_STRING.replace("_","_" + mod + "_")); } if (kr_r != null) { removeLocalParameter(GlobalConstants.REVERSE_KREP_STRING.replace("_","_" + mod + "_")); } if (repBindf!=bindf || repBindr!=bindr) { addLocalParameter(GlobalConstants.FORWARD_KREP_STRING.replace("_","_" + mod + "_"),repBindf); addLocalParameter(GlobalConstants.REVERSE_KREP_STRING.replace("_","_" + mod + "_"),repBindr); } bindf = bioModel.getSBMLDocument().getModel().getParameter(GlobalConstants.FORWARD_KACT_STRING).getValue(); bindr = bioModel.getSBMLDocument().getModel().getParameter(GlobalConstants.REVERSE_KACT_STRING).getValue(); LocalParameter ka_f = getChangedParameter(GlobalConstants.FORWARD_KACT_STRING.replace("_","_" + mod + "_")); LocalParameter ka_r = getChangedParameter(GlobalConstants.REVERSE_KACT_STRING.replace("_","_" + mod + "_")); if (ka_f != null) { removeLocalParameter(GlobalConstants.FORWARD_KACT_STRING.replace("_","_" + mod + "_")); } if (ka_r != null) { removeLocalParameter(GlobalConstants.REVERSE_KACT_STRING.replace("_","_" + mod + "_")); } if (actBindf!=bindf || actBindr!=bindr) { addLocalParameter(GlobalConstants.FORWARD_KACT_STRING.replace("_","_" + mod + "_"),actBindf); addLocalParameter(GlobalConstants.REVERSE_KACT_STRING.replace("_","_" + mod + "_"),actBindr); } } if (modifier == null || !inSchematic) { modifierArray[index] = mod; Utility.sort(modifierArray); modifiers.setListData(modifierArray); modifiers.setSelectedIndex(index); } // TODO: Scott - change for Plugin writing ArraysSBasePlugin sBasePlugin = SBMLutilities.getArraysSBasePlugin(modifier); sBasePlugin.unsetListOfDimensions(); for(int i = 0; i<dimID.length-1; i++){ org.sbml.jsbml.ext.arrays.Dimension dimX = sBasePlugin.createDimension(dimensionIds[i]); dimX.setSize(dimID[i+1]); dimX.setArrayDimension(i); } sBasePlugin.unsetListOfIndices(); for(int i = 0; i<dex.length-1; i++){ Index indexRule = new Index(); indexRule.setArrayDimension(i); indexRule.setReferencedAttribute("variable"); ASTNode indexMath = SBMLutilities.myParseFormula(dex[i+1]); indexRule.setMath(indexMath); sBasePlugin.addIndex(indexRule); } } else { modifiers.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); modifierArray = Utility.getList(modifierArray, modifiers); modifiers.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); modifiers.setSelectedIndex(index); ModifierSpeciesReference modi = new ModifierSpeciesReference(bioModel.getSBMLDocument().getLevel(), bioModel.getSBMLDocument().getVersion()); modi.setId(dimID[0]); modi.setName(modifierName.getText()); changedModifiers.add(modi); modi.setSpecies(mod); if (production!=null) { if (SBOTerms.getSelectedItem().equals("Repression")) { modi.setSBOTerm(GlobalConstants.SBO_REPRESSION); } else if (SBOTerms.getSelectedItem().equals("Activation")) { modi.setSBOTerm(GlobalConstants.SBO_ACTIVATION); } else if (SBOTerms.getSelectedItem().equals("Dual activity")) { modi.setSBOTerm(GlobalConstants.SBO_DUAL_ACTIVITY); } else if (SBOTerms.getSelectedItem().equals("No influence")) { modi.setSBOTerm(GlobalConstants.SBO_NEUTRAL); } else if (SBOTerms.getSelectedItem().equals("Promoter")) { modi.setSBOTerm(GlobalConstants.SBO_PROMOTER_MODIFIER); } } if (production!=null) { double nc = bioModel.getSBMLDocument().getModel().getParameter(GlobalConstants.COOPERATIVITY_STRING).getValue(); String ncStr = GlobalConstants.COOPERATIVITY_STRING+"_"+mod+"_r"; LocalParameter paramet = getChangedParameter(ncStr); if (paramet != null) { removeLocalParameter(ncStr); } if (nc!=repCoop) { addLocalParameter(ncStr,repCoop); } ncStr = GlobalConstants.COOPERATIVITY_STRING+"_"+mod+"_a"; paramet = getChangedParameter(ncStr); if (paramet != null) { removeLocalParameter(ncStr); } if (nc!=actCoop) { addLocalParameter(ncStr,actCoop); } double bindf = bioModel.getSBMLDocument().getModel().getParameter(GlobalConstants.FORWARD_KREP_STRING).getValue(); double bindr = bioModel.getSBMLDocument().getModel().getParameter(GlobalConstants.REVERSE_KREP_STRING).getValue(); LocalParameter kr_f = getChangedParameter(GlobalConstants.FORWARD_KREP_STRING.replace("_","_" + mod + "_")); LocalParameter kr_r = getChangedParameter(GlobalConstants.REVERSE_KREP_STRING.replace("_","_" + mod + "_")); if (kr_f != null) { removeLocalParameter(GlobalConstants.FORWARD_KREP_STRING.replace("_","_" + mod + "_")); } if (kr_r != null) { removeLocalParameter(GlobalConstants.REVERSE_KREP_STRING.replace("_","_" + mod + "_")); } if (repBindf!=bindf || repBindr!=bindr) { addLocalParameter(GlobalConstants.FORWARD_KREP_STRING.replace("_","_" + mod + "_"),repBindf); addLocalParameter(GlobalConstants.REVERSE_KREP_STRING.replace("_","_" + mod + "_"),repBindr); } bindf = bioModel.getSBMLDocument().getModel().getParameter(GlobalConstants.FORWARD_KACT_STRING).getValue(); bindr = bioModel.getSBMLDocument().getModel().getParameter(GlobalConstants.REVERSE_KACT_STRING).getValue(); LocalParameter ka_f = getChangedParameter(GlobalConstants.FORWARD_KACT_STRING.replace("_","_" + mod + "_")); LocalParameter ka_r = getChangedParameter(GlobalConstants.REVERSE_KACT_STRING.replace("_","_" + mod + "_")); if (ka_f != null) { removeLocalParameter(GlobalConstants.FORWARD_KACT_STRING.replace("_","_" + mod + "_")); } if (ka_r != null) { removeLocalParameter(GlobalConstants.REVERSE_KACT_STRING.replace("_","_" + mod + "_")); } if (actBindf!=bindf || actBindr!=bindr) { addLocalParameter(GlobalConstants.FORWARD_KACT_STRING.replace("_","_" + mod + "_"),actBindf); addLocalParameter(GlobalConstants.REVERSE_KACT_STRING.replace("_","_" + mod + "_"),actBindr); } } JList add = new JList(); Object[] adding = { mod }; add.setListData(adding); add.setSelectedIndex(0); modifiers.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); adding = Utility.add(modifierArray, modifiers, add); modifierArray = new String[adding.length]; for (int i = 0; i < adding.length; i++) { modifierArray[i] = (String) adding[i]; } Utility.sort(modifierArray); modifiers.setListData(modifierArray); modifiers.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); try { if (bioModel.getSBMLDocument().getModel().getReaction(selectedReaction).getModifierCount() == 1) { modifiers.setSelectedIndex(0); } else { modifiers.setSelectedIndex(index); } } catch (Exception e2) { modifiers.setSelectedIndex(0); } ArraysSBasePlugin sBasePlugin = SBMLutilities.getArraysSBasePlugin(modifier); for(int i = 0; i<dimID.length-1; i++){ org.sbml.jsbml.ext.arrays.Dimension dimX = sBasePlugin.createDimension(dimensionIds[i]); dimX.setSize(dimID[i]); dimX.setArrayDimension(i); } for(int i = 0; i<dex.length-1; i++){ Index indexRule = new Index(); indexRule.setArrayDimension(i); indexRule.setReferencedAttribute("variable"); ASTNode indexMath = SBMLutilities.myParseFormula(dex[i+1]); indexRule.setMath(indexMath); sBasePlugin.addIndex(indexRule); } } } modelEditor.setDirty(true); bioModel.makeUndoPoint(); if (error) { value = JOptionPane.showOptionDialog(Gui.frame, modifiersPanel, "Modifiers Editor", JOptionPane.YES_NO_OPTION, JOptionPane.PLAIN_MESSAGE, null, options, options[0]); } } if (value == JOptionPane.NO_OPTION) { return; } } /** * Creates a frame used to edit reactants or create new ones. */ public void reactantsEditor(BioModel gcm, String option, String selectedReactantId, SpeciesReference reactant, boolean inSchematic, Reaction reaction) { JPanel reactantsPanel; if (gcm.getSBMLDocument().getLevel() < 3) { reactantsPanel = new JPanel(new GridLayout(5, 2)); } else { reactantsPanel = new JPanel(new GridLayout(6, 2)); } JLabel reactantIdLabel = new JLabel("Id:"); JLabel reactantNameLabel = new JLabel("Name:"); JLabel speciesLabel = new JLabel("Species:"); Object[] stoiciOptions = { "Stoichiometry", "Stoichiometry Math" }; stoiciLabel = new JComboBox(stoiciOptions); JLabel stoichiometryLabel = new JLabel("Stoichiometry:"); JLabel constantLabel = new JLabel("Constant:"); Object[] reactantConstantOptions = { "true", "false" }; reactantConstant = new JComboBox(reactantConstantOptions); ListOf<Species> listOfSpecies = gcm.getSBMLDocument().getModel().getListOfSpecies(); String[] speciesList = new String[gcm.getSBMLDocument().getModel().getSpeciesCount()]; for (int i = 0; i < gcm.getSBMLDocument().getModel().getSpeciesCount(); i++) { speciesList[i] = listOfSpecies.get(i).getId(); } Utility.sort(speciesList); RiIndex = new JTextField(10); RiIndex.setEnabled(true); reactantSpecies = new JComboBox(); reactantSpecies.addActionListener(this); if (inSchematic) { reactantSpecies.setEnabled(false); } else { reactantSpecies.setEnabled(true); } // TODO: Scott: if (inSchematic) extract dimensions from reaction else from reaction id field for (int i = 0; i < speciesList.length; i++) { Species species = gcm.getSBMLDocument().getModel().getSpecies(speciesList[i]); if (species.getBoundaryCondition() || (!species.getConstant() && Rules.keepVarRateRule(gcm, "", speciesList[i]))) { reactantSpecies.addItem(speciesList[i]); } } reactantId = new JTextField(""); reactantName = new JTextField(""); reactantStoichiometry = new JTextField("1"); String selectedID = ""; if (complex!=null) { double nc = bioModel.getSBMLDocument().getModel().getParameter(GlobalConstants.COOPERATIVITY_STRING).getValue(); reactantStoichiometry.setText(""+nc); } if (option.equals("OK")) { String v = selectedReactantId; if (reactant == null) { for (SpeciesReference r : changedReactants) { if (r.getSpecies().equals(v)) { reactant = r; } } } reactantSpecies.setSelectedItem(reactant.getSpecies()); if (reactant.isSetName()) { reactantName.setText(reactant.getName()); } reactantStoichiometry.setText("" + reactant.getStoichiometry()); if (reactant.isSetId()) { selectedID = reactant.getId(); reactantId.setText(reactant.getId()); InitialAssignment init = bioModel.getSBMLDocument().getModel().getInitialAssignment(selectedID); if (init!=null) { reactantStoichiometry.setText("" + bioModel.removeBooleans(init.getMath())); } } if (!reactant.getConstant()) { reactantConstant.setSelectedItem("false"); } // TODO: Scott - change for Plugin reading ArraysSBasePlugin sBasePlugin = SBMLutilities.getArraysSBasePlugin(reactant); String dimInID = ""; for(int i = sBasePlugin.getDimensionCount()-1; i>=0; i org.sbml.jsbml.ext.arrays.Dimension dimX = sBasePlugin.getDimensionByArrayDimension(i); dimInID += "[" + dimX.getSize() + "]"; } reactantId.setText(reactantId.getText()+dimInID); String freshIndex = ""; for(int i = sBasePlugin.getIndexCount()-1; i>=0; i Index indie = sBasePlugin.getIndex(i); freshIndex += "[" + SBMLutilities.myFormulaToString(indie.getMath()) + "]"; } RiIndex.setText(freshIndex); if (complex!=null) { if (complex.getKineticLaw().getLocalParameter(GlobalConstants.COOPERATIVITY_STRING+"_"+selectedID)!=null) { double nc = complex.getKineticLaw().getLocalParameter(GlobalConstants.COOPERATIVITY_STRING+"_"+selectedID).getValue(); reactantStoichiometry.setText(""+nc); } } } reactantsPanel.add(reactantIdLabel); reactantsPanel.add(reactantId); reactantsPanel.add(reactantNameLabel); reactantsPanel.add(reactantName); reactantsPanel.add(speciesLabel); reactantsPanel.add(reactantSpecies); reactantsPanel.add(new JLabel("Indices:")); reactantsPanel.add(RiIndex); if (gcm.getSBMLDocument().getLevel() < 3) { reactantsPanel.add(stoiciLabel); } else { reactantsPanel.add(stoichiometryLabel); } reactantsPanel.add(reactantStoichiometry); if (gcm.getSBMLDocument().getLevel() > 2) { reactantsPanel.add(constantLabel); reactantsPanel.add(reactantConstant); } if (speciesList.length == 0) { JOptionPane.showMessageDialog(Gui.frame, "There are no species availiable to be reactants." + "\nAdd species to this sbml file first.", "No Species", JOptionPane.ERROR_MESSAGE); return; } Object[] options = { option, "Cancel" }; int value = JOptionPane.showOptionDialog(Gui.frame, reactantsPanel, "Reactants Editor", JOptionPane.YES_NO_OPTION, JOptionPane.PLAIN_MESSAGE, null, options, options[0]); String[] dimID = new String[]{""}; String[] dex = new String[]{""}; String[] dimensionIds = new String[]{""}; boolean error = true; while (error && value == JOptionPane.YES_OPTION) { error = false; String react = ""; double val = 1.0; dimID = SBMLutilities.checkSizeParameters(bioModel.getSBMLDocument(), reactantId.getText(), true); if(dimID!=null){ dimensionIds = SBMLutilities.getDimensionIds("r",dimID.length-1); if (dimID[0].trim().equals("")) { error = SBMLutilities.variableInUse(gcm.getSBMLDocument(), selectedID, false, true, true); } else { error = SBMLutilities.checkID(gcm.getSBMLDocument(), dimID[0].trim(), selectedID, false); } } else{ error = true; } if(!error){ SBase variable = SBMLutilities.getElementBySId(bioModel.getSBMLDocument(), (String)reactantSpecies.getSelectedItem()); String test = RiIndex.getText(); dex = SBMLutilities.checkIndices(RiIndex.getText(), variable, bioModel.getSBMLDocument(), dimensionIds, "variable", dimID); error = (dex==null); } if (!error) { if (stoiciLabel.getSelectedItem().equals("Stoichiometry")) { InitialAssignments.removeInitialAssignment(bioModel, selectedID); try { val = Double.parseDouble(reactantStoichiometry.getText().trim()); } catch (Exception e1) { if (reactantId.getText().equals("")) { JOptionPane.showMessageDialog(Gui.frame, "The stoichiometry must be a real number if no id is provided.", "Enter A Valid Value", JOptionPane.ERROR_MESSAGE); error = true; } else { // TODO: need sot use reactant dimension when it exists error = InitialAssignments.addInitialAssignment(bioModel, dimID[0].trim(), reactantStoichiometry.getText().trim(), dimID); val = 1.0; } } if (val <= 0) { JOptionPane.showMessageDialog(Gui.frame, "The stoichiometry value must be greater than 0.", "Enter A Valid Value", JOptionPane.ERROR_MESSAGE); error = true; } react = reactantSpecies.getSelectedItem() + " " + val; } else { react = reactantSpecies.getSelectedItem() + " " + reactantStoichiometry.getText().trim(); } } int index = -1; if (!error) { if (reactant == null || !inSchematic) { if (option.equals("OK")) { index = reactants.getSelectedIndex(); } reactants.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); reacta = Utility.getList(reacta, reactants); reactants.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); if (index >= 0) { reactants.setSelectedIndex(index); } for (int i = 0; i < reacta.length; i++) { if (i != index) { if (reacta[i].split(" ")[0].equals(reactantSpecies.getSelectedItem())) { error = true; JOptionPane.showMessageDialog(Gui.frame, "Unable to add species as a reactant.\n" + "Each species can only be used as a reactant once.", "Species Can Only Be Used Once", JOptionPane.ERROR_MESSAGE); } } } } } if (!error) { if (stoiciLabel.getSelectedItem().equals("Stoichiometry Math")) { if (reactantStoichiometry.getText().trim().equals("")) { JOptionPane.showMessageDialog(Gui.frame, "Stoichiometry math must have formula.", "Enter Stoichiometry Formula", JOptionPane.ERROR_MESSAGE); error = true; } else if (SBMLutilities.myParseFormula(reactantStoichiometry.getText().trim()) == null) { JOptionPane.showMessageDialog(Gui.frame, "Stoichiometry formula is not valid.", "Enter Valid Formula", JOptionPane.ERROR_MESSAGE); error = true; } else { ArrayList<String> invalidVars = getInvalidVariablesInReaction(reactantStoichiometry.getText().trim(), dimensionIds, true, "", false); if (invalidVars.size() > 0) { String invalid = ""; for (int i = 0; i < invalidVars.size(); i++) { if (i == invalidVars.size() - 1) { invalid += invalidVars.get(i); } else { invalid += invalidVars.get(i) + "\n"; } } String message; message = "Stoiciometry math contains unknown variables.\n\n" + "Unknown variables:\n" + invalid; JTextArea messageArea = new JTextArea(message); messageArea.setLineWrap(true); messageArea.setWrapStyleWord(true); messageArea.setEditable(false); JScrollPane scrolls = new JScrollPane(); scrolls.setMinimumSize(new Dimension(300, 300)); scrolls.setPreferredSize(new Dimension(300, 300)); scrolls.setViewportView(messageArea); JOptionPane.showMessageDialog(Gui.frame, scrolls, "Stoiciometry Math Error", JOptionPane.ERROR_MESSAGE); error = true; } if (!error) { error = SBMLutilities.checkNumFunctionArguments(gcm.getSBMLDocument(), SBMLutilities.myParseFormula(reactantStoichiometry.getText().trim())); } if (!error) { if (SBMLutilities.returnsBoolean(SBMLutilities.myParseFormula(reactantStoichiometry.getText().trim()), bioModel.getSBMLDocument().getModel())) { JOptionPane.showMessageDialog(Gui.frame, "Stoichiometry math must evaluate to a number.", "Number Expected", JOptionPane.ERROR_MESSAGE); error = true; } } } } } if (!error && option.equals("OK") && reactantConstant.getSelectedItem().equals("true")) { String id = selectedID; error = SBMLutilities.checkConstant(gcm.getSBMLDocument(), "Reactant stoiciometry", id); } if (!error) { if (option.equals("OK")) { String v = selectedReactantId; SpeciesReference reactan = reactant; if (reactant == null || !inSchematic) { for (SpeciesReference r : changedReactants) { if (r.getSpecies().equals(v)) { reactan = r; } } reactants.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); reacta = Utility.getList(reacta, reactants); reactants.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); } if (reactan==null) return; reactan.setId(dimID[0].trim()); reactan.setName(reactantName.getText().trim()); reactan.setSpecies((String) reactantSpecies.getSelectedItem()); reactan.setStoichiometry(val); if (complex!=null) { double nc = bioModel.getSBMLDocument().getModel().getParameter(GlobalConstants.COOPERATIVITY_STRING).getValue(); String ncStr = GlobalConstants.COOPERATIVITY_STRING+"_"+reactan.getSpecies(); LocalParameter paramet = null; for (LocalParameter p : changedParameters) { if (p.getId().equals(ncStr)) { paramet = p; } } if (nc==val) { if (paramet != null) { removeLocalParameter(ncStr); } } else { if (paramet != null) { removeLocalParameter(ncStr); addLocalParameter(GlobalConstants.COOPERATIVITY_STRING+"_"+reactan.getSpecies(),val); } else { addLocalParameter(GlobalConstants.COOPERATIVITY_STRING+"_"+reactan.getSpecies(),val); } } } if (reactantConstant.getSelectedItem().equals("true")) { reactan.setConstant(true); } else { reactan.setConstant(false); } // TODO: Scott - change for Plugin writing if(!error){ ArraysSBasePlugin sBasePlugin = SBMLutilities.getArraysSBasePlugin(reactan); sBasePlugin.unsetListOfDimensions(); for(int i = 0; i<dimID.length-1; i++){ org.sbml.jsbml.ext.arrays.Dimension dimX = sBasePlugin.createDimension(dimensionIds[i]); dimX.setSize(dimID[i+1]); dimX.setArrayDimension(i); } // Add the indices sBasePlugin.unsetListOfIndices(); for(int i = 0; i<dex.length-1; i++){ Index indexRule = new Index(); indexRule.setArrayDimension(i); indexRule.setReferencedAttribute("variable"); ASTNode indexMath = SBMLutilities.myParseFormula(dex[i+1]); indexRule.setMath(indexMath); sBasePlugin.addIndex(indexRule); } } if (reactant == null || !inSchematic) { reacta[index] = react; Utility.sort(reacta); reactants.setListData(reacta); reactants.setSelectedIndex(index); } SBMLutilities.updateVarId(gcm.getSBMLDocument(), false, selectedID, dimID[0].trim()); if (reactant == null || !inSchematic) { kineticLaw.setText(SBMLutilities.updateFormulaVar(kineticLaw.getText().trim(), selectedID, dimID[0].trim())); } } else { // SpeciesReference reactan = new // SpeciesReference(BioSim.SBML_LEVEL, BioSim.SBML_VERSION); SpeciesReference reactan = new SpeciesReference(gcm.getSBMLDocument().getLevel(), gcm.getSBMLDocument().getVersion()); reactan.setId(dimID[0].trim()); reactan.setName(reactantName.getText().trim()); reactan.setConstant(true); changedReactants.add(reactan); reactan.setSpecies((String) reactantSpecies.getSelectedItem()); reactan.setStoichiometry(val); if (complex!=null) { double nc = bioModel.getSBMLDocument().getModel().getParameter(GlobalConstants.COOPERATIVITY_STRING).getValue(); String ncStr = GlobalConstants.COOPERATIVITY_STRING+"_"+reactan.getSpecies(); LocalParameter paramet = null; for (LocalParameter p : changedParameters) { if (p.getId().equals(ncStr)) { paramet = p; } } if (nc==val) { if (paramet != null) { removeLocalParameter(ncStr); } } else { if (paramet != null) { removeLocalParameter(ncStr); addLocalParameter(GlobalConstants.COOPERATIVITY_STRING+"_"+reactan.getSpecies(),val); } else { addLocalParameter(GlobalConstants.COOPERATIVITY_STRING+"_"+reactan.getSpecies(),val); } } } if (reactantConstant.getSelectedItem().equals("true")) { reactan.setConstant(true); } else { reactan.setConstant(false); } // TODO: Scott - change for Plugin writing if(!error){ ArraysSBasePlugin sBasePlugin = SBMLutilities.getArraysSBasePlugin(reactan); for(int i = 0; i<dimID.length-1; i++){ org.sbml.jsbml.ext.arrays.Dimension dimX = sBasePlugin.createDimension(dimensionIds[i]); dimX.setSize(dimID[i+1]); dimX.setArrayDimension(i); } // Add the indices for(int i = 0; i<dex.length-1; i++){ Index indexRule = new Index(); indexRule.setArrayDimension(i); indexRule.setReferencedAttribute("variable"); ASTNode indexMath = SBMLutilities.myParseFormula(dex[i+1]); indexRule.setMath(indexMath); sBasePlugin.addIndex(indexRule); } } JList add = new JList(); Object[] adding = { react }; add.setListData(adding); add.setSelectedIndex(0); reactants.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); adding = Utility.add(reacta, reactants, add); reacta = new String[adding.length]; for (int i = 0; i < adding.length; i++) { reacta[i] = (String) adding[i]; } Utility.sort(reacta); reactants.setListData(reacta); reactants.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); reactants.setSelectedIndex(0); } modelEditor.setDirty(true); gcm.makeUndoPoint(); } if (error) { value = JOptionPane.showOptionDialog(Gui.frame, reactantsPanel, "Reactants Editor", JOptionPane.YES_NO_OPTION, JOptionPane.PLAIN_MESSAGE, null, options, options[0]); } } if (value == JOptionPane.NO_OPTION) { return; } } /** * Remove a reaction */ private void removeReaction() { int index = reactions.getSelectedIndex(); if (index != -1) { String selected = ((String) reactions.getSelectedValue()).split(" ")[0]; Reaction reaction = bioModel.getSBMLDocument().getModel().getReaction(selected); if (BioModel.isProductionReaction(reaction)) { bioModel.removePromoter(selected.replace("Production_", "")); } else { bioModel.removeReaction(selected); reactions.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); reacts = (String[]) Utility.remove(reactions, reacts); reactions.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); if (index < reactions.getModel().getSize()) { reactions.setSelectedIndex(index); } else { reactions.setSelectedIndex(index - 1); } } modelEditor.setDirty(true); bioModel.makeUndoPoint(); } } /** * Remove the reaction */ public static void removeTheReaction(BioModel gcm, String selected) { Reaction tempReaction = gcm.getSBMLDocument().getModel().getReaction(selected); ListOf<Reaction> r = gcm.getSBMLDocument().getModel().getListOfReactions(); for (int i = 0; i < gcm.getSBMLDocument().getModel().getReactionCount(); i++) { if (r.get(i).getId().equals(tempReaction.getId())) { r.remove(i); } } } /** * Remove a reactant from a reaction */ private void removeReactant() { int index = reactants.getSelectedIndex(); if (index != -1) { String v = ((String) reactants.getSelectedValue()).split(" ")[0]; for (int i = 0; i < changedReactants.size(); i++) { if (changedReactants.get(i).getSpecies().equals(v) && !SBMLutilities.variableInUse(bioModel.getSBMLDocument(), changedReactants.get(i).getId(), false, true,true)) { changedReactants.remove(i); reactants.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); reacta = (String[]) Utility.remove(reactants, reacta); reactants.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); if (index < reactants.getModel().getSize()) { reactants.setSelectedIndex(index); } else { reactants.setSelectedIndex(index - 1); } modelEditor.setDirty(true); bioModel.makeUndoPoint(); } } } } /** * Remove a product from a reaction */ private void removeProduct() { int index = products.getSelectedIndex(); if (index != -1) { String v = ((String) products.getSelectedValue()).split(" ")[0]; for (int i = 0; i < changedProducts.size(); i++) { if (changedProducts.get(i).getSpecies().equals(v) && !SBMLutilities.variableInUse(bioModel.getSBMLDocument(), changedProducts.get(i).getId(), false, true, true)) { changedProducts.remove(i); products.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); proda = (String[]) Utility.remove(products, proda); products.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); if (index < products.getModel().getSize()) { products.setSelectedIndex(index); } else { products.setSelectedIndex(index - 1); } modelEditor.setDirty(true); bioModel.makeUndoPoint(); } } } } /** * Remove a modifier from a reaction */ private void removeModifier() { int index = modifiers.getSelectedIndex(); if (index != -1) { String v = ((String) modifiers.getSelectedValue()).split(" ")[0]; for (int i = 0; i < changedModifiers.size(); i++) { if (changedModifiers.get(i).getSpecies().equals(v)) { if (!changedModifiers.get(i).isSetSBOTerm() || changedModifiers.get(i).getSBOTerm()!=GlobalConstants.SBO_PROMOTER_MODIFIER) { changedModifiers.remove(i); } else { return; } } } modifiers.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); modifierArray = (String[]) Utility.remove(modifiers, modifierArray); modifiers.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); if (index < modifiers.getModel().getSize()) { modifiers.setSelectedIndex(index); } else { modifiers.setSelectedIndex(index - 1); } modelEditor.setDirty(true); bioModel.makeUndoPoint(); } } private static String indexedSpeciesRef(SimpleSpeciesReference reference) { String result = reference.getSpecies(); ArraysSBasePlugin sBasePlugin = SBMLutilities.getArraysSBasePlugin(reference); for(int i = sBasePlugin.getIndexCount()-1; i>=0; i Index index = sBasePlugin.getIndex(i); result += "[" + SBMLutilities.myFormulaToString(index.getMath()) + "]"; } return result; } private static String indexedSpeciesRefId(SimpleSpeciesReference reference) { String result = reference.getId(); ArraysSBasePlugin sBasePlugin = SBMLutilities.getArraysSBasePlugin(reference); for(int i = sBasePlugin.getIndexCount()-1; i>=0; i Index index = sBasePlugin.getIndex(i); result += "[" + SBMLutilities.myFormulaToString(index.getMath()) + "]"; } return result; } /** * Remove a function if not in use */ private void useMassAction() { String kf; String kr; if (changedParameters.size() == 0) { JOptionPane.showMessageDialog(Gui.frame, "Unable to create mass action kinetic law.\n" + "Requires at least one local parameter.", "Unable to Create Kinetic Law", JOptionPane.ERROR_MESSAGE); return; } else if (changedParameters.size() == 1) { kf = changedParameters.get(0).getId(); kr = changedParameters.get(0).getId(); } else { kf = changedParameters.get(0).getId(); kr = changedParameters.get(1).getId(); } String kinetic = kf; boolean addEquil = false; String equilExpr = ""; for (SpeciesReference s : changedReactants) { if (SBMLutilities.getArraysSBasePlugin(s).getDimensionCount()>0) { JOptionPane.showMessageDialog(Gui.frame, "Unable to create mass action kinetic law.\n" + "Dimensions on species references not currently supported for use mass action button.", "Unable to Create Kinetic Law", JOptionPane.ERROR_MESSAGE); return; } if (s.isSetId()) { addEquil = true; equilExpr += indexedSpeciesRefId(s); } else { equilExpr += s.getStoichiometry(); } } if (addEquil) { kinetic += " * pow(" + kf + "/" + kr + "," + equilExpr + "-2)"; } for (SpeciesReference s : changedReactants) { if (s.isSetId()) { kinetic += " * pow(" + indexedSpeciesRef(s) + ", " + indexedSpeciesRefId(s) + ")"; } else { if (s.getStoichiometry() == 1) { kinetic += " * " + indexedSpeciesRef(s); } else { kinetic += " * pow(" + indexedSpeciesRef(s) + ", " + s.getStoichiometry() + ")"; } } } for (ModifierSpeciesReference s : changedModifiers) { if (SBMLutilities.getArraysSBasePlugin(s).getDimensionCount()>0) { JOptionPane.showMessageDialog(Gui.frame, "Unable to create mass action kinetic law.\n" + "Dimensions on species references not currently supported for use mass action button.", "Unable to Create Kinetic Law", JOptionPane.ERROR_MESSAGE); return; } kinetic += " * " + indexedSpeciesRef(s); } if (reacReverse.getSelectedItem().equals("true")) { kinetic += " - " + kr; addEquil = false; equilExpr = ""; for (SpeciesReference s : changedProducts) { if (SBMLutilities.getArraysSBasePlugin(s).getDimensionCount()>0) { JOptionPane.showMessageDialog(Gui.frame, "Unable to create mass action kinetic law.\n" + "Dimensions on species references not currently supported for use mass action button.", "Unable to Create Kinetic Law", JOptionPane.ERROR_MESSAGE); return; } if (s.isSetId()) { addEquil = true; equilExpr += indexedSpeciesRefId(s); } else { equilExpr += s.getStoichiometry(); } } if (addEquil) { kinetic += " * pow(" + kf + "/" + kr + "," + equilExpr + "-1)"; } for (SpeciesReference s : changedProducts) { if (s.isSetId()) { kinetic += " * pow(" + indexedSpeciesRef(s) + ", " + indexedSpeciesRefId(s) + ")"; } else { if (s.getStoichiometry() == 1) { kinetic += " * " + indexedSpeciesRef(s); } else { kinetic += " * pow(" + indexedSpeciesRef(s) + ", " + s.getStoichiometry() + ")"; } } } for (ModifierSpeciesReference s : changedModifiers) { kinetic += " * " + indexedSpeciesRef(s); } } kineticLaw.setText(kinetic); modelEditor.setDirty(true); bioModel.makeUndoPoint(); } /** * Remove a reaction parameter, if allowed */ private void reacRemoveParam() { int index = reacParameters.getSelectedIndex(); if (index != -1) { String v = ((String) reacParameters.getSelectedValue()).split(" ")[0]; if (reactions.getSelectedIndex() != -1) { String kinetic = kineticLaw.getText().trim(); String[] vars = new String[0]; if (!kinetic.equals("")) { vars = SBMLutilities.myFormulaToString(SBMLutilities.myParseFormula(kineticLaw.getText().trim())).split(" |\\(|\\)|\\,"); } for (int j = 0; j < vars.length; j++) { if (vars[j].equals(v)) { JOptionPane.showMessageDialog(Gui.frame, "Cannot remove reaction parameter because it is used in the kinetic law.", "Cannot Remove Parameter", JOptionPane.ERROR_MESSAGE); return; } } } for (int i = 0; i < changedParameters.size(); i++) { if (changedParameters.get(i).getId().equals(v)) { changedParameters.remove(i); } } thisReactionParams.remove(v); reacParameters.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); reacParams = (String[]) Utility.remove(reacParameters, reacParams); reacParameters.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); if (index < reacParameters.getModel().getSize()) { reacParameters.setSelectedIndex(index); } else { reacParameters.setSelectedIndex(index - 1); } modelEditor.setDirty(true); bioModel.makeUndoPoint(); } } private void removeLocalParameter(String v) { for (int i = 0; i < reacParameters.getModel().getSize(); i++) { if (((String)reacParameters.getModel().getElementAt(i)).split(" ")[0].equals(v)) { reacParameters.setSelectedIndex(i); break; } } for (int i = 0; i < changedParameters.size(); i++) { if (changedParameters.get(i).getId().equals(v)) { changedParameters.remove(i); } } thisReactionParams.remove(v); reacParameters.setSelectionMode(ListSelectionModel.MULTIPLE_INTERVAL_SELECTION); reacParams = (String[]) Utility.remove(reacParameters, reacParams); reacParameters.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); reacParameters.setSelectedIndex(0); modelEditor.setDirty(true); bioModel.makeUndoPoint(); } /** * Check the units of a kinetic law */ public boolean checkKineticLawUnits(KineticLaw law) { if (law.containsUndeclaredUnits()) { if (Gui.getCheckUndeclared()) { JOptionPane.showMessageDialog(Gui.frame, "Kinetic law contains literals numbers or parameters with undeclared units.\n" + "Therefore, it is not possible to completely verify the consistency of the units.", "Contains Undeclared Units", JOptionPane.WARNING_MESSAGE); } return false; } else if (Gui.getCheckUnits()) { if (SBMLutilities.checkUnitsInKineticLaw(bioModel.getSBMLDocument(), law)) { JOptionPane.showMessageDialog(Gui.frame, "Kinetic law units should be substance / time.", "Units Do Not Match", JOptionPane.ERROR_MESSAGE); return true; } } return false; } /** * Checks the string to see if there are any errors. Retruns true if there are no errors, else returns false. */ public boolean fluxBoundisGood(String s, String reactionId){ if(s.contains("<=")){ String [] correctnessTest = s.split("<="); if(correctnessTest.length == 3){ try{ Double.parseDouble(correctnessTest[0]); } catch(NumberFormatException e){ JOptionPane.showMessageDialog(Gui.frame, correctnessTest[0]+ " has to be a double.", "Incorrect Element", JOptionPane.ERROR_MESSAGE); return false; } try{ Double.parseDouble(correctnessTest[2]); } catch(NumberFormatException e){ JOptionPane.showMessageDialog(Gui.frame, correctnessTest[2] + " has to be a double.", "Incorrect Element", JOptionPane.ERROR_MESSAGE); return false; } if(Double.parseDouble(correctnessTest[0]) > Double.parseDouble(correctnessTest[2])){ JOptionPane.showMessageDialog(Gui.frame, correctnessTest[0] + " must be less than " + correctnessTest[2], "Imbalance with Bounds", JOptionPane.ERROR_MESSAGE); return false; } return true; } else if(correctnessTest.length == 2){ if(!correctnessTest[0].equals(reactionId) && !correctnessTest[1].equals(reactionId)){ JOptionPane.showMessageDialog(Gui.frame, "Must have "+ reactionId + " in the equation.", "No Reaction", JOptionPane.ERROR_MESSAGE); return false; } if(correctnessTest[0].equals(reactionId)){ try{ Double.parseDouble(correctnessTest[1]); } catch(Exception e){ if(e.equals(new NumberFormatException())){ JOptionPane.showMessageDialog(Gui.frame, correctnessTest[1] + " has to be a double.", "Incorrect Element", JOptionPane.ERROR_MESSAGE); return false; } } } else{ try{ Double.parseDouble(correctnessTest[0]); } catch(Exception e){ if(e.equals(new NumberFormatException())){ JOptionPane.showMessageDialog(Gui.frame, correctnessTest[0] + " has to be a double.", "Incorrect Element", JOptionPane.ERROR_MESSAGE); return false; } } } return true; } else{ JOptionPane.showMessageDialog(Gui.frame, "Wrong number of elements.", "Bad Format", JOptionPane.ERROR_MESSAGE); return false; } } else if(s.contains(">=")){ String [] correctnessTest = s.split(">="); if(correctnessTest.length == 3){ try{ Double.parseDouble(correctnessTest[0]); } catch(NumberFormatException e){ JOptionPane.showMessageDialog(Gui.frame, correctnessTest[0]+ " has to be a double.", "Incorrect Element", JOptionPane.ERROR_MESSAGE); return false; } try{ Double.parseDouble(correctnessTest[2]); } catch(NumberFormatException e){ JOptionPane.showMessageDialog(Gui.frame, correctnessTest[2] + " has to be a double.", "Incorrect Element", JOptionPane.ERROR_MESSAGE); return false; } if(Double.parseDouble(correctnessTest[0]) < Double.parseDouble(correctnessTest[2])){ JOptionPane.showMessageDialog(Gui.frame, correctnessTest[0] + " must be greater than " + correctnessTest[2], "Imbalance with Bounds", JOptionPane.ERROR_MESSAGE); return false; } return true; } else if(correctnessTest.length == 2){ if(!correctnessTest[0].equals(reactionId) && !correctnessTest[1].equals(reactionId)){ JOptionPane.showMessageDialog(Gui.frame, "Must have "+ reactionId + " in the equation.", "No Reaction", JOptionPane.ERROR_MESSAGE); return false; } if(correctnessTest[0].equals(reactionId)){ try{ Double.parseDouble(correctnessTest[1]); } catch(Exception e){ if(e.equals(new NumberFormatException())){ JOptionPane.showMessageDialog(Gui.frame, correctnessTest[1] + " has to be a double.", "Incorrect Element", JOptionPane.ERROR_MESSAGE); return false; } } } else{ try{ Double.parseDouble(correctnessTest[0]); } catch(Exception e){ if(e.equals(new NumberFormatException())){ JOptionPane.showMessageDialog(Gui.frame, correctnessTest[0] + " has to be a double.", "Incorrect Element", JOptionPane.ERROR_MESSAGE); return false; } } } return true; } else{ JOptionPane.showMessageDialog(Gui.frame, "Wrong number of elements.", "Bad Format", JOptionPane.ERROR_MESSAGE); return false; } } else if(s.contains("=")){ String [] correctnessTest = s.split("="); if(correctnessTest.length == 2){ if(!correctnessTest[0].equals(reactionId) && !correctnessTest[1].equals(reactionId)){ JOptionPane.showMessageDialog(Gui.frame, "Must have "+ reactionId + " in the equation.", "No Reaction", JOptionPane.ERROR_MESSAGE); return false; } if(correctnessTest[0].equals(reactionId)){ try{ Double.parseDouble(correctnessTest[1]); } catch(Exception e){ if(e.equals(new NumberFormatException())){ JOptionPane.showMessageDialog(Gui.frame, correctnessTest[1] + " has to be a double.", "Incorrect Element", JOptionPane.ERROR_MESSAGE); return false; } } } else{ try{ Double.parseDouble(correctnessTest[0]); } catch(Exception e){ if(e.equals(new NumberFormatException())){ JOptionPane.showMessageDialog(Gui.frame, correctnessTest[0] + " has to be a double.", "Incorrect Element", JOptionPane.ERROR_MESSAGE); return false; } } } return true; } else{ JOptionPane.showMessageDialog(Gui.frame, "Wrong number of elements.", "Bad Format", JOptionPane.ERROR_MESSAGE); return false; } } else{ JOptionPane.showMessageDialog(Gui.frame, "Need Operations.", "Bad Format", JOptionPane.ERROR_MESSAGE); return false; } } public void setPanels(InitialAssignments initialsPanel, Rules rulesPanel) { this.initialsPanel = initialsPanel; this.rulesPanel = rulesPanel; } @Override public void actionPerformed(ActionEvent e) { // if the add compartment type button is clicked // if the add species type button is clicked // if the add compartment button is clicked // if the add parameters button is clicked // if the add reactions button is clicked if (e.getSource() == addReac) { reactionsEditor(bioModel, "Add", "", false); } // if the edit reactions button is clicked else if (e.getSource() == editReac) { if (reactions.getSelectedIndex() == -1) { JOptionPane.showMessageDialog(Gui.frame, "No reaction selected.", "Must Select A Reaction", JOptionPane.ERROR_MESSAGE); return; } reactionsEditor(bioModel, "OK", ((String) reactions.getSelectedValue()).split(" ")[0], false); initialsPanel.refreshInitialAssignmentPanel(bioModel); rulesPanel.refreshRulesPanel(); } // if the remove reactions button is clicked else if (e.getSource() == removeReac) { removeReaction(); } // if the add reactions parameters button is clicked else if (e.getSource() == reacAddParam) { reacParametersEditor(bioModel,"Add"); } // if the edit reactions parameters button is clicked else if (e.getSource() == reacEditParam) { reacParametersEditor(bioModel,"OK"); } // if the remove reactions parameters button is clicked else if (e.getSource() == reacRemoveParam) { reacRemoveParam(); } // if the add reactants button is clicked else if (e.getSource() == addReactant) { reactantsEditor(bioModel, "Add", "", null, false, null); } // if the edit reactants button is clicked else if (e.getSource() == editReactant) { if (reactants.getSelectedIndex() == -1) { JOptionPane.showMessageDialog(Gui.frame, "No reactant selected.", "Must Select A Reactant", JOptionPane.ERROR_MESSAGE); return; } reactantsEditor(bioModel, "OK", ((String) reactants.getSelectedValue()).split(" ")[0], null, false, null); initialsPanel.refreshInitialAssignmentPanel(bioModel); rulesPanel.refreshRulesPanel(); } // if the remove reactants button is clicked else if (e.getSource() == removeReactant) { removeReactant(); } // if the add products button is clicked else if (e.getSource() == addProduct) { productsEditor(bioModel, "Add", "", null, false); } // if the edit products button is clicked else if (e.getSource() == editProduct) { if (products.getSelectedIndex() == -1) { JOptionPane.showMessageDialog(Gui.frame, "No product selected.", "Must Select A Product", JOptionPane.ERROR_MESSAGE); return; } productsEditor(bioModel, "OK", ((String) products.getSelectedValue()).split(" ")[0], null, false); initialsPanel.refreshInitialAssignmentPanel(bioModel); rulesPanel.refreshRulesPanel(); } // if the remove products button is clicked else if (e.getSource() == removeProduct) { removeProduct(); } // if the add modifiers button is clicked else if (e.getSource() == addModifier) { modifiersEditor(bioModel, "Add", "", null, false); } // if the edit modifiers button is clicked else if (e.getSource() == editModifier) { if (modifiers.getSelectedIndex() == -1) { JOptionPane.showMessageDialog(Gui.frame, "No modifier selected.", "Must Select A Modifier", JOptionPane.ERROR_MESSAGE); return; } modifiersEditor(bioModel,"OK", ((String) modifiers.getSelectedValue()).split(" ")[0], null, false); } // if the remove modifiers button is clicked else if (e.getSource() == removeModifier) { removeModifier(); } // if the clear button is clicked else if (e.getSource() == clearKineticLaw) { kineticLaw.setText(""); modelEditor.setDirty(true); bioModel.makeUndoPoint(); } // if the use mass action button is clicked else if (e.getSource() == useMassAction) { useMassAction(); } } @Override public void mouseClicked(MouseEvent e) { if (e.getClickCount() == 2) { if (e.getSource() == reactions) { if (reactions.getSelectedIndex() == -1) { JOptionPane.showMessageDialog(Gui.frame, "No reaction selected.", "Must Select A Reaction", JOptionPane.ERROR_MESSAGE); return; } reactionsEditor(bioModel, "OK", ((String) reactions.getSelectedValue()).split(" ")[0], false); initialsPanel.refreshInitialAssignmentPanel(bioModel); rulesPanel.refreshRulesPanel(); } else if (e.getSource() == reacParameters) { reacParametersEditor(bioModel,"OK"); } else if (e.getSource() == reactants) { if (!paramsOnly) { if (reactants.getSelectedIndex() == -1) { JOptionPane.showMessageDialog(Gui.frame, "No reactant selected.", "Must Select A Reactant", JOptionPane.ERROR_MESSAGE); return; } reactantsEditor(bioModel, "OK", ((String) reactants.getSelectedValue()).split(" ")[0], null, false, null); initialsPanel.refreshInitialAssignmentPanel(bioModel); rulesPanel.refreshRulesPanel(); } } else if (e.getSource() == products) { if (!paramsOnly) { if (products.getSelectedIndex() == -1) { JOptionPane.showMessageDialog(Gui.frame, "No product selected.", "Must Select A Product", JOptionPane.ERROR_MESSAGE); return; } productsEditor(bioModel, "OK", ((String) products.getSelectedValue()).split(" ")[0], null, false); initialsPanel.refreshInitialAssignmentPanel(bioModel); rulesPanel.refreshRulesPanel(); } } else if (e.getSource() == modifiers) { if (!paramsOnly) { if (modifiers.getSelectedIndex() == -1) { JOptionPane.showMessageDialog(Gui.frame, "No modifier selected.", "Must Select A Modifier", JOptionPane.ERROR_MESSAGE); return; } modifiersEditor(bioModel,"OK", ((String) modifiers.getSelectedValue()).split(" ")[0], null, false); } } } } /** * Refresh reaction panel */ public void refreshReactionPanel(BioModel gcm) { String selectedReactionId = ""; if (!reactions.isSelectionEmpty()) { selectedReactionId = ((String) reactions.getSelectedValue()).split(" ")[0]; } this.bioModel = gcm; Model model = gcm.getSBMLDocument().getModel(); ListOf<Reaction> listOfReactions = model.getListOfReactions(); reacts = new String[model.getReactionCount()]; for (int i = 0; i < model.getReactionCount(); i++) { Reaction reaction = listOfReactions.get(i); reacts[i] = reaction.getId(); if (paramsOnly) { if (!reaction.isSetKineticLaw()) continue; ListOf<LocalParameter> params = reaction.getKineticLaw().getListOfLocalParameters(); for (int j = 0; j < reaction.getKineticLaw().getLocalParameterCount(); j++) { LocalParameter paramet = (params.get(j)); for (int k = 0; k < parameterChanges.size(); k++) { if (parameterChanges.get(k).split(" ")[0].equals(reaction.getId() + "/" + paramet.getId())) { String[] splits = parameterChanges.get(k).split(" "); if (splits[splits.length - 2].equals("Modified") || splits[splits.length - 2].equals("Custom")) { String value = splits[splits.length - 1]; paramet.setValue(Double.parseDouble(value)); } else if (splits[splits.length - 2].equals("Sweep")) { String value = splits[splits.length - 1]; paramet.setValue(Double.parseDouble(value.split(",")[0].substring(1).trim())); } if (!reacts[i].contains("Modified")) { reacts[i] += " Modified"; } } } } } } Utility.sort(reacts); int selected = 0; for (int i = 0; i < reacts.length; i++) { if (reacts[i].split(" ")[0].equals(selectedReactionId)) { selected = i; } } reactions.setListData(reacts); reactions.setSelectedIndex(selected); } /** * This method currently does nothing. */ @Override public void mouseEntered(MouseEvent e) { } /** * This method currently does nothing. */ @Override public void mouseExited(MouseEvent e) { } /** * This method currently does nothing. */ @Override public void mousePressed(MouseEvent e) { } /** * This method currently does nothing. */ @Override public void mouseReleased(MouseEvent e) { } }
package org.nextrtc.signalingserver.domain; import static org.apache.commons.lang3.StringUtils.EMPTY; import static org.hamcrest.Matchers.is; import static org.junit.Assert.assertThat; import static org.junit.Assert.assertTrue; import static org.mockito.Mockito.mock; import static org.mockito.Mockito.when; import static org.nextrtc.signalingserver.api.annotation.NextRTCEvents.CONVERSATION_CREATED; import static org.nextrtc.signalingserver.api.annotation.NextRTCEvents.MEMBER_LOCAL_STREAM_CREATED; import static org.nextrtc.signalingserver.api.annotation.NextRTCEvents.SESSION_STARTED; import java.util.List; import javax.websocket.CloseReason; import javax.websocket.Session; import org.junit.Before; import org.junit.Rule; import org.junit.Test; import org.junit.rules.ExpectedException; import org.nextrtc.signalingserver.BaseTest; import org.nextrtc.signalingserver.EventChecker; import org.nextrtc.signalingserver.MessageMatcher; import org.nextrtc.signalingserver.api.NextRTCEvent; import org.nextrtc.signalingserver.api.annotation.NextRTCEventListener; import org.nextrtc.signalingserver.domain.ServerTest.LocalStreamCreated; import org.nextrtc.signalingserver.domain.ServerTest.ServerEventCheck; import org.nextrtc.signalingserver.exception.Exceptions; import org.nextrtc.signalingserver.exception.SignalingException; import org.nextrtc.signalingserver.repository.Members; import org.springframework.beans.factory.annotation.Autowired; import org.springframework.test.context.ContextConfiguration; @ContextConfiguration(classes = { ServerEventCheck.class, LocalStreamCreated.class }) public class ServerTest extends BaseTest { @NextRTCEventListener({ SESSION_STARTED, CONVERSATION_CREATED }) public static class ServerEventCheck extends EventChecker { } @Rule public ExpectedException expect = ExpectedException.none(); @Autowired private Server server; @Autowired private Members members; @Autowired private ServerEventCheck eventCheckerCall; @Test public void shouldThrowExceptionWhenMemberDoesntExists() throws Exception { // given Session session = mock(Session.class); when(session.getId()).thenReturn("s1"); // then expect.expect(SignalingException.class); expect.expectMessage(Exceptions.MEMBER_NOT_FOUND.name()); // when server.handle(mock(Message.class), session); } @Test public void shouldRegisterUserOnWebSocketConnection() throws Exception { // given Session session = mock(Session.class); when(session.getId()).thenReturn("s1"); // when server.register(session); // then assertTrue(members.findBy("s1").isPresent()); } @Test public void shouldCreateConversationOnCreateSignal() throws Exception { // given Session session = mockSession("s1"); server.register(session); // when server.handle(Message.create() .signal("create") .build(), session); // then List<NextRTCEvent> events = eventCheckerCall.getEvents(); assertThat(events.size(), is(2)); } @Test public void shouldCreateConversation() throws Exception { // given MessageMatcher s1Matcher = new MessageMatcher(); MessageMatcher s2Matcher = new MessageMatcher(); Session s1 = mockSession("s1", s1Matcher); Session s2 = mockSession("s2", s2Matcher); server.register(s1); server.register(s2); // when server.handle(Message.create() .signal("create") .build(), s1); // then assertThat(s1Matcher.getMessages().size(), is(1)); assertThat(s1Matcher.getMessage().getSignal(), is("created")); assertThat(s2Matcher.getMessages().size(), is(0)); } @Test public void shouldCreateConversationThenJoinAndSendOfferRequest() throws Exception { // given MessageMatcher s1Matcher = new MessageMatcher(); MessageMatcher s2Matcher = new MessageMatcher(); Session s1 = mockSession("s1", s1Matcher); Session s2 = mockSession("s2", s2Matcher); server.register(s1); server.register(s2); // when server.handle(Message.create() .signal("create") .build(), s1); String conversationKey = s1Matcher.getMessage().getContent(); // s1Matcher.reset(); server.handle(Message.create() .signal("join") .content(conversationKey) .build(), s2); // then assertThat(s1Matcher.getMessages().size(), is(3)); assertMessage(s1Matcher, 0, EMPTY, "s1", "created", conversationKey); assertMessage(s1Matcher, 1, "s2", "s1", "joined", EMPTY); assertMessage(s1Matcher, 2, "s2", "s1", "offerRequest", EMPTY); assertThat(s2Matcher.getMessages().size(), is(1)); assertMessage(s2Matcher, 0, EMPTY, "s2", "joined", conversationKey); } @NextRTCEventListener({ MEMBER_LOCAL_STREAM_CREATED }) public static class LocalStreamCreated extends EventChecker { } @Autowired private LocalStreamCreated eventLocalStream; @Test public void shouldCreateConversationJoinMemberAndPassOfferResponseToRestMembers() throws Exception { // given MessageMatcher s1Matcher = new MessageMatcher(); MessageMatcher s2Matcher = new MessageMatcher(); Session s1 = mockSession("s1", s1Matcher); Session s2 = mockSession("s2", s2Matcher); server.register(s1); server.register(s2); server.handle(Message.create() .signal("create") .build(), s1); String conversationKey = s1Matcher.getMessage().getContent(); server.handle(Message.create() .signal("join") .content(conversationKey) .build(), s2); s1Matcher.reset(); s2Matcher.reset(); // when // s2 has to create local stream server.handle(Message.create() .to("s2") .signal("offerResponse") .content("s2 spd") .build(), s1); // then assertThat(s1Matcher.getMessages().size(), is(1)); assertMessage(s1Matcher, 0, "s2", "s1", "answerRequest", "s2 spd"); assertThat(s2Matcher.getMessages().size(), is(0)); } @Test public void shouldCreateConversationJoinMemberAndPassOfferResponseToRestTwoMembers() throws Exception { // given MessageMatcher s1Matcher = new MessageMatcher(); MessageMatcher s2Matcher = new MessageMatcher(); MessageMatcher s3Matcher = new MessageMatcher(); Session s1 = mockSession("s1", s1Matcher); Session s2 = mockSession("s2", s2Matcher); Session s3 = mockSession("s3", s3Matcher); server.register(s1); server.register(s2); server.register(s3); server.handle(Message.create() .signal("create") .build(), s1); String conversationKey = s1Matcher.getMessage().getContent(); server.handle(Message.create() .signal("join") .content(conversationKey) .build(), s2); server.handle(Message.create() .signal("join") .content(conversationKey) .build(), s3); s1Matcher.reset(); s2Matcher.reset(); s3Matcher.reset(); // when // s2 has to create local stream server.handle(Message.create() .to("s1") .signal("offerResponse") .content("s2 spd") .build(), s2); // s3 has to create local stream server.handle(Message.create() .to("s1") .signal("offerResponse") .content("s3 spd") .build(), s3); // then assertThat(s1Matcher.getMessages().size(), is(2)); assertMessage(s1Matcher, 0, "s2", "s1", "answerRequest", "s2 spd"); assertMessage(s1Matcher, 1, "s3", "s1", "answerRequest", "s3 spd"); assertThat(s2Matcher.getMessages().size(), is(0)); assertThat(s3Matcher.getMessages().size(), is(0)); } @Test public void shouldExchangeSpds() throws Exception { // given MessageMatcher s1Matcher = new MessageMatcher(); MessageMatcher s2Matcher = new MessageMatcher(); Session s1 = mockSession("s1", s1Matcher); Session s2 = mockSession("s2", s2Matcher); server.register(s1); server.register(s2); server.handle(Message.create() .signal("create") .build(), s1); // -> created String conversationKey = s1Matcher.getMessage().getContent(); server.handle(Message.create() .signal("join") .content(conversationKey) .build(), s2); // -> joined // -> offerRequest server.handle(Message.create() .to("s1") .signal("offerResponse") .content("s2 spd") .build(), s2); // -> answerRequest s1Matcher.reset(); s2Matcher.reset(); // when server.handle(Message.create() .to("s2") .signal("answerResponse") .content("s1 spd") .build(), s1); // then assertThat(s2Matcher.getMessages().size(), is(1)); assertMessage(s2Matcher, 0, "s1", "s2", "finalize", "s1 spd"); assertThat(s1Matcher.getMessages().size(), is(0)); } @Test public void shouldExchangeCandidates() throws Exception { // given MessageMatcher s1Matcher = new MessageMatcher(); MessageMatcher s2Matcher = new MessageMatcher(); Session s1 = mockSession("s1", s1Matcher); Session s2 = mockSession("s2", s2Matcher); server.register(s1); server.register(s2); server.handle(Message.create() .signal("create") .build(), s1); // -> created String conversationKey = s1Matcher.getMessage().getContent(); server.handle(Message.create() .signal("join") .content(conversationKey) .build(), s2); // -> joined // -> offerRequest server.handle(Message.create() .to("s1") .signal("offerResponse") .content("s2 spd") .build(), s2); // -> answerRequest server.handle(Message.create() .to("s2") .signal("answerResponse") .content("s1 spd") .build(), s1); // -> finalize s1Matcher.reset(); s2Matcher.reset(); server.handle(Message.create() .to("s1") .signal("candidate") .content("candidate s2") .build(), s2); server.handle(Message.create() .to("s2") .signal("candidate") .content("candidate s1") .build(), s1); // when // then assertThat(s1Matcher.getMessages().size(), is(1)); assertMessage(s1Matcher, 0, "s2", "s1", "candidate", "candidate s2"); assertThat(s2Matcher.getMessages().size(), is(1)); assertMessage(s2Matcher, 0, "s1", "s2", "candidate", "candidate s1"); } @Test public void shouldUnregisterSession() throws Exception { // given MessageMatcher s1Matcher = new MessageMatcher(); MessageMatcher s2Matcher = new MessageMatcher(); Session s1 = mockSession("s1", s1Matcher); Session s2 = mockSession("s2", s2Matcher); server.register(s1); server.register(s2); server.handle(Message.create() .signal("create") .build(), s1); // -> created String conversationKey = s1Matcher.getMessage().getContent(); server.handle(Message.create() .signal("join") .content(conversationKey) .build(), s2); s1Matcher.reset(); s2Matcher.reset(); server.unregister(s1, mock(CloseReason.class)); // when // then assertThat(s1Matcher.getMessages().size(), is(0)); assertThat(s2Matcher.getMessages().size(), is(1)); assertMessage(s2Matcher, 0, "s1", "s2", "left", EMPTY); } private void assertMessage(MessageMatcher matcher, int number, String from, String to, String signal, String content) { assertThat(matcher.getMessage(number).getFrom(), is(from)); assertThat(matcher.getMessage(number).getTo(), is(to)); assertThat(matcher.getMessage(number).getSignal(), is(signal)); assertThat(matcher.getMessage(number).getContent(), is(content)); } @Before public void resetObjects() { eventCheckerCall.reset(); eventLocalStream.reset(); members.unregister("s1"); members.unregister("s2"); members.unregister("s3"); } }
package org.sdnplatform.sync.internal; import static org.junit.Assert.assertEquals; import static org.junit.Assert.assertNotNull; import static org.junit.Assert.assertNull; import static org.junit.Assert.assertTrue; import static org.junit.Assert.fail; import java.io.File; import java.util.ArrayList; import java.util.Arrays; import java.util.Collections; import java.util.HashMap; import java.util.HashSet; import java.util.Iterator; import java.util.List; import java.util.Map.Entry; import org.junit.After; import org.junit.Before; import org.junit.Ignore; import org.junit.Rule; import org.junit.Test; import org.junit.rules.TemporaryFolder; import org.sdnplatform.sync.IClosableIterator; import org.sdnplatform.sync.IInconsistencyResolver; import org.sdnplatform.sync.IStoreClient; import org.sdnplatform.sync.IStoreListener; import org.sdnplatform.sync.IStoreListener.UpdateType; import org.sdnplatform.sync.ISyncService; import org.sdnplatform.sync.ISyncService.Scope; import org.sdnplatform.sync.Versioned; import org.sdnplatform.sync.error.ObsoleteVersionException; import org.sdnplatform.sync.internal.config.Node; import org.sdnplatform.sync.internal.config.PropertyCCProvider; import org.sdnplatform.sync.internal.store.Key; import org.sdnplatform.sync.internal.store.TBean; import org.sdnplatform.sync.internal.util.CryptoUtil; import org.sdnplatform.sync.internal.version.VectorClock; import org.slf4j.Logger; import org.slf4j.LoggerFactory; import com.fasterxml.jackson.core.type.TypeReference; import com.fasterxml.jackson.databind.ObjectMapper; import net.floodlightcontroller.core.module.FloodlightModuleContext; import net.floodlightcontroller.debugcounter.IDebugCounterService; import net.floodlightcontroller.debugcounter.MockDebugCounterService; import net.floodlightcontroller.threadpool.IThreadPoolService; import net.floodlightcontroller.threadpool.ThreadPool; public class SyncManagerTest { protected static Logger logger = LoggerFactory.getLogger(SyncManagerTest.class); protected FloodlightModuleContext[] moduleContexts; protected SyncManager[] syncManagers; protected final static ObjectMapper mapper = new ObjectMapper(); protected String nodeString; ArrayList<Node> nodes; ThreadPool tp; @Rule public TemporaryFolder keyStoreFolder = new TemporaryFolder(); protected File keyStoreFile; protected String keyStorePassword = "verysecurepassword"; protected void setupSyncManager(FloodlightModuleContext fmc, SyncManager syncManager, Node thisNode) throws Exception { fmc.addService(IThreadPoolService.class, tp); fmc.addService(IDebugCounterService.class, new MockDebugCounterService()); fmc.addConfigParam(syncManager, "configProviders", PropertyCCProvider.class.getName()); fmc.addConfigParam(syncManager, "nodes", nodeString); fmc.addConfigParam(syncManager, "thisNodeId", ""+thisNode.getNodeId()); fmc.addConfigParam(syncManager, "persistenceEnabled", "false"); fmc.addConfigParam(syncManager, "authScheme", "CHALLENGE_RESPONSE"); fmc.addConfigParam(syncManager, "keyStorePath", keyStoreFile.getAbsolutePath()); fmc.addConfigParam(syncManager, "keyStorePassword", keyStorePassword); tp.init(fmc); syncManager.init(fmc); tp.startUp(fmc); syncManager.startUp(fmc); syncManager.registerStore("global", Scope.GLOBAL); syncManager.registerStore("local", Scope.LOCAL); } @Before public void setUp() throws Exception { keyStoreFile = new File(keyStoreFolder.getRoot(), "keystore.jceks"); CryptoUtil.writeSharedSecret(keyStoreFile.getAbsolutePath(), keyStorePassword, CryptoUtil.secureRandom(16)); tp = new ThreadPool(); syncManagers = new SyncManager[4]; moduleContexts = new FloodlightModuleContext[4]; nodes = new ArrayList<>(); nodes.add(new Node("localhost", 40101, (short)1, (short)1)); nodes.add(new Node("localhost", 40102, (short)2, (short)2)); nodes.add(new Node("localhost", 40103, (short)3, (short)1)); nodes.add(new Node("localhost", 40104, (short)4, (short)2)); nodeString = mapper.writeValueAsString(nodes); for(int i = 0; i < 4; i++) { moduleContexts[i] = new FloodlightModuleContext(); syncManagers[i] = new SyncManager(); setupSyncManager(moduleContexts[i], syncManagers[i], nodes.get(i)); } } @After public void tearDown() { tp.getScheduledExecutor().shutdownNow(); tp = null; if (syncManagers != null) { for(int i = 0; i < syncManagers.length; i++) { if (null != syncManagers[i]) syncManagers[i].shutdown(); } } syncManagers = null; } @Test public void testBasicOneNode() throws Exception { AbstractSyncManager sync = syncManagers[0]; IStoreClient<Key, TBean> testClient = sync.getStoreClient("global", Key.class, TBean.class); Key k = new Key("com.bigswitch.bigsync.internal", "test"); TBean tb = new TBean("hello", 42); TBean tb2 = new TBean("hello", 84); TBean tb3 = new TBean("hello", 126); assertNotNull(testClient.get(k)); assertNull(testClient.get(k).getValue()); testClient.put(k, tb); Versioned<TBean> result = testClient.get(k); assertEquals(result.getValue(), tb); result.setValue(tb2); testClient.put(k, result); try { result.setValue(tb3); testClient.put(k, result); fail("Should get ObsoleteVersionException"); } catch (ObsoleteVersionException e) { // happy town } result = testClient.get(k); assertEquals(tb2, result.getValue()); } @Test public void testIterator() throws Exception { AbstractSyncManager sync = syncManagers[0]; IStoreClient<Key, TBean> testClient = sync.getStoreClient("local", Key.class, TBean.class); HashMap<Key, TBean> testMap = new HashMap<>(); for (int i = 0; i < 100; i++) { Key k = new Key("com.bigswitch.bigsync.internal", "test" + i); TBean tb = new TBean("value", i); testMap.put(k, tb); testClient.put(k, tb); } IClosableIterator<Entry<Key, Versioned<TBean>>> iter = testClient.entries(); int size = 0; try { while (iter.hasNext()) { Entry<Key, Versioned<TBean>> e = iter.next(); assertEquals(testMap.get(e.getKey()), e.getValue().getValue()); size += 1; } } finally { iter.close(); } assertEquals(testMap.size(), size); } protected static <K, V> Versioned<V> waitForValue(IStoreClient<K, V> client, K key, V value, int maxTime, String clientName) throws Exception { Versioned<V> v = null; long then = System.currentTimeMillis(); while (true) { v = client.get(key); if (value != null) { if (v.getValue() != null && v.getValue().equals(value)) break; } else { if (v.getValue() != null) break; } if (v.getValue() != null) logger.info("{}: Value for key {} not yet right: " + "expected: {}; actual: {}", new Object[]{clientName, key, value, v.getValue()}); else logger.info("{}: Value for key {} is null: expected {}", new Object[]{clientName, key, value}); Thread.sleep(100); assertTrue(then + maxTime > System.currentTimeMillis()); } return v; } private void waitForFullMesh(int maxTime) throws Exception { waitForFullMesh(syncManagers, maxTime); } protected static void waitForFullMesh(SyncManager[] syncManagers, int maxTime) throws Exception { long then = System.currentTimeMillis(); while (true) { boolean full = true; for(int i = 0; i < syncManagers.length; i++) { if (!syncManagers[i].rpcService.isFullyConnected()) full = false; } if (full) break; Thread.sleep(100); assertTrue(then + maxTime > System.currentTimeMillis()); } } private void waitForConnection(SyncManager sm, short nodeId, boolean connected, int maxTime) throws Exception { long then = System.currentTimeMillis(); while (true) { if (connected == sm.rpcService.isConnected(nodeId)) break; Thread.sleep(100); assertTrue(then + maxTime > System.currentTimeMillis()); } } @Test public void testBasicGlobalSync() throws Exception { waitForFullMesh(2000); ArrayList<IStoreClient<String, String>> clients = new ArrayList<>(syncManagers.length); // write one value to each node's local interface for (int i = 0; i < syncManagers.length; i++) { IStoreClient<String, String> client = syncManagers[i].getStoreClient("global", String.class, String.class); clients.add(client); client.put("key" + i, ""+i); } // verify that we see all the values everywhere for (int j = 0; j < clients.size(); j++) { for (int i = 0; i < syncManagers.length; i++) { waitForValue(clients.get(j), "key" + i, ""+i, 2000, "client"+j); } } } @Test public void testBasicLocalSync() throws Exception { waitForFullMesh(2000); ArrayList<IStoreClient<String, String>> clients = new ArrayList<>(syncManagers.length); // write one value to each node's local interface for (int i = 0; i < syncManagers.length; i++) { IStoreClient<String, String> client = syncManagers[i].getStoreClient("local", String.class, String.class); clients.add(client); client.put("key" + i, ""+i); } // verify that we see all the values from each local group at all the // nodes of that local group for (int j = 0; j < clients.size(); j++) { IStoreClient<String, String> client = clients.get(j); for (int i = 0; i < syncManagers.length; i++) { if (i % 2 == j % 2) waitForValue(client, "key" + i, ""+i, 2000, "client"+j); else { Versioned<String> v = client.get("key" + i); if (v.getValue() != null) { fail("Node " + j + " reading key" + i + ": " + v.getValue()); } } } } } @Test public void testConcurrentWrite() throws Exception { waitForFullMesh(2000); // Here we generate concurrent writes and then resolve them using // a custom inconsistency resolver IInconsistencyResolver<Versioned<List<String>>> ir = new IInconsistencyResolver<Versioned<List<String>>>() { @Override public List<Versioned<List<String>>> resolveConflicts(List<Versioned<List<String>>> items) { VectorClock vc = null; List<String> strings = new ArrayList<>(); for (Versioned<List<String>> item : items) { if (vc == null) vc = (VectorClock)item.getVersion(); else vc = vc.merge((VectorClock)item.getVersion()); strings.addAll(item.getValue()); } Versioned<List<String>> v = new Versioned<>(strings, vc); return Collections.singletonList(v); } }; TypeReference<List<String>> tr = new TypeReference<List<String>>() {}; TypeReference<String> ktr = new TypeReference<String>() {}; IStoreClient<String, List<String>> client0 = syncManagers[0].getStoreClient("local", ktr, tr, ir); IStoreClient<String, List<String>> client2 = syncManagers[2].getStoreClient("local", ktr, tr, ir); client0.put("key", Collections.singletonList("value")); Versioned<List<String>> v = client0.get("key"); assertNotNull(v); // now we generate two writes that are concurrent to each other // but are both locally after the first write. The result should be // two non-obsolete lists each containing a single element. // The inconsistency resolver above will resolve these by merging // the lists List<String> comp = new ArrayList<>(); v.setValue(Collections.singletonList("newvalue0")); comp.add("newvalue0"); client0.put("key", v); v.setValue(Collections.singletonList("newvalue1")); comp.add("newvalue1"); client2.put("key", v); v = waitForValue(client0, "key", comp, 1000, "client0"); // add one more value to the array. Now there will be exactly one // non-obsolete value List<String> newlist = new ArrayList<>(v.getValue()); assertEquals(2, newlist.size()); newlist.add("finalvalue"); v.setValue(newlist); client0.put("key", v); v = waitForValue(client2, "key", newlist, 2000, "client2"); assertEquals(3, newlist.size()); } @Ignore("fails in OSS Floodlight; since Sync isn't a focus, disabling for now.") @Test public void testReconnect() throws Exception { IStoreClient<String, String> client0 = syncManagers[0].getStoreClient("global", String.class, String.class); IStoreClient<String, String> client1 = syncManagers[1].getStoreClient("global", String.class, String.class); IStoreClient<String, String> client2 = syncManagers[2].getStoreClient("global", String.class, String.class); client0.put("key0", "value0"); waitForValue(client2, "key0", "value0", 1000, "client0"); logger.info("Shutting down server ID 1"); syncManagers[0].shutdown(); client1.put("newkey1", "newvalue1"); client2.put("newkey2", "newvalue2"); client1.put("key0", "newvalue0"); client2.put("key2", "newvalue2"); for (int i = 0; i < 500; i++) { client2.put("largetest" + i, "largetestvalue"); } logger.info("Initializing server ID 1"); syncManagers[0] = new SyncManager(); setupSyncManager(moduleContexts[0], syncManagers[0], nodes.get(0)); waitForFullMesh(2000); client0 = syncManagers[0].getStoreClient("global", String.class, String.class); waitForValue(client0, "newkey1", "newvalue1", 1000, "client0"); waitForValue(client0, "newkey2", "newvalue2", 1000, "client0"); waitForValue(client0, "key0", "newvalue0", 1000, "client0"); waitForValue(client0, "key2", "newvalue2", 1000, "client0"); for (int i = 0; i < 500; i++) { waitForValue(client0, "largetest" + i, "largetestvalue", 1000, "client0"); } } protected class Update { String key; UpdateType type; public Update(String key, UpdateType type) { super(); this.key = key; this.type = type; } @Override public int hashCode() { final int prime = 31; int result = 1; result = prime * result + getOuterType().hashCode(); result = prime * result + ((key == null) ? 0 : key.hashCode()); result = prime * result + ((type == null) ? 0 : type.hashCode()); return result; } @Override public boolean equals(Object obj) { if (this == obj) return true; if (obj == null) return false; if (getClass() != obj.getClass()) return false; Update other = (Update) obj; if (!getOuterType().equals(other.getOuterType())) return false; if (key == null) { if (other.key != null) return false; } else if (!key.equals(other.key)) return false; if (type != other.type) return false; return true; } private SyncManagerTest getOuterType() { return SyncManagerTest.this; } } protected class TestListener implements IStoreListener<String> { HashSet<Update> notified = new HashSet<>(); @Override public void keysModified(Iterator<String> keys, UpdateType type) { while (keys.hasNext()) notified.add(new Update(keys.next(), type)); } } @SuppressWarnings("rawtypes") private void waitForNotify(TestListener tl, HashSet comp, int maxTime) throws Exception { long then = System.currentTimeMillis(); while (true) { if (tl.notified.containsAll(comp)) break; Thread.sleep(100); assertTrue(then + maxTime > System.currentTimeMillis()); } } @Test public void testNotify() throws Exception { IStoreClient<String, String> client0 = syncManagers[0].getStoreClient("local", String.class, String.class); IStoreClient<String, String> client2 = syncManagers[2].getStoreClient("local", new TypeReference<String>() {}, new TypeReference<String>() {}); TestListener t0 = new TestListener(); TestListener t2 = new TestListener(); client0.addStoreListener(t0); client2.addStoreListener(t2); client0.put("test0", "value"); client2.put("test2", "value"); HashSet<Update> c0 = new HashSet<>(); c0.add(new Update("test0", UpdateType.LOCAL)); c0.add(new Update("test2", UpdateType.REMOTE)); HashSet<Update> c2 = new HashSet<>(); c2.add(new Update("test0", UpdateType.REMOTE)); c2.add(new Update("test2", UpdateType.LOCAL)); waitForNotify(t0, c0, 2000); waitForNotify(t2, c2, 2000); assertEquals(2, t0.notified.size()); assertEquals(2, t2.notified.size()); t0.notified.clear(); t2.notified.clear(); Versioned<String> v0 = client0.get("test0"); v0.setValue("newvalue"); client0.put("test0", v0); Versioned<String> v2 = client0.get("test2"); v2.setValue("newvalue"); client2.put("test2", v2); waitForNotify(t0, c0, 2000); waitForNotify(t2, c2, 2000); assertEquals(2, t0.notified.size()); assertEquals(2, t2.notified.size()); t0.notified.clear(); t2.notified.clear(); client0.delete("test0"); client2.delete("test2"); waitForNotify(t0, c0, 2000); waitForNotify(t2, c2, 2000); assertEquals(2, t0.notified.size()); assertEquals(2, t2.notified.size()); } @Test public void testAddNode() throws Exception { waitForFullMesh(2000); IStoreClient<String, String> client0 = syncManagers[0].getStoreClient("global", String.class, String.class); IStoreClient<String, String> client1 = syncManagers[1].getStoreClient("global", String.class, String.class); client0.put("key", "value"); waitForValue(client1, "key", "value", 2000, "client1"); nodes.add(new Node("localhost", 40105, (short)5, (short)5)); SyncManager[] sms = Arrays.copyOf(syncManagers, syncManagers.length + 1); FloodlightModuleContext[] fmcs = Arrays.copyOf(moduleContexts, moduleContexts.length + 1); sms[syncManagers.length] = new SyncManager(); fmcs[moduleContexts.length] = new FloodlightModuleContext(); nodeString = mapper.writeValueAsString(nodes); setupSyncManager(fmcs[moduleContexts.length], sms[syncManagers.length], nodes.get(syncManagers.length)); syncManagers = sms; moduleContexts = fmcs; for(int i = 0; i < 4; i++) { moduleContexts[i].addConfigParam(syncManagers[i], "nodes", nodeString); syncManagers[i].doUpdateConfiguration(); } waitForFullMesh(2000); IStoreClient<String, String> client4 = syncManagers[4].getStoreClient("global", String.class, String.class); client4.put("newkey", "newvalue"); waitForValue(client4, "key", "value", 2000, "client4"); waitForValue(client0, "newkey", "newvalue", 2000, "client0"); } @Test public void testRemoveNode() throws Exception { waitForFullMesh(2000); IStoreClient<String, String> client0 = syncManagers[0].getStoreClient("global", String.class, String.class); IStoreClient<String, String> client1 = syncManagers[1].getStoreClient("global", String.class, String.class); IStoreClient<String, String> client2 = syncManagers[2].getStoreClient("global", String.class, String.class); client0.put("key", "value"); waitForValue(client1, "key", "value", 2000, "client1"); nodes.remove(0); nodeString = mapper.writeValueAsString(nodes); SyncManager oldNode = syncManagers[0]; syncManagers = Arrays.copyOfRange(syncManagers, 1, 4); moduleContexts = Arrays.copyOfRange(moduleContexts, 1, 4); try { for(int i = 0; i < syncManagers.length; i++) { moduleContexts[i].addConfigParam(syncManagers[i], "nodes", nodeString); syncManagers[i].doUpdateConfiguration(); waitForConnection(syncManagers[i], (short)1, false, 2000); } } finally { oldNode.shutdown(); } waitForFullMesh(2000); client1.put("newkey", "newvalue"); waitForValue(client2, "key", "value", 2000, "client4"); waitForValue(client2, "newkey", "newvalue", 2000, "client0"); } @Test public void testChangeNode() throws Exception { waitForFullMesh(2000); IStoreClient<String, String> client0 = syncManagers[0].getStoreClient("global", String.class, String.class); IStoreClient<String, String> client2 = syncManagers[2].getStoreClient("global", String.class, String.class); client0.put("key", "value"); waitForValue(client2, "key", "value", 2000, "client2"); nodes.set(2, new Node("localhost", 50103, (short)3, (short)1)); nodeString = mapper.writeValueAsString(nodes); for(int i = 0; i < syncManagers.length; i++) { moduleContexts[i].addConfigParam(syncManagers[i], "nodes", nodeString); syncManagers[i].doUpdateConfiguration(); } waitForFullMesh(2000); waitForValue(client2, "key", "value", 2000, "client2"); client2 = syncManagers[2].getStoreClient("global", String.class, String.class); client0.put("key", "newvalue"); waitForValue(client2, "key", "newvalue", 2000, "client2"); } /** * Do a brain-dead performance test with one thread writing and waiting * for the values on the other node. The result get printed to the log */ public void testSimpleWritePerformance(String store) throws Exception { waitForFullMesh(5000); final int count = 1000000; IStoreClient<String, String> client0 = syncManagers[0].getStoreClient(store, String.class, String.class); IStoreClient<String, String> client2 = syncManagers[2].getStoreClient(store, String.class, String.class); long then = System.currentTimeMillis(); for (int i = 1; i <= count; i++) { client0.put(""+i, ""+i); } long donewriting = System.currentTimeMillis(); waitForValue(client2, ""+count, null, count, "client2"); long now = System.currentTimeMillis(); logger.info("Simple write ({}): {} values in {}+/-100 " + "millis ({} synced writes/s) ({} local writes/s)", new Object[]{store, count, (now-then), 1000.0*count/(now-then), 1000.0*count/(donewriting-then)}); } @Test @Ignore // ignored just to speed up routine tests public void testPerfSimpleWriteLocal() throws Exception { testSimpleWritePerformance("local"); } @Test @Ignore // ignored just to speed up routine tests public void testPerfSimpleWriteGlobal() throws Exception { testSimpleWritePerformance("global"); } @Test @Ignore public void testPerfOneNode() throws Exception { tearDown(); tp = new ThreadPool(); tp.init(null); tp.startUp(null); nodes = new ArrayList<>(); nodes.add(new Node("localhost", 40101, (short)1, (short)1)); nodeString = mapper.writeValueAsString(nodes); SyncManager sm = new SyncManager(); FloodlightModuleContext fmc = new FloodlightModuleContext(); setupSyncManager(fmc, sm, nodes.get(0)); fmc.addService(ISyncService.class, sm); SyncTorture st = new SyncTorture(); //fmc.addConfigParam(st, "iterations", "1"); st.init(fmc); st.startUp(fmc); Thread.sleep(10000); } }
package gui; import com.alexmerz.graphviz.ParseException; import com.alexmerz.graphviz.TokenMgrError; import gui.basics.NumberSpinner; import gui.partialdeployment.PartialDeploymentController; import io.InvalidTagException; import io.NetworkParser; import io.reporters.HTMLReporter; import io.reporters.Reporter; import javafx.event.ActionEvent; import javafx.fxml.Initializable; import javafx.scene.control.*; import javafx.scene.layout.GridPane; import javafx.stage.FileChooser; import network.exceptions.NodeExistsException; import network.exceptions.NodeNotFoundException; import simulators.*; import java.io.File; import java.io.IOException; import java.net.URL; import java.util.List; import java.util.ResourceBundle; import java.util.stream.Collectors; import static policies.shortestpath.ShortestPathPolicy.isShortestPath; public class Controller implements Initializable { public GridPane pane; public TextField networkTextField; public Button startButton; public Spinner<Integer> destinationIdSpinner; public Spinner<Integer> repetitionsSpinner; public Spinner<Integer> minDelaySpinner; public Spinner<Integer> maxDelaySpinner; public PartialDeploymentController partialDeploymentFormController; public CheckBox debugCheckBox; private FileChooser fileChooser = new FileChooser(); @Override public void initialize(URL location, ResourceBundle resources) { // ensure the start button is disabled when the text field is empty networkTextField.textProperty().addListener((observable, oldText, newText) -> { startButton.setDisable(newText.isEmpty()); }); NumberSpinner.setupNumberSpinner(destinationIdSpinner, 0, Integer.MAX_VALUE, 0); NumberSpinner.setupNumberSpinner(repetitionsSpinner, 1, Integer.MAX_VALUE, 1); NumberSpinner.setupNumberSpinner(minDelaySpinner, 0, Integer.MAX_VALUE, 0); NumberSpinner.setupNumberSpinner(maxDelaySpinner, 0, Integer.MAX_VALUE, 10); // enforces the minimum delay is never higher than the maximum delay minDelaySpinner.valueProperty().addListener((observable, oldValue, newValue) -> { if (newValue > maxDelaySpinner.getValue()) { maxDelaySpinner.getValueFactory().setValue(newValue); } }); // enforces the maximum delay is never lower than the minimum delay maxDelaySpinner.valueProperty().addListener((observable, oldValue, newValue) -> { if (newValue < minDelaySpinner.getValue()) { minDelaySpinner.getValueFactory().setValue(newValue); } }); // accept only *.gv file in the file chooser fileChooser.getExtensionFilters().add(new FileChooser.ExtensionFilter("Network files (*.gv)", "*.gv")); } /** * Handles browsing for network files. Opens up a file chooser for the user to select the network files to * simulate. */ public void handleClickedBrowseButton(ActionEvent actionEvent) { List<File> files = fileChooser.showOpenMultipleDialog(pane.getScene().getWindow()); if (files != null) { List<String> filePaths = files.stream() .filter(File::exists) .map(File::getAbsolutePath) .collect(Collectors.toList()); networkTextField.setText(String.join(" ; ", filePaths)); } } public void handleClickedStartButton(ActionEvent actionEvent) { for (String networkFilePath : networkTextField.getText().split(" ; ")) { simulate(new File(networkFilePath)); } } /** * Simulates each network file. * * @param networkFile network file to be simulated. */ private void simulate(File networkFile) { int destinationId = destinationIdSpinner.getValue(); int repetitionCount = repetitionsSpinner.getValue(); int minDelay = minDelaySpinner.getValue(); int maxDelay = maxDelaySpinner.getValue(); try { NetworkParser parser = new NetworkParser(); parser.parse(networkFile); // simulator that will be used to simulate Simulator simulator; if (!partialDeploymentFormController.activateToggle.isSelected()) { if (isShortestPath(parser.getNetwork().getPolicy())) { simulator = new SPPolicyStandardSimulator(parser.getNetwork(), destinationId, minDelay, maxDelay); } else { simulator = new StandardSimulator(parser.getNetwork(), destinationId, minDelay, maxDelay); } } else { int timeToChange = partialDeploymentFormController.detectingTimeSpinner.getValue(); if (isShortestPath(parser.getNetwork().getPolicy())) { simulator = new SPPolicyFullDeploymentSimulator(parser.getNetwork(), destinationId, minDelay, maxDelay, timeToChange); } else { simulator = new FullDeploymentSimulator(parser.getNetwork(), destinationId, minDelay, maxDelay, timeToChange); } } String debugFilePath = networkFile.getPath().replaceFirst("\\.gv", ".debug"); simulator.enableDebugReport(debugCheckBox.isSelected(), new File(debugFilePath)); for (int i = 0; i < repetitionCount; i++) { simulator.simulate(); } try { // store the report file in the same directory as the network file and with the same name bu with // different extension String reportFileName = networkFile.getName().replaceFirst("\\.gv", ".html"); // FIXME add a reporter implementation Reporter reporter = new HTMLReporter(new File(networkFile.getParent(), reportFileName)); simulator.report(reporter); } catch (IOException e) { Alert alert = new Alert(Alert.AlertType.ERROR, "could not generate report", ButtonType.OK); alert.setHeaderText("Report File Error"); alert.showAndWait(); } } catch (IOException e) { Alert alert = new Alert(Alert.AlertType.ERROR, "can't open the file", ButtonType.OK); alert.setHeaderText("Network File Error"); alert.showAndWait(); } catch (TokenMgrError | ParseException | NodeExistsException | NodeNotFoundException | InvalidTagException e) { Alert alert = new Alert(Alert.AlertType.ERROR, "network file is corrupted", ButtonType.OK); alert.setHeaderText("Invalid File Error"); alert.showAndWait(); } } }
package hex; import water.*; import water.exceptions.H2OIllegalArgumentException; import water.exceptions.H2OModelBuilderIllegalArgumentException; import water.fvec.*; import water.rapids.ASTKFold; import water.util.ArrayUtils; import water.util.Log; import water.util.MRUtils; import water.util.VecUtils; import java.util.*; /** * Model builder parent class. Contains the common interfaces and fields across all model builders. */ abstract public class ModelBuilder<M extends Model<M,P,O>, P extends Model.Parameters, O extends Model.Output> extends Iced { public Job _job; // Job controlling this build /** Block till completion, and return the built model from the DKV. Note the * funny assert: the Job does NOT have to be controlling this model build, * but might, e.g. be controlling a Grid search for which this is just one * of many results. Calling 'get' means that we are blocking on the Job * which is controlling ONLY this ModelBuilder, and when the Job completes * we can return built Model. */ public final M get() { assert _job._result == _result; return (M)_job.get(); } public final boolean isStopped() { return _job.isStopped(); } // Key of the model being built; note that this is DIFFERENT from // _job._result if the Job is being shared by many sub-models // e.g. cross-validation. protected Key<M> _result; // Built Model key public final Key<M> dest() { return _result; } /** Default model-builder key */ public static Key<? extends Model> defaultKey(String algoName) { return Key.make(H2O.calcNextUniqueModelId(algoName)); } /** Default easy constructor: Unique new job and unique new result key */ protected ModelBuilder(P parms) { String algoName = parms.algoName(); _job = new Job<>(_result = (Key<M>)defaultKey(algoName), parms.javaName(), algoName); _parms = parms; } /** Unique new job and named result key */ protected ModelBuilder(P parms, Key<M> key) { _job = new Job<>(_result = key, parms.javaName(), parms.algoName()); _parms = parms; } /** Shared pre-existing Job and unique new result key */ protected ModelBuilder(P parms, Job job) { _job = job; _result = (Key<M>)defaultKey(parms.algoName()); _parms = parms; } /** List of known ModelBuilders with all default args; endlessly cloned by * the GUI for new private instances, then the GUI overrides some of the * defaults with user args. */ private static String[] ALGOBASES = new String[0]; public static String[] algos() { return ALGOBASES; } private static ModelBuilder[] BUILDERS = new ModelBuilder[0]; /** One-time start-up only ModelBuilder, endlessly cloned by the GUI for the * default settings. */ protected ModelBuilder(P parms, boolean startup_once) { assert startup_once; _job = null; _result = null; _parms = parms; init(false); // Default cheap init String base = getClass().getSimpleName().toLowerCase(); if( ArrayUtils.find(ALGOBASES,base) != -1 ) throw H2O.fail("Only called once at startup per ModelBuilder, and "+base+" has already been called"); ALGOBASES = Arrays.copyOf(ALGOBASES,ALGOBASES.length+1); BUILDERS = Arrays.copyOf(BUILDERS ,BUILDERS .length+1); ALGOBASES[ALGOBASES.length-1] = base; BUILDERS [BUILDERS .length-1] = this; } /** gbm -> GBM, deeplearning -> DeepLearning */ public static String algoName(String urlName) { return BUILDERS[ArrayUtils.find(ALGOBASES,urlName)]._parms.algoName(); } /** gbm -> hex.tree.gbm.GBM, deeplearning -> hex.deeplearning.DeepLearning */ public static String javaName(String urlName) { return BUILDERS[ArrayUtils.find(ALGOBASES,urlName)]._parms.javaName(); } /** gbm -> GBMParameters */ public static String paramName(String urlName) { return algoName(urlName)+"Parameters"; } /** Factory method to create a ModelBuilder instance for given the algo name. * Shallow clone of both the default ModelBuilder instance and a Parameter. */ public static <B extends ModelBuilder> B make(String algo, Job job, Key<Model> result) { int idx = ArrayUtils.find(ALGOBASES,algo.toLowerCase()); assert idx != -1 : "Unregistered algorithm "+algo; B mb = (B)BUILDERS[idx].clone(); mb._job = job; mb._result = result; mb._parms = BUILDERS[idx]._parms.clone(); return mb; } /** All the parameters required to build the model. */ public P _parms; // Not final, so CV can set-after-clone /** Training frame: derived from the parameter's training frame, excluding * all ignored columns, all constant and bad columns, perhaps flipping the * response column to an Categorical, etc. */ public final Frame train() { return _train; } protected transient Frame _train; /** Validation frame: derived from the parameter's validation frame, excluding * all ignored columns, all constant and bad columns, perhaps flipping the * response column to a Categorical, etc. Is null if no validation key is set. */ protected final Frame valid() { return _valid; } protected transient Frame _valid; // TODO: tighten up the type // Map the algo name (e.g., "deeplearning") to the builder class (e.g., DeepLearning.class) : private static final Map<String, Class<? extends ModelBuilder>> _builders = new HashMap<>(); // Map the Model class (e.g., DeepLearningModel.class) to the algo name (e.g., "deeplearning"): private static final Map<Class<? extends Model>, String> _model_class_to_algo = new HashMap<>(); // Map the simple algo name (e.g., deeplearning) to the full algo name (e.g., "Deep Learning"): private static final Map<String, String> _algo_to_algo_full_name = new HashMap<>(); // Map the algo name (e.g., "deeplearning") to the Model class (e.g., DeepLearningModel.class): private static final Map<String, Class<? extends Model>> _algo_to_model_class = new HashMap<>(); /** Train response vector. */ public Vec response(){return _response;} /** Validation response vector. */ public Vec vresponse(){return _vresponse == null ? _response : _vresponse;} abstract protected class Driver extends H2O.H2OCountedCompleter<Driver> { protected Driver() { super(true); } // bump priority of model drivers protected Driver(H2O.H2OCountedCompleter completer){ super(completer,true); } } /** Method to launch training of a Model, based on its parameters. */ final public Job<M> trainModel() { if (error_count() > 0) throw H2OModelBuilderIllegalArgumentException.makeFromBuilder(this); if( !nFoldCV() ) return _job.start(trainModelImpl(), progressUnits()); // cross-validation needs to be forked off to allow continuous (non-blocking) progress bar return _job.start(new H2O.H2OCountedCompleter() { @Override public void compute2() { computeCrossValidation(); tryComplete(); } }, (1/*for all pre-fold work*/+nFoldWork()+1/*for all the post-fold work*/) * progressUnits()); } /** Train a model as part of a larger Job; the Job already exists and has started. */ final public M trainModelNested() { if (error_count() > 0) throw H2OModelBuilderIllegalArgumentException.makeFromBuilder(this); if( !nFoldCV() ) trainModelImpl().compute2(); else computeCrossValidation(); return _result.get(); } /** Model-specific implementation of model training * @return A F/J Job, which, when executed, does the build. F/J is NOT started. */ abstract protected Driver trainModelImpl(); abstract protected long progressUnits(); // Work for each requested fold private int nFoldWork() { if( _parms._fold_column == null ) return _parms._nfolds; Vec f = train().vec(_parms._fold_column); Vec fc = VecUtils.toCategoricalVec(f); int N = fc.domain().length; fc.remove(); return N; } // Temp zero'd vector, same size as train() private Vec zTmp() { return train().anyVec().makeZero(); } /** * Default naive (serial) implementation of N-fold cross-validation * @return Cross-validation Job * (builds N+1 models, all have train+validation metrics, the main model has N-fold cross-validated validation metrics) */ public void computeCrossValidation() { assert _job.isRunning(); // main Job is still running final Integer N = nFoldWork(); init(false); try { Scope.enter(); // Step 1: Assign each row to a fold final Vec foldAssignment = cv_AssignFold(N); // Step 2: Make 2*N binary weight vectors final Vec[] weights = cv_makeWeights(N,foldAssignment); _job.update(1); // Did the major pre-fold work // Step 3: Build N train & validation frames; build N ModelBuilders; error check them all ModelBuilder<M, P, O> cvModelBuilders[] = cv_makeFramesAndBuilders(N,weights); // Step 4: Run all the CV models and launch the main model H2O.H2OCountedCompleter mainMB = cv_runCVBuilds(N, cvModelBuilders); // Step 5: Score the CV models ModelMetrics.MetricBuilder mbs[] = cv_scoreCVModels(N, weights, cvModelBuilders); // wait for completion of the main model mainMB.join(); // Step 6: Combine cross-validation scores; compute main model x-val // scores; compute gains/lifts cv_mainModelScores(N, mbs, cvModelBuilders); } finally { Scope.exit(); } } // Step 1: Assign each row to a fold // TODO: Implement better splitting algo (with Strata if response is public Vec cv_AssignFold(int N) { Vec fold = train().vec(_parms._fold_column); if( fold != null ) { if( !fold.isInt() || (!(fold.min() == 0 && fold.max() == N-1) && !(fold.min() == 1 && fold.max() == N ) )) // Allow 0 to N-1, or 1 to N throw new H2OIllegalArgumentException("Fold column must be integers from 0 to number of folds, and all folds must be non-empty"); return fold; } final long seed = _parms.nFoldSeed(); Log.info("Creating " + N + " cross-validation splits with random number seed: " + seed); switch( _parms._fold_assignment ) { case AUTO: case Random: return ASTKFold. kfoldColumn( zTmp(),N,seed); case Modulo: return ASTKFold. moduloKfoldColumn( zTmp(),N ); case Stratified: return ASTKFold.stratifiedKFoldColumn(response(),N,seed); default: throw H2O.unimpl(); } } // Step 2: Make 2*N binary weight vectors public Vec[] cv_makeWeights( final int N, Vec foldAssignment ) { String origWeightsName = _parms._weights_column; Vec origWeight = origWeightsName != null ? train().vec(origWeightsName) : train().anyVec().makeCon(1.0); Frame folds_and_weights = new Frame(new Vec[]{foldAssignment, origWeight}); Vec[] weights = new MRTask() { @Override public void map(Chunk chks[], NewChunk nchks[]) { Chunk fold = chks[0], orig = chks[1]; for( int row=0; row< orig._len; row++ ) { int foldAssignment = (int)fold.at8(row) % N; double w = orig.atd(row); for( int f = 0; f < N; f++ ) { boolean holdout = foldAssignment == f; nchks[2*f+0].addNum(holdout ? 0 : w); nchks[2*f+1].addNum(holdout ? w : 0); } } } }.doAll(2*N,Vec.T_NUM,folds_and_weights).outputFrame().vecs(); if( _parms._fold_column == null ) foldAssignment.remove(); if( origWeightsName == null ) origWeight.remove(); // Cleanup temp for( Vec weight : weights ) if( weight.isConst() ) throw new H2OIllegalArgumentException("Not enough data to create " + N + " random cross-validation splits. Either reduce nfolds, specify a larger dataset (or specify another random number seed, if applicable)."); return weights; } // Step 3: Build N train & validation frames; build N ModelBuilders; error check them all public ModelBuilder<M, P, O>[] cv_makeFramesAndBuilders( int N, Vec[] weights ) { final long old_cs = _parms.checksum(); final String origDest = _job._result.toString(); final String weightName = "__internal_cv_weights__"; if (train().find(weightName) != -1) throw new H2OIllegalArgumentException("Frame cannot contain a Vec called '" + weightName + "'."); Frame cv_fr = new Frame(train().names(),train().vecs()); if( _parms._weights_column!=null ) cv_fr.remove( _parms._weights_column ); // The CV frames will have their own private weight column ModelBuilder<M, P, O>[] cvModelBuilders = new ModelBuilder[N]; for( int i=0; i<N; i++ ) { String identifier = origDest + "_cv_" + (i+1); // Training/Validation share the same data, but will have exclusive weights Frame cvTrain = new Frame(Key.make(identifier+"_train"),cv_fr.names(),cv_fr.vecs()); cvTrain.add(weightName, weights[2*i]); DKV.put(cvTrain); Frame cvValid = new Frame(Key.make(identifier+"_valid"),cv_fr.names(),cv_fr.vecs()); cvValid.add(weightName, weights[2*i+1]); DKV.put(cvValid); // Shallow clone - not everything is a private copy!!! ModelBuilder<M, P, O> cv_mb = (ModelBuilder)this.clone(); cv_mb._result = Key.make(identifier); // Each submodel gets its own key cv_mb._parms = (P) _parms.clone(); // Fix up some parameters of the clone cv_mb._parms._weights_column = weightName;// All submodels have a weight column, which the main model does not cv_mb._parms._train = cvTrain._key; // All submodels have a weight column, which the main model does not cv_mb._parms._valid = cvValid._key; cv_mb._parms._fold_assignment = Model.Parameters.FoldAssignmentScheme.AUTO; cv_mb._parms._nfolds = 0; // Each submodel is not itself folded cv_mb.init(false); // Arg check submodels // Error-check all the cross-validation Builders before launching any if( cv_mb.error_count() > 0 ) // Gather all submodel error messages for( ValidationMessage vm : cv_mb._messages ) message(vm._log_level, vm._field_name, vm._message); cvModelBuilders[i] = cv_mb; } if( error_count() > 0 ) // Error in any submodel throw H2OModelBuilderIllegalArgumentException.makeFromBuilder(this); // check that this Job's original _params haven't changed assert old_cs == _parms.checksum(); return cvModelBuilders; } // Step 4: Run all the CV models and launch the main model public H2O.H2OCountedCompleter cv_runCVBuilds( int N, ModelBuilder<M, P, O>[] cvModelBuilders ) { final boolean async = true; // Set to TRUE for parallel building H2O.H2OCountedCompleter submodel_tasks[] = new H2O.H2OCountedCompleter[N]; for( int i=0; i<N; ++i ) { if( _job.stop_requested() ) break; // Stop launching but still must block for all async jobs Log.info("Building cross-validation model " + (i + 1) + " / " + N + "."); submodel_tasks[i] = H2O.submitTask(cvModelBuilders[i].trainModelImpl()); if( !async ) submodel_tasks[i].join(); } if( async ) // Block for the parallel builds to complete for( int i=0; i<N; ++i ) // (block, even if cancelled) submodel_tasks[i].join(); // Now do the main model if( _job.stop_requested() ) return null; assert _job.isRunning(); Log.info("Building main model."); modifyParmsForCrossValidationMainModel(cvModelBuilders); //tell the main model that it shouldn't stop early either H2O.H2OCountedCompleter mainMB = H2O.submitTask(trainModelImpl()); //non-blocking if( !async ) mainMB.join(); return mainMB; } // Step 5: Score the CV models public ModelMetrics.MetricBuilder[] cv_scoreCVModels(int N, Vec[] weights, ModelBuilder<M, P, O>[] cvModelBuilders) { if( _job.stop_requested() ) return null; ModelMetrics.MetricBuilder[] mbs = new ModelMetrics.MetricBuilder[N]; Futures fs = new Futures(); for (int i=0; i<N; ++i) { if( _job.stop_requested() ) return null; //don't waste time scoring if the CV run is stopped Frame cvValid = cvModelBuilders[i].valid(); Frame adaptFr = new Frame(cvValid); M cvModel = cvModelBuilders[i].dest().get(); cvModel.adaptTestForTrain(adaptFr, true, !isSupervised()); mbs[i] = cvModel.scoreMetrics(adaptFr); if (nclasses() == 2 /* need holdout predictions for gains/lift table */ || _parms._keep_cross_validation_predictions) { String predName = "prediction_" + cvModelBuilders[i]._result.toString(); cvModel.predictScoreImpl(cvValid, adaptFr, predName); } // free resources as early as possible if (adaptFr != null) { Model.cleanup_adapt(adaptFr, cvValid); DKV.remove(adaptFr._key,fs); } DKV.remove(cvModelBuilders[i]._parms._train,fs); DKV.remove(cvModelBuilders[i]._parms._valid,fs); weights[2*i ].remove(fs); weights[2*i+1].remove(fs); } fs.blockForPending(); return mbs; } // Step 6: Combine cross-validation scores; compute main model x-val scores; compute gains/lifts public void cv_mainModelScores(int N, ModelMetrics.MetricBuilder mbs[], ModelBuilder<M, P, O> cvModelBuilders[]) { if( _job.stop_requested() ) return; assert _job.isRunning(); M mainModel = _result.get(); // Compute and put the cross-validation metrics into the main model Log.info("Computing " + N + "-fold cross-validation metrics."); mainModel._output._cross_validation_models = new Key[N]; Key<Frame>[] predKeys = new Key[N]; mainModel._output._cross_validation_predictions = _parms._keep_cross_validation_predictions ? predKeys : null; for (int i = 0; i < N; ++i) { if (i > 0) mbs[0].reduce(mbs[i]); Key<M> cvModelKey = cvModelBuilders[i]._result; mainModel._output._cross_validation_models[i] = cvModelKey; predKeys[i] = Key.make("prediction_" + cvModelKey.toString()); } Frame preds = null; //stitch together holdout predictions into one Vec, to compute the Gains/Lift table if (nclasses() == 2) { Vec[] p1s = new Vec[N]; for (int i=0;i<N;++i) { p1s[i] = ((Frame)DKV.getGet(predKeys[i])).lastVec(); } Frame p1combined = new HoldoutPredictionCombiner().doAll(1,Vec.T_NUM,new Frame(p1s)).outputFrame(new String[]{"p1"},null); Vec p1 = p1combined.anyVec(); preds = new Frame(new Vec[]{p1, p1, p1}); //pretend to have labels,p0,p1, but will only need p1 anyway } // Keep or toss predictions for (Key<Frame> k : predKeys) { Frame fr = DKV.getGet(k); if( _parms._keep_cross_validation_predictions ) Scope.untrack(fr.keys()); else fr.remove(); } mainModel._output._cross_validation_metrics = mbs[0].makeModelMetrics(mainModel, _parms.train(), null, preds); if (preds!=null) preds.remove(); mainModel._output._cross_validation_metrics._description = N + "-fold cross-validation on training data"; Log.info(mainModel._output._cross_validation_metrics.toString()); // Now, the main model is complete (has cv metrics) DKV.put(mainModel); } // helper to combine multiple holdout prediction Vecs (each only has 1/N-th filled with non-zeros) into 1 Vec private static class HoldoutPredictionCombiner extends MRTask<HoldoutPredictionCombiner> { @Override public void map(Chunk[] cs, NewChunk[] nc) { double [] vals = new double[cs[0].len()]; for (int i=0;i<cs.length;++i) for (int row = 0; row < cs[0].len(); ++row) vals[row] += cs[i].atd(row); nc[0].setDoubles(vals); } } /** Override for model-specific checks / modifications to _parms for the main model during N-fold cross-validation. * For example, the model might need to be told to not do early stopping. */ public void modifyParmsForCrossValidationMainModel(ModelBuilder<M, P, O>[] cvModelBuilders) { } /** @return Whether n-fold cross-validation is done */ public boolean nFoldCV() { return _parms._fold_column != null || _parms._nfolds != 0; } /** List containing the categories of models that this builder can * build. Each ModelBuilder must have one of these. */ abstract public ModelCategory[] can_build(); /** Visibility for this algo: is it always visible, is it beta (always * visible but with a note in the UI) or is it experimental (hidden by * default, visible in the UI if the user gives an "experimental" flag at * startup); test-only builders are "experimental" */ public enum BuilderVisibility { Experimental, Beta, Stable } public BuilderVisibility builderVisibility() { return BuilderVisibility.Stable; } /** Clear whatever was done by init() so it can be run again. */ public void clearInitState() { clearValidationErrors(); } protected boolean logMe() { return true; } public boolean isSupervised(){return false;} protected transient Vec _response; // Handy response column protected transient Vec _vresponse; // Handy response column protected transient Vec _offset; // Handy offset column protected transient Vec _weights; // observation weight column protected transient Vec _fold; // fold id column public boolean hasOffsetCol(){ return _parms._offset_column != null;} // don't look at transient Vec public boolean hasWeightCol(){return _parms._weights_column != null;} // don't look at transient Vec public boolean hasFoldCol(){return _parms._fold_column != null;} // don't look at transient Vec public int numSpecialCols() { return (hasOffsetCol() ? 1 : 0) + (hasWeightCol() ? 1 : 0) + (hasFoldCol() ? 1 : 0); } // no hasResponse, call isSupervised instead (response is mandatory if isSupervised is true) protected int _nclass; // Number of classes; 1 for regression; 2+ for classification public int nclasses(){return _nclass;} public final boolean isClassifier() { return nclasses() > 1; } /** * Find and set response/weights/offset/fold and put them all in the end, * @return number of non-feature vecs */ protected int separateFeatureVecs() { int res = 0; if(_parms._weights_column != null) { Vec w = _train.remove(_parms._weights_column); if(w == null) error("_weights_column","Weights column '" + _parms._weights_column + "' not found in the training frame"); else { if(!w.isNumeric()) error("_weights_column","Invalid weights column '" + _parms._weights_column + "', weights must be numeric"); _weights = w; if(w.naCnt() > 0) error("_weights_columns","Weights cannot have missing values."); if(w.min() < 0) error("_weights_columns","Weights must be >= 0"); if(w.max() == 0) error("_weights_columns","Max. weight must be > 0"); _train.add(_parms._weights_column, w); ++res; } } else { _weights = null; assert(!hasWeightCol()); } if(_parms._offset_column != null) { Vec o = _train.remove(_parms._offset_column); if(o == null) error("_offset_column","Offset column '" + _parms._offset_column + "' not found in the training frame"); else { if(!o.isNumeric()) error("_offset_column","Invalid offset column '" + _parms._offset_column + "', offset must be numeric"); _offset = o; if(o.naCnt() > 0) error("_offset_column","Offset cannot have missing values."); if(_weights == _offset) error("_offset_column", "Offset must be different from weights"); _train.add(_parms._offset_column, o); ++res; } } else { _offset = null; assert(!hasOffsetCol()); } if(_parms._fold_column != null) { Vec f = _train.remove(_parms._fold_column); if(f == null) error("_fold_column","Fold column '" + _parms._fold_column + "' not found in the training frame"); else { if(!f.isInt() && !f.isCategorical()) error("_fold_column","Invalid fold column '" + _parms._fold_column + "', fold must be integer or categorical"); if(f.min() < 0) error("_fold_column","Invalid fold column '" + _parms._fold_column + "', fold must be non-negative"); if(f.isConst()) error("_fold_column","Invalid fold column '" + _parms._fold_column + "', fold cannot be constant"); _fold = f; if(f.naCnt() > 0) error("_fold_column","Fold cannot have missing values."); if(_fold == _weights) error("_fold_column", "Fold must be different from weights"); if(_fold == _offset) error("_fold_column", "Fold must be different from offset"); _train.add(_parms._fold_column, f); ++res; } } else { _fold = null; assert(!hasFoldCol()); } if(isSupervised() && _parms._response_column != null) { _response = _train.remove(_parms._response_column); if (_response == null) { if (isSupervised()) error("_response_column", "Response column '" + _parms._response_column + "' not found in the training frame"); } else { if(_response == _offset) error("_response", "Response must be different from offset_column"); if(_response == _weights) error("_response", "Response must be different from weights_column"); if(_response == _fold) error("_response", "Response must be different from fold_column"); _train.add(_parms._response_column, _response); ++res; } } else { _response = null; } return res; } protected boolean ignoreStringColumns(){return true;} protected boolean ignoreConstColumns(){return _parms._ignore_const_cols;} /** * Ignore constant columns, columns with all NAs and strings. * @param npredictors * @param expensive */ protected void ignoreBadColumns(int npredictors, boolean expensive){ // Drop all-constant and all-bad columns. if(_parms._ignore_const_cols) new FilterCols(npredictors) { @Override protected boolean filter(Vec v) { return (ignoreConstColumns() && v.isConst()) || v.isBad() || (ignoreStringColumns() && v.isString()); } }.doIt(_train,"Dropping constant columns: ",expensive); } /** * Override this method to call error() if the model is expected to not fit in memory, and say why */ protected void checkMemoryFootPrint() {} transient double [] _distribution; transient double [] _priorClassDist; protected boolean computePriorClassDistribution(){ return isClassifier(); } /** A list of field validation issues. */ public ValidationMessage[] _messages = new ValidationMessage[0]; private int _error_count = -1; // -1 ==> init not run yet, for those Jobs that have an init, like ModelBuilder. Note, this counts ONLY errors, not WARNs and etc. public int error_count() { assert _error_count >= 0 : "init() not run yet"; return _error_count; } public void hide (String field_name, String message) { message(Log.TRACE, field_name, message); } public void info (String field_name, String message) { message(Log.INFO , field_name, message); } public void warn (String field_name, String message) { message(Log.WARN , field_name, message); } public void error(String field_name, String message) { message(Log.ERRR , field_name, message); _error_count++; } public void clearValidationErrors() { _messages = new ValidationMessage[0]; _error_count = 0; } public void message(byte log_level, String field_name, String message) { _messages = Arrays.copyOf(_messages, _messages.length + 1); _messages[_messages.length - 1] = new ValidationMessage(log_level, field_name, message); } /** Get a string representation of only the ERROR ValidationMessages (e.g., to use in an exception throw). */ public String validationErrors() { StringBuilder sb = new StringBuilder(); for( ValidationMessage vm : _messages ) if( vm._log_level == Log.ERRR ) sb.append(vm.toString()).append("\n"); return sb.toString(); } /** Can be an ERROR, meaning the parameters can't be used as-is, * a TRACE, which means the specified field should be hidden given * the values of other fields, or a WARN or INFO for informative * messages to the user. */ public static final class ValidationMessage extends Iced { final byte _log_level; // See util/Log.java for levels final String _field_name; final String _message; public ValidationMessage(byte log_level, String field_name, String message) { _log_level = log_level; _field_name = field_name; _message = message; Log.log(log_level,field_name + ": " + message); } public int log_level() { return _log_level; } @Override public String toString() { return Log.LVLS[_log_level] + " on field: " + _field_name + ": " + _message; } } /** Initialize the ModelBuilder, validating all arguments and preparing the * training frame. This call is expected to be overridden in the subclasses * and each subclass will start with "super.init();". This call is made by * the front-end whenever the GUI is clicked, and needs to be fast whenever * {@code expensive} is false; it will be called once again at the start of * model building {@see #trainModel()} with expensive set to true. *<p> * The incoming training frame (and validation frame) will have ignored * columns dropped out, plus whatever work the parent init did. *<p> * NOTE: The front end initially calls this through the parameters validation * endpoint with no training_frame, so each subclass's {@code init()} method * has to work correctly with the training_frame missing. *<p> */ public void init(boolean expensive) { // Log parameters if( expensive && logMe() ) { Log.info("Building H2O " + this.getClass().getSimpleName().toString() + " model with these parameters:"); Log.info(new String(_parms.writeJSON(new AutoBuffer()).buf())); } // NOTE: allow re-init: clearInitState(); assert _parms != null; // Parms must already be set in if( _parms._train == null ) { if (expensive) error("_train","Missing training frame"); return; } Frame tr = _parms.train(); if( tr == null ) { error("_train","Missing training frame: "+_parms._train); return; } _train = new Frame(null /* not putting this into KV */, tr._names.clone(), tr.vecs().clone()); if (_parms._nfolds < 0 || _parms._nfolds == 1) { error("_nfolds", "nfolds must be either 0 or >1."); } if (_parms._nfolds > 1 && _parms._nfolds > train().numRows()) { error("_nfolds", "nfolds cannot be larger than the number of rows (" + train().numRows() + ")."); } if (_parms._fold_column != null) { hide("_fold_assignment", "Fold assignment is ignored when a fold column is specified."); if (_parms._nfolds > 1) { error("_nfolds", "nfolds cannot be specified at the same time as a fold column."); } else { hide("_nfolds", "nfolds is ignored when a fold column is specified."); } if (_parms._fold_assignment != Model.Parameters.FoldAssignmentScheme.AUTO) { error("_fold_assignment", "Fold assignment is not allowed in conjunction with a fold column."); } } if (_parms._nfolds > 1) { hide("_fold_column", "Fold column is ignored when nfolds > 1."); } // hide cross-validation parameters unless cross-val is enabled if (!nFoldCV()) { hide("_keep_cross_validation_predictions", "Only for cross-validation."); hide("_fold_assignment", "Only for cross-validation."); if (_parms._fold_assignment != Model.Parameters.FoldAssignmentScheme.AUTO) { error("_fold_assignment", "Fold assignment is only allowed for cross-validation."); } } if (_parms._distribution != Distribution.Family.tweedie) { hide("_tweedie_power", "Only for Tweedie Distribution."); } if (_parms._tweedie_power <= 1 || _parms._tweedie_power >= 2) { error("_tweedie_power", "Tweedie power must be between 1 and 2 (exclusive)."); } // Drop explicitly dropped columns if( _parms._ignored_columns != null ) { _train.remove(_parms._ignored_columns); if( expensive ) Log.info("Dropping ignored columns: "+Arrays.toString(_parms._ignored_columns)); } // Rebalance train and valid datasets if (expensive && error_count() == 0) { _train = rebalance(_train, false, _result + ".temporary.train"); _valid = rebalance(_valid, false, _result + ".temporary.valid"); } // Drop all non-numeric columns (e.g., String and UUID). No current algo // can use them, and otherwise all algos will then be forced to remove // them. Text algos (grep, word2vec) take raw text columns - which are // numeric (arrays of bytes). ignoreBadColumns(separateFeatureVecs(), expensive); // Check that at least some columns are not-constant and not-all-NAs if( _train.numCols() == 0 ) error("_train","There are no usable columns to generate model"); if(isSupervised()) { if(_response != null) { if (expensive) checkDistributions(); _nclass = _response.isCategorical() ? _response.cardinality() : 1; if (_response.isConst()) error("_response","Response cannot be constant."); } if (! _parms._balance_classes) hide("_max_after_balance_size", "Balance classes is false, hide max_after_balance_size"); else if (_parms._weights_column != null && _weights != null && !_weights.isBinary()) error("_balance_classes", "Balance classes and observation weights are not currently supported together."); if( _parms._max_after_balance_size <= 0.0 ) error("_max_after_balance_size","Max size after balancing needs to be positive, suggest 1.0f"); if( _train != null ) { if (_train.numCols() <= 1) error("_train", "Training data must have at least 2 features (incl. response)."); if( null == _parms._response_column) { error("_response_column", "Response column parameter not set."); return; } if(_response != null && computePriorClassDistribution()) { if (isClassifier() && isSupervised()) { MRUtils.ClassDist cdmt = _weights != null ? new MRUtils.ClassDist(nclasses()).doAll(_response, _weights) : new MRUtils.ClassDist(nclasses()).doAll(_response); _distribution = cdmt.dist(); _priorClassDist = cdmt.rel_dist(); } else { // Regression; only 1 "class" _distribution = new double[]{ (_weights != null ? _weights.mean() : 1.0) * train().numRows() }; _priorClassDist = new double[]{1.0f}; } } } if( !isClassifier() ) { hide("_balance_classes", "Balance classes is only applicable to classification problems."); hide("_class_sampling_factors", "Class sampling factors is only applicable to classification problems."); hide("_max_after_balance_size", "Max after balance size is only applicable to classification problems."); hide("_max_confusion_matrix_size", "Max confusion matrix size is only applicable to classification problems."); } if (_nclass <= 2) { hide("_max_hit_ratio_k", "Max K-value for hit ratio is only applicable to multi-class classification problems."); hide("_max_confusion_matrix_size", "Only for multi-class classification problems."); } if( !_parms._balance_classes ) { hide("_max_after_balance_size", "Only used with balanced classes"); hide("_class_sampling_factors", "Class sampling factors is only applicable if balancing classes."); } } else { hide("_response_column", "Ignored for unsupervised methods."); hide("_balance_classes", "Ignored for unsupervised methods."); hide("_class_sampling_factors", "Ignored for unsupervised methods."); hide("_max_after_balance_size", "Ignored for unsupervised methods."); hide("_max_confusion_matrix_size", "Ignored for unsupervised methods."); _response = null; _vresponse = null; _nclass = 1; } if( _nclass > Model.Parameters.MAX_SUPPORTED_LEVELS ) { error("_nclass", "Too many levels in response column: " + _nclass + ", maximum supported number of classes is " + Model.Parameters.MAX_SUPPORTED_LEVELS + "."); } // Build the validation set to be compatible with the training set. // Toss out extra columns, complain about missing ones, remap categoricals Frame va = _parms.valid(); // User-given validation set if (va != null) { _valid = new Frame(null /* not putting this into KV */, va._names.clone(), va.vecs().clone()); try { String[] msgs = Model.adaptTestForTrain(_train._names, _parms._weights_column, _parms._offset_column, _parms._fold_column, null, _train.domains(), _valid, _parms.missingColumnsType(), expensive, true); _vresponse = _valid.vec(_parms._response_column); if (_vresponse == null && _parms._response_column != null) error("_validation_frame", "Validation frame must have a response column '" + _parms._response_column + "'."); if (expensive) { for (String s : msgs) { Log.info(s); warn("_valid", s); } } assert !expensive || (_valid == null || Arrays.equals(_train._names, _valid._names)); } catch (IllegalArgumentException iae) { error("_valid", iae.getMessage()); } } else { _valid = null; _vresponse = null; } if (_parms._checkpoint != null && DKV.get(_parms._checkpoint) == null) { error("_checkpoint", "Checkpoint has to point to existing model!"); } if (_parms._stopping_tolerance < 0) { error("_stopping_tolerance", "Stopping tolerance must be >= 0."); } if (_parms._stopping_tolerance >= 1) { error("_stopping_tolerance", "Stopping tolerance must be < 1."); } if (_parms._stopping_rounds == 0) { if (_parms._stopping_metric != ScoreKeeper.StoppingMetric.AUTO) warn("_stopping_metric", "Stopping metric is ignored for _stopping_rounds=0."); if (_parms._stopping_tolerance != _parms.defaultStoppingTolerance()) warn("_stopping_tolerance", "Stopping tolerance is ignored for _stopping_rounds=0."); } else if (_parms._stopping_rounds < 0) { error("_stopping_rounds", "Stopping rounds must be >= 0."); } else { if (isClassifier()) { if (_parms._stopping_metric == ScoreKeeper.StoppingMetric.deviance) { error("_stopping_metric", "Stopping metric cannot be deviance for classification."); } if (nclasses()!=2 && _parms._stopping_metric == ScoreKeeper.StoppingMetric.AUC) { error("_stopping_metric", "Stopping metric cannot be AUC for multinomial classification."); } } else { if (_parms._stopping_metric == ScoreKeeper.StoppingMetric.misclassification || _parms._stopping_metric == ScoreKeeper.StoppingMetric.AUC || _parms._stopping_metric == ScoreKeeper.StoppingMetric.logloss) { error("_stopping_metric", "Stopping metric cannot be " + _parms._stopping_metric.toString() + " for regression."); } } } } /** * Rebalance a frame for load balancing * @param original_fr Input frame * @param local Whether to only create enough chunks to max out all cores on one node only * @param name Name of rebalanced frame * @return Frame that has potentially more chunks */ protected Frame rebalance(final Frame original_fr, boolean local, final String name) { if (original_fr == null) return null; int chunks = desiredChunks(original_fr, local); if (original_fr.anyVec().nChunks() >= chunks) { if (chunks>1) Log.info(name.substring(name.length()-5)+ " dataset already contains " + original_fr.anyVec().nChunks() + " chunks. No need to rebalance."); return original_fr; } Log.info("Rebalancing " + name.substring(name.length()-5) + " dataset into " + chunks + " chunks."); Key newKey = Key.make(name + ".chunks" + chunks); RebalanceDataSet rb = new RebalanceDataSet(original_fr, newKey, chunks); H2O.submitTask(rb).join(); Frame rebalanced_fr = DKV.get(newKey).get(); Scope.track(rebalanced_fr); return rebalanced_fr; } /** * Find desired number of chunks. If fewer, dataset will be rebalanced. * @return Lower bound on number of chunks after rebalancing. */ protected int desiredChunks(final Frame original_fr, boolean local) { return Math.min((int) Math.ceil(original_fr.numRows() / 1e3), H2O.NUMCPUS); } public void checkDistributions() { if (_parms._distribution == Distribution.Family.poisson) { if (_response.min() < 0) error("_response", "Response must be non-negative for Poisson distribution."); } else if (_parms._distribution == Distribution.Family.gamma) { if (_response.min() < 0) error("_response", "Response must be non-negative for Gamma distribution."); } else if (_parms._distribution == Distribution.Family.tweedie) { if (_parms._tweedie_power >= 2 || _parms._tweedie_power <= 1) error("_tweedie_power", "Tweedie power must be between 1 and 2."); if (_response.min() < 0) error("_response", "Response must be non-negative for Tweedie distribution."); } } protected transient HashSet<String> _removedCols = new HashSet<String>(); abstract class FilterCols { final int _specialVecs; // special vecs to skip at the end public FilterCols(int n) {_specialVecs = n;} abstract protected boolean filter(Vec v); void doIt( Frame f, String msg, boolean expensive ) { boolean any=false; for( int i = 0; i < f.vecs().length - _specialVecs; i++ ) { if( filter(f.vecs()[i]) ) { if( any ) msg += ", "; // Log dropped cols any = true; msg += f._names[i]; _removedCols.add(f._names[i]); f.remove(i); i--; // Re-run at same iteration after dropping a col } } if( any ) { warn("_train", msg); if (expensive) Log.info(msg); } } } }
package example; //-*- mode:java; encoding:utf-8 -*- // vim:set fileencoding=utf-8: //@homepage@ import java.awt.*; import java.awt.event.*; import java.util.Objects; import javax.swing.*; import javax.swing.event.*; import javax.swing.table.*; public final class MainPanel extends JPanel { private MainPanel() { super(new BorderLayout()); DefaultListModel<String> listModel = new DefaultListModel<>(); TestModel model = new TestModel(listModel); model.addTest(new Test("Name 1", "comment")); model.addTest(new Test("Name 2", "test")); model.addTest(new Test("Name d", "ee")); model.addTest(new Test("Name c", "test cc")); model.addTest(new Test("Name b", "test bb")); model.addTest(new Test("Name a", "ff")); model.addTest(new Test("Name 0", "test aa")); model.addTest(new Test("Name 0", "gg")); JTable table = new JTable(model); table.setCellSelectionEnabled(true); JTableHeader header = table.getTableHeader(); header.addMouseListener(new MouseAdapter() { @Override public void mousePressed(MouseEvent e) { if (table.isEditing()) { table.getCellEditor().stopCellEditing(); } int col = header.columnAtPoint(e.getPoint()); table.changeSelection(0, col, false, false); table.changeSelection(table.getRowCount() - 1, col, false, true); } }); RowHeaderList<String> rowHeader = new RowHeaderList<>(listModel, table); rowHeader.setFixedCellWidth(50); JScrollPane scroll = new JScrollPane(table); scroll.setRowHeaderView(rowHeader); scroll.getRowHeader().addChangeListener(e -> { JViewport viewport = (JViewport) e.getSource(); scroll.getVerticalScrollBar().setValue(viewport.getViewPosition().y); }); scroll.setComponentPopupMenu(new TablePopupMenu()); table.setInheritsPopupMenu(true); rowHeader.setBackground(Color.BLUE); scroll.setBackground(Color.RED); scroll.getViewport().setBackground(Color.GREEN); add(scroll); setPreferredSize(new Dimension(320, 240)); } public static void main(String... args) { EventQueue.invokeLater(new Runnable() { @Override public void run() { createAndShowGUI(); } }); } public static void createAndShowGUI() { try { UIManager.setLookAndFeel(UIManager.getSystemLookAndFeelClassName()); } catch (ClassNotFoundException | InstantiationException | IllegalAccessException | UnsupportedLookAndFeelException ex) { ex.printStackTrace(); } JFrame frame = new JFrame("@title@"); frame.setDefaultCloseOperation(WindowConstants.EXIT_ON_CLOSE); frame.getContentPane().add(new MainPanel()); frame.pack(); frame.setLocationRelativeTo(null); frame.setVisible(true); } } class RowHeaderList<E> extends JList<E> { protected final JTable table; protected final ListSelectionModel tableSelection; protected final ListSelectionModel rListSelection; protected int rollOverRowIndex = -1; protected int pressedRowIndex = -1; protected RowHeaderList(ListModel<E> model, JTable table) { super(model); this.table = table; setFixedCellHeight(table.getRowHeight()); setCellRenderer(new RowHeaderRenderer<>(table.getTableHeader())); //setSelectionModel(table.getSelectionModel()); RollOverListener rol = new RollOverListener(); addMouseListener(rol); addMouseMotionListener(rol); //setBorder(BorderFactory.createMatteBorder(1, 0, 0, 0, Color.GRAY.brighter())); tableSelection = table.getSelectionModel(); rListSelection = getSelectionModel(); } class RowHeaderRenderer<E2> extends JLabel implements ListCellRenderer<E2> { private final JTableHeader header; // = table.getTableHeader(); protected RowHeaderRenderer(JTableHeader header) { super(); this.header = header; this.setOpaque(true); //this.setBorder(UIManager.getBorder("TableHeader.cellBorder")); this.setBorder(BorderFactory.createMatteBorder(0, 0, 1, 2, Color.GRAY.brighter())); this.setHorizontalAlignment(CENTER); this.setForeground(header.getForeground()); this.setBackground(header.getBackground()); this.setFont(header.getFont()); } @Override public Component getListCellRendererComponent(JList<? extends E2> list, E2 value, int index, boolean isSelected, boolean cellHasFocus) { if (index == pressedRowIndex) { setBackground(Color.GRAY); } else if (index == rollOverRowIndex) { setBackground(Color.WHITE); } else if (isSelected) { setBackground(Color.GRAY.brighter()); } else { setForeground(header.getForeground()); setBackground(header.getBackground()); } setText(Objects.toString(value, "")); return this; } } class RollOverListener extends MouseAdapter { @Override public void mouseExited(MouseEvent e) { if (pressedRowIndex < 0) { //pressedRowIndex = -1; rollOverRowIndex = -1; repaint(); } } @Override public void mouseMoved(MouseEvent e) { int row = locationToIndex(e.getPoint()); if (row != rollOverRowIndex) { rollOverRowIndex = row; repaint(); } } @Override public void mouseDragged(MouseEvent e) { if (pressedRowIndex >= 0) { int row = locationToIndex(e.getPoint()); int start = Math.min(row, pressedRowIndex); int end = Math.max(row, pressedRowIndex); tableSelection.clearSelection(); rListSelection.clearSelection(); tableSelection.addSelectionInterval(start, end); rListSelection.addSelectionInterval(start, end); repaint(); } } @Override public void mousePressed(MouseEvent e) { int row = locationToIndex(e.getPoint()); if (row == pressedRowIndex) { return; } rListSelection.clearSelection(); table.changeSelection(row, 0, false, false); table.changeSelection(row, table.getColumnModel().getColumnCount() - 1, false, true); pressedRowIndex = row; // table.setRowSelectionInterval(row, row); // table.getSelectionModel().setSelectionInterval(row, row); // tableSelection.clearSelection(); // table.getSelectionModel().setAnchorSelectionIndex(row); // table.getSelectionModel().setLeadSelectionIndex(row); // tableSelection.addSelectionInterval(row, row); // rListSelection.addSelectionInterval(row, row); // table.getColumnModel().getSelectionModel().setAnchorSelectionIndex(0); // table.getColumnModel().getSelectionModel().setLeadSelectionIndex(0); // table.changeSelection(pressedRowIndex, table.getColumnModel().getColumnCount() - 1, false, true); } @Override public void mouseReleased(MouseEvent e) { rListSelection.clearSelection(); pressedRowIndex = -1; rollOverRowIndex = -1; repaint(); } } } class TestModel extends DefaultTableModel { private static final ColumnContext[] COLUMN_ARRAY = { //new ColumnContext("No.", Integer.class, false), new ColumnContext("Name", String.class, false), new ColumnContext("Comment", String.class, false) }; private int number; private final DefaultListModel<String> rowListModel; protected TestModel(DefaultListModel<String> lm) { super(); rowListModel = lm; } public void addTest(Test t) { Object[] obj = {t.getName(), t.getComment()}; super.addRow(obj); rowListModel.addElement("row" + number); number++; } @Override public void removeRow(int index) { super.removeRow(index); rowListModel.remove(index); } @Override public boolean isCellEditable(int row, int col) { return COLUMN_ARRAY[col].isEditable; } @Override public Class<?> getColumnClass(int column) { return COLUMN_ARRAY[column].columnClass; } @Override public int getColumnCount() { return COLUMN_ARRAY.length; } @Override public String getColumnName(int column) { return COLUMN_ARRAY[column].columnName; } private static class ColumnContext { public final String columnName; public final Class columnClass; public final boolean isEditable; protected ColumnContext(String columnName, Class columnClass, boolean isEditable) { this.columnName = columnName; this.columnClass = columnClass; this.isEditable = isEditable; } } } class Test { private String name; private String comment; protected Test(String name, String comment) { this.name = name; this.comment = comment; } public void setName(String str) { name = str; } public void setComment(String str) { comment = str; } public String getName() { return name; } public String getComment() { return comment; } } class TablePopupMenu extends JPopupMenu { private final Action addAction = new AbstractAction("add") { @Override public void actionPerformed(ActionEvent e) { JTable table = (JTable) getInvoker(); TestModel model = (TestModel) table.getModel(); model.addTest(new Test("add row", "")); Rectangle rect = table.getCellRect(model.getRowCount() - 1, 0, true); table.scrollRectToVisible(rect); } }; private final Action deleteAction = new AbstractAction("delete") { @Override public void actionPerformed(ActionEvent e) { JTable table = (JTable) getInvoker(); DefaultTableModel model = (DefaultTableModel) table.getModel(); int[] selection = table.getSelectedRows(); for (int i = selection.length - 1; i >= 0; i model.removeRow(table.convertRowIndexToModel(selection[i])); } } }; protected TablePopupMenu() { super(); add(addAction); addSeparator(); add(deleteAction); } @Override public void show(Component c, int x, int y) { if (c instanceof JTable) { deleteAction.setEnabled(((JTable) c).getSelectedRowCount() > 0); super.show(c, x, y); } } }
package bat_nav; import java.awt.FlowLayout; import java.awt.event.ActionEvent; import javax.swing.AbstractAction; import javax.swing.JFrame; import javax.swing.JLabel; import javax.swing.JPanel; import javax.swing.JTextField; import javax.swing.JButton; public class Joueur { //Contient le score, historique, les bateaux qu'il reste Joueur(int score) { } } class CreationJoueur extends JFrame{ // A voir ou mettre private JLabel label; private JTextField t; private JPanel buildContentPane(){ // Creation TextBox JPanel panel = new JPanel(); panel.setLayout(new FlowLayout()); t = new JTextField(); panel.add(t); label = new JLabel("Rien pour le moment"); panel.add(label); JButton bouton = new JButton(new GetAction(this, "Ok")); panel.add(bouton); return panel; } public JTextField getTextField(){ return t; } public JLabel getLabel(){ return label; } } class GetAction extends AbstractAction { //Recuperation name private CreationJoueur fenetre; private String name; public GetAction(CreationJoueur fenetre, String texte){ super(texte); this.fenetre = fenetre; } public void actionPerformed(ActionEvent e) { name = fenetre.getTextField().getText(); fenetre.getLabel().setText(name); } }
package battle; public class Fighter { public boolean removeStatus(Status status) { throw new UnsupportedOperationException("Not supported yet."); } }
package battle; import java.util.ArrayList; import java.util.List; public class Fighter implements Actor { /** * @see FighterBuilder#setName */ private final String name; /** * @see FighterBuilder#setCloseRange */ private final int closeRange; /** * @see FighterBuilder#addSkill */ private final List<Skill> skillList; /** * @see Fighter#applyStatus */ private final List<Status> statusList; /** * Initializes the object so that all internal field variables that can be * explicitly set are done so through the given parameters. See the {@link * FighterBuilder} class which allows you to create Fighter objects using a * builder pattern. * @param name {@see FighterBuilder#setName} * @param closeRange {@see FighterBuilder#setCloseRange} * @param skillList {@see FighterBuilder#addSkill} */ public Fighter(String name, int closeRange, List<Skill> skillList) { this.name = name; this.closeRange = closeRange; this.skillList = skillList; this.statusList = new ArrayList<>(); } /** * Attempts to apply the given Status object to the fighter. Returns {@code * true} if the predicate for its application returned {@code true}. * @param status status to be applied. * @return {@code true} if the status was applied. */ public boolean applyStatus(Status status) { throw new UnsupportedOperationException("Not supported yet."); } /** * Attempts to remove the given Status object from the fighter. Returns {@code * true} if the object was both found and if the predicate for its removal * returned {@code true}. This method will only remove the Status object * given. * @param status the status to be removed. * @return {@code true} if the status was removed. * @see #removeStatus(String name) */ public boolean removeStatus(Status status) { throw new UnsupportedOperationException("Not supported yet."); } /** * Attempts to remove any Status object matching the given name from the * fighter. Returns {@code true} if a match was both found and if the * predicate for its removal returned {@code true}. * @param name name of the status to be removed. * @return {@code true} if the status was removed. */ public boolean removeStatus(String name) { throw new UnsupportedOperationException("Not supported yet."); } /** * Tells the fighter to attempt to execute the given skill. Returns true if * the skill or any sub-skill was successfully executed. The order in which * the given skill is executed is as such:<br><ol> * <li>The battlefield is checked for any valid targets that meet the skill's * requirements. Valid targets must match the target criteria of the skill. * The targets must also have all of the matching Status objects found in * the Skill object's list of requirements. If no valid targets are found, * then execution fails and this method returns false.</li> * <li>All Skill objects found in the list of sub-skills is executed * recursively using this method. If all calls return false, then the Skill * fails and this method returns false. If there are no sub-skills, the * passed skill succeeds and applies its actions to valid targets. Up to * the skill's maximum targets property can be affected by the skill, * starting with those closest to the fighter.</li> * <li>If any but not all sub-skill executions return true, this Skill fails * to apply its actions but returns true. If all sub-skill executions * return true, this Skill succeeds and applies its actions to valid * targets. Up to the skill's maximum targets property can be affected by * the skill, starting with those closest to the fighter. This method would * then return true. </li></ol> * Note that valid targets that meet the requirements are checked both before * and after sub-skills are executed. It is possible to create a skill that * can never apply its actions. This will be so if your sub-skills applis a * status that in turn removes a status that the primary skill requires, or if * it applies a status that defeats would-be targets. * @param skill the skill attempting to be executed. * @return {@code true} if the skill or any sub-Skill successfully executed. */ public boolean executeSkill(Skill skill) { throw new UnsupportedOperationException("Not supported yet."); } /** * @return close range property of the fighter. * @see FighterBuilder#setCloseRange */ public int getCloseRange() { throw new UnsupportedOperationException("Not supported yet."); } /** * Returns {@code true} if this fighter is an ally of the given fighter. * @param fighter fighter to test allied relationship with. * @return {@code true} if given fighter is an ally. */ boolean isAlly(Fighter fighter) { throw new UnsupportedOperationException("Not supported yet."); } /** * Returns {@code true} if this fighter is an enemy of the given fighter. * @param fighter fighter to test enemy relationship with. * @return {@code true} if given fighter is an enemy. */ boolean isEnemy(Fighter fighter) { throw new UnsupportedOperationException("Not supported yet."); } /** * Returns {@code true} if the fighter has a status applied to it that stuns * it. * @return {@code true} if stunned. */ public boolean isStunned() { throw new UnsupportedOperationException("Not supported yet."); } /** * Returns {@code true} if the fighter has a status applied to it that defeats * it. * @return {@code true} if defeated. */ public boolean isDefeated() { throw new UnsupportedOperationException("Not supported yet."); } }
package hash; import java.io.File; import java.io.FileInputStream; import java.io.IOException; import java.nio.MappedByteBuffer; import java.nio.channels.FileChannel; import java.nio.channels.FileChannel.MapMode; import java.security.MessageDigest; import java.security.NoSuchAlgorithmException; import java.util.logging.Logger; /** * Generates a SHA-2 Hash for binary data, and formats the value into * a Hex representation. */ public class HashMaker { private static Logger logger = Logger.getLogger(HashMaker.class.getName()); MessageDigest md = null; String key; byte[] rawHash; /** * Generate a Hash value for binary data. * @param data Binary data * @return hash Hash as a hex value */ public String hash(byte[] data){ if(md == null){ try { md = MessageDigest.getInstance("SHA-256"); } catch (NoSuchAlgorithmException e1) { logger.severe(e1.getMessage()); return null; } } if(data == null){ logger.severe("No data"); return null; } md.reset(); rawHash = md.digest(data); key = toHex(rawHash); return key; } public String hashFile(File file) { if (md == null) { try { md = MessageDigest.getInstance("SHA-256"); } catch (NoSuchAlgorithmException e1) { logger.severe(e1.getMessage()); return null; } } if(file == null){ return null; } key = null; FileInputStream stream; stream = null; try { final FileChannel channel; final MappedByteBuffer buffer; final int fileSize; stream = new FileInputStream(file); channel = stream.getChannel(); buffer = channel.map(MapMode.READ_ONLY, 0, file.length()); fileSize = (int) file.length(); for (int i = 0; i < fileSize; i++) { md.update(buffer.get()); } rawHash = md.digest(); key = toHex(rawHash); } catch (final IOException ex) { ex.printStackTrace(); } finally { if (stream != null) { try { stream.close(); } catch (final IOException ex) { ex.printStackTrace(); } } } return key; } /** * Converts binary values to Hex. * @param conv binary value to convert to a string. * @return string representation of binary value */ private String toHex (byte[] conv){ String str =""; String chk = ""; int tmp = 0; for (byte b : conv){ tmp = b; if (tmp <0) tmp += 256; chk = Integer.toHexString(tmp).toUpperCase(); if (chk.length() != 2) chk = "0"+chk; str += chk; } return str; } }
package ccw.launching; import java.io.BufferedReader; import java.io.File; import java.io.FileReader; import java.io.IOException; import java.util.ArrayList; import java.util.List; import org.eclipse.core.resources.IFile; import org.eclipse.core.resources.IProject; import org.eclipse.core.resources.IResource; import org.eclipse.core.resources.ResourcesPlugin; import org.eclipse.core.runtime.CoreException; import org.eclipse.core.runtime.IPath; import org.eclipse.core.runtime.Path; import org.eclipse.debug.core.ILaunch; import org.eclipse.debug.core.ILaunchConfiguration; import org.eclipse.debug.core.ILaunchConfigurationWorkingCopy; import org.eclipse.jdt.core.IJavaProject; import org.eclipse.jdt.core.IPackageFragment; import org.eclipse.jdt.core.IPackageFragmentRoot; import org.eclipse.jdt.core.JavaModelException; import org.eclipse.jdt.launching.IJavaLaunchConfigurationConstants; import ccw.CCWPlugin; import ccw.ClojureCore; import ccw.util.IOUtils; import ccw.util.StringUtils; public final class LaunchUtils implements IJavaLaunchConfigurationConstants { private LaunchUtils(){} static public final String LAUNCH_ID = "ccw.launching.clojure"; static public final String MAIN_CLASSNAME = "clojure.main"; static public final String MAIN_CLASSNAME_FOR_REPL = "clojure.contrib.repl_ln"; static public final int DEFAULT_SERVER_PORT = -1; /** Launch attribute that will be of type String, the files will be listed separated by newlines */ static public final String ATTR_FILES_LAUNCHED_AT_STARTUP = "CCW_ATTR_FILES_LAUNCHED_AT_STARTUP"; public static final String ATTR_CLOJURE_SERVER_LISTEN = "CCW_ATTR_CLOJURE_SERVER_LISTEN"; public static final String ATTR_CLOJURE_SERVER_FILE_PORT = "ccw.debug.serverrepl.file.port"; public static final String SERVER_FILE_PORT_PREFIX = "ccw.debug.serverrepl.port-"; public static final String SERVER_FILE_PORT_SUFFFIX = ".port"; public static final String ATTR_CLOJURE_INSTALL_REPL = "CCW_ATTR_CLOJURE_INSTALL_REPL"; /** * @param files * @param lastFileAsScript if true, does not install the last arg as a resource to load, but as * a script to launch * @return */ static public String getProgramArguments(IProject project, IFile[] files, boolean lastFileAsScript) { StringBuilder args = new StringBuilder(); int lastIndex = lastFileAsScript ? files.length - 1 : files.length; for (int i = 0; i < lastIndex; i++) { String fileArg = fileArg(project, files[i]); if (!StringUtils.isEmpty(fileArg)) { args.append(" -i" + fileArg); } } if (lastFileAsScript) { args.append(fileArg(project, files[lastIndex])); } return args.toString(); } public static IProject getProject(ILaunchConfiguration configuration) throws CoreException { String projectName = configuration.getAttribute(LaunchUtils.ATTR_PROJECT_NAME, (String) null); if (projectName == null) { return null; } else { return ResourcesPlugin.getWorkspace().getRoot().getProject(projectName); } } private static String fileArg(IProject project, IFile file) { String FILE_ARG_ERROR_PREFIX = "When trying to create clojure.main " + "file arg to launch, was " + "unable to "; IPath filePath = file.getLocation(); IJavaProject javaProject = ClojureCore.getJavaProject(project); try { IPackageFragmentRoot filePFR = findPackageFragmentRoot(javaProject, filePath); if (filePFR != null) { IPath pfrPath = filePFR.getResource().getLocation();// getResource(); String classpathRelativeArg = filePath.makeRelativeTo(pfrPath).toString(); return " \"@/" + classpathRelativeArg + "\""; } else { CCWPlugin.logError(FILE_ARG_ERROR_PREFIX + " find package fragment root for file " + file + " in project " + project); return ""; } } catch (JavaModelException jme) { CCWPlugin.logError(FILE_ARG_ERROR_PREFIX + " complete due to a JavaModelException finding package fragment root for file " + file + " in project " + project, jme); return ""; } } private static IPackageFragmentRoot findPackageFragmentRoot(IJavaProject javaProject, IPath filePath) throws JavaModelException { if (filePath.isEmpty() || filePath.isRoot()) { return null; } else { IResource possibleFragmentResource = ResourcesPlugin.getWorkspace().getRoot().getFileForLocation(filePath); if (possibleFragmentResource != null) { filePath = possibleFragmentResource.getFullPath(); } IPackageFragmentRoot fragment = javaProject.findPackageFragmentRoot(filePath); if (fragment != null) { return fragment; } else { return findPackageFragmentRoot(javaProject, filePath.removeLastSegments(1)); } } } static public String getProgramArguments(IProject project, List<IFile> files, boolean lastFileAsScript) { return getProgramArguments(project, files.toArray(new IFile[]{}), lastFileAsScript); } static public List<IFile> getFilesToLaunchList(ILaunchConfiguration config) throws CoreException { List<IFile> selectedFiles = new ArrayList<IFile>(); for (String path : config.getAttribute(LaunchUtils.ATTR_FILES_LAUNCHED_AT_STARTUP, "").split("\n")) { IResource rc = ResourcesPlugin.getWorkspace().getRoot().findMember(new Path(path)); if (rc instanceof IFile) { selectedFiles.add((IFile) rc); } } return selectedFiles; } static public String getFilesToLaunchAsCommandLineList(ILaunchConfiguration config, boolean lastFileAsScript) throws CoreException { List<IFile> filesToLaunch = LaunchUtils.getFilesToLaunchList(config); return LaunchUtils.getProgramArguments(getProject(config), filesToLaunch, lastFileAsScript); } static public void setFilesToLaunchString(ILaunchConfigurationWorkingCopy config, List<IFile> selectedFiles) { StringBuilder filesAsString = new StringBuilder(); if (selectedFiles != null) { for (int i = 0; i < selectedFiles.size(); i++) { if (i != 0) { filesAsString.append('\n'); } filesAsString.append(selectedFiles.get(i).getFullPath()); } } config.setAttribute(LaunchUtils.ATTR_FILES_LAUNCHED_AT_STARTUP, filesAsString.toString()); } static public int getLaunchServerReplPort(ILaunch launch) { String portAttr = launch.getAttribute(LaunchUtils.ATTR_CLOJURE_SERVER_LISTEN); int port; if (portAttr == null || (port = Integer.valueOf(portAttr)) == -1) { port = tryFindPort(launch); if (port != -1) { launch.setAttribute(LaunchUtils.ATTR_CLOJURE_SERVER_LISTEN, Integer.toString(port)); } } return port; } static private int tryFindPort(ILaunch launch) { FileReader fr = null; BufferedReader br = null; try { String filename = launch.getAttribute(LaunchUtils.ATTR_CLOJURE_SERVER_FILE_PORT); if (filename != null) { File f = new File(filename); fr = new FileReader(f); br = new BufferedReader(fr); return Integer.valueOf(br.readLine()); } } catch (IOException e) { // maybe do not catch exception to not pollute log with false positives? } catch (NumberFormatException e) { // maybe do not catch exception to not pollute log with false positives? } finally { IOUtils.safeClose(br); IOUtils.safeClose(fr); } return -1; } }
/* * To change this template, choose Tools | Templates * and open the template in the editor. */ package org.broad.igv.sam; import com.google.common.base.Predicate; import org.apache.log4j.Logger; import org.broad.igv.data.Interval; import org.broad.igv.feature.FeatureUtils; import org.broad.igv.feature.Locus; import org.broad.igv.feature.SpliceJunctionFeature; import org.broad.igv.feature.Strand; import org.broad.igv.feature.genome.Genome; import org.broad.igv.feature.genome.GenomeManager; import org.broad.igv.ui.panel.ReferenceFrame; import org.broad.tribble.Feature; import java.util.*; import static org.broad.igv.util.collections.CollUtils.filter; /** * @author jrobinso */ public class AlignmentInterval extends Locus implements Interval { private static Logger log = Logger.getLogger(AlignmentInterval.class); Genome genome; private int maxCount = 0; private AlignmentCounts counts; private LinkedHashMap<String, List<Row>> groupedAlignmentRows; // The alignments private List<SpliceJunctionFeature> spliceJunctions; private List<DownsampledInterval> downsampledIntervals; private AlignmentTrack.RenderOptions renderOptions; public AlignmentInterval(String chr, int start, int end, LinkedHashMap<String, List<Row>> groupedAlignmentRows, AlignmentCounts counts, List<SpliceJunctionFeature> spliceJunctions, List<DownsampledInterval> downsampledIntervals, AlignmentTrack.RenderOptions renderOptions) { super(chr, start, end); this.groupedAlignmentRows = groupedAlignmentRows; genome = GenomeManager.getInstance().getCurrentGenome(); //reference = genome.getSequence(chr, start, end); this.counts = counts; this.maxCount = counts.getMaxCount(); this.spliceJunctions = spliceJunctions; this.downsampledIntervals = downsampledIntervals; this.renderOptions = renderOptions; } static AlignmentInterval emptyAlignmentInterval(String chr, int start, int end) { return new AlignmentInterval(chr, start, end, null, null, null, null, null); } static Alignment getFeatureContaining(List<Alignment> features, int right) { int leftBounds = 0; int rightBounds = features.size() - 1; int idx = features.size() / 2; int lastIdx = -1; while (idx != lastIdx) { lastIdx = idx; Alignment f = features.get(idx); if (f.contains(right)) { return f; } if (f.getStart() > right) { rightBounds = idx; idx = (leftBounds + idx) / 2; } else { leftBounds = idx; idx = (rightBounds + idx) / 2; } } // Check the extremes if (features.get(0).contains(right)) { return features.get(0); } if (features.get(rightBounds).contains(right)) { return features.get(rightBounds); } return null; } /** * The "packed" alignments in this interval */ public LinkedHashMap<String, List<Row>> getGroupedAlignments() { return groupedAlignmentRows; } public int getGroupCount() { return groupedAlignmentRows == null ? 0 : groupedAlignmentRows.size(); } public void setAlignmentRows(LinkedHashMap<String, List<Row>> alignmentRows, AlignmentTrack.RenderOptions renderOptions) { this.groupedAlignmentRows = alignmentRows; this.renderOptions = renderOptions; } public void sortRows(AlignmentTrack.SortOption option, ReferenceFrame referenceFrame, String tag) { double center = referenceFrame.getCenter(); sortRows(option, center, tag); } /** * Sort rows group by group * * @param option * @param location */ public void sortRows(AlignmentTrack.SortOption option, double location, String tag) { if (groupedAlignmentRows == null) { return; } for (List<AlignmentInterval.Row> alignmentRows : groupedAlignmentRows.values()) { for (AlignmentInterval.Row row : alignmentRows) { row.updateScore(option, location, this, tag); } Collections.sort(alignmentRows); } } public byte getReference(int pos) { if (genome == null) { return 0; } return genome.getReference(getChr(), pos); } public AlignmentCounts getCounts() { return counts; } /** * Return the count of the specified nucleotide * * @param pos genomic position * @param b nucleotide * @return */ public int getCount(int pos, byte b) { AlignmentCounts c = counts; if (pos >= c.getStart() && pos < c.getEnd()) { return c.getCount(pos, b); } return 0; } public int getMaxCount() { return maxCount; } public AlignmentCounts getAlignmentCounts(int pos) { AlignmentCounts c = counts; if (pos >= c.getStart() && pos < c.getEnd()) { return c; } return null; } public int getTotalCount(int pos) { AlignmentCounts c = counts; if (pos >= c.getStart() && pos < c.getEnd()) { return c.getTotalCount(pos); } return 0; } public int getNegCount(int pos, byte b) { AlignmentCounts c = counts; if (pos >= c.getStart() && pos < c.getEnd()) { return c.getNegCount(pos, b); } return 0; } public int getPosCount(int pos, byte b) { AlignmentCounts c = counts; if (pos >= c.getStart() && pos < c.getEnd()) { return c.getPosCount(pos, b); } return 0; } public int getDelCount(int pos) { AlignmentCounts c = counts; if (pos >= c.getStart() && pos < c.getEnd()) { return c.getDelCount(pos); } return 0; } public int getInsCount(int pos) { AlignmentCounts c = counts; if (pos >= c.getStart() && pos < c.getEnd()) { return c.getInsCount(pos); } return 0; } public Iterator<Alignment> getAlignmentIterator() { return new AlignmentIterator(); } public List<SpliceJunctionFeature> getSpliceJunctions() { return spliceJunctions; } public List<DownsampledInterval> getDownsampledIntervals() { return downsampledIntervals; } @Override public boolean contains(String chr, int start, int end, int zoom) { return super.contains(chr, start, end); } @Override public boolean overlaps(String chr, int start, int end, int zoom) { return super.overlaps(chr, start, end); } @Override public boolean canMerge(Interval i) { if (!super.overlaps(i.getChr(), i.getStart(), i.getEnd()) || !(i instanceof AlignmentInterval)) { return false; } return getCounts().getClass().equals(((AlignmentInterval) i).getCounts().getClass()); } @Override public boolean merge(Interval i) { boolean canMerge = this.canMerge(i); if (!canMerge) return false; AlignmentInterval other = (AlignmentInterval) i; List<Alignment> allAlignments = (List<Alignment>) FeatureUtils.combineSortedFeatureListsNoDups( getAlignmentIterator(), other.getAlignmentIterator(), start, end); this.counts = counts.merge(other.getCounts(), renderOptions.bisulfiteContext); this.spliceJunctions = FeatureUtils.combineSortedFeatureListsNoDups(this.spliceJunctions, other.getSpliceJunctions(), start, end); this.downsampledIntervals = FeatureUtils.combineSortedFeatureListsNoDups(this.downsampledIntervals, other.getDownsampledIntervals(), start, end); //This must be done AFTER calling combineSortedFeatureListsNoDups for the last time, //because we rely on the original start/end this.start = Math.min(getStart(), i.getStart()); this.end = Math.max(getEnd(), i.getEnd()); this.maxCount = Math.max(this.getMaxCount(), other.getMaxCount()); AlignmentPacker packer = new AlignmentPacker(); this.groupedAlignmentRows = packer.packAlignments(allAlignments.iterator(), this.end, renderOptions); return true; } /** * Remove data outside the specified interval. * This interval must contain the specified interval. * * @param chr * @param start * @param end * @param zoom * @return true if any trimming was performed, false if not */ public boolean trimTo(final String chr, final int start, final int end, int zoom) { boolean toRet = false; if (!this.contains(chr, start, end, zoom)) { return false; } for (String groupKey : groupedAlignmentRows.keySet()) { for (AlignmentInterval.Row row : groupedAlignmentRows.get(groupKey)) { Iterator<Alignment> alIter = row.alignments.iterator(); Alignment al; while (alIter.hasNext()) { al = alIter.next(); if (al.getEnd() < start || al.getStart() > end) { alIter.remove(); toRet |= true; } } } } Predicate<Feature> overlapPredicate = FeatureUtils.getOverlapPredicate(chr, start, end); //getCounts().trimTo(chr, start, end); filter(this.getDownsampledIntervals(), overlapPredicate); filter(this.getSpliceJunctions(), overlapPredicate); this.start = Math.max(this.start, start); this.end = Math.min(this.end, end); return toRet; } private List addToListNoDups(List self, List other) { if (self == null) self = new ArrayList(); if (other != null) { Set selfSet = new HashSet(self); selfSet.addAll(other); self = new ArrayList(selfSet); FeatureUtils.sortFeatureList(self); } return self; } /** * AlignmentInterval data is independent of zoom * * @return */ @Override public int getZoom() { return -1; } public static class Row implements Comparable<Row> { int nextIdx; private double score = 0; List<Alignment> alignments; private int start; private int lastEnd; public Row() { nextIdx = 0; this.alignments = new ArrayList(100); } public void addAlignment(Alignment alignment) { if (alignments.isEmpty()) { this.start = alignment.getStart(); } alignments.add(alignment); lastEnd = alignment.getEnd(); } public void updateScore(AlignmentTrack.SortOption option, Locus locus, AlignmentInterval interval, String tag) { double mean = 0; //double sd = 0; int number = 0; for (int center = locus.getStart(); center < locus.getEnd(); center++) { double value = calculateScore(option, center, interval, tag); mean = number * (mean / (number + 1)) + (value / (number + 1)); number++; } setScore(mean); } public void updateScore(AlignmentTrack.SortOption option, double center, AlignmentInterval interval, String tag) { setScore(calculateScore(option, center, interval, tag)); } public double calculateScore(AlignmentTrack.SortOption option, double center, AlignmentInterval interval, String tag) { int adjustedCenter = (int) center; Alignment centerAlignment = getFeatureContaining(alignments, adjustedCenter); if (centerAlignment == null) { return Integer.MAX_VALUE; } else { switch (option) { case START: return centerAlignment.getStart(); case STRAND: return centerAlignment.isNegativeStrand() ? -1 : 1; case FIRST_OF_PAIR_STRAND: Strand strand = centerAlignment.getFirstOfPairStrand(); int score = 2; if (strand != Strand.NONE) { score = strand == Strand.NEGATIVE ? 1 : -1; } return score; case NUCELOTIDE: byte base = centerAlignment.getBase(adjustedCenter); byte ref = interval.getReference(adjustedCenter); if (base == 'N' || base == 'n') { return 2; // Base is "n" } else if (base == ref) { return 3; // Base is reference } else { //If base is 0, base not covered (splice junction) or is deletion if (base == 0) { int delCount = interval.getDelCount(adjustedCenter); if (delCount > 0) { return -delCount; } else { //Base not covered, NOT a deletion return 1; } } else { int count = interval.getCount(adjustedCenter, base); byte phred = centerAlignment.getPhred(adjustedCenter); return -(count + (phred / 100.0f)); } } case QUALITY: return -centerAlignment.getMappingQuality(); case SAMPLE: String sample = centerAlignment.getSample(); score = sample == null ? 0 : sample.hashCode(); return score; case READ_GROUP: String readGroup = centerAlignment.getReadGroup(); score = readGroup == null ? 0 : readGroup.hashCode(); return score; case INSERT_SIZE: return -Math.abs(centerAlignment.getInferredInsertSize()); case MATE_CHR: ReadMate mate = centerAlignment.getMate(); if (mate == null) { return Integer.MAX_VALUE; } else { if (mate.getChr().equals(centerAlignment.getChr())) { return Integer.MAX_VALUE - 1; } else { return mate.getChr().hashCode(); } } case TAG: Object tagValue = centerAlignment.getAttribute(tag); score = tagValue == null ? 0 : tagValue.hashCode(); return score; default: return Integer.MAX_VALUE; } } } // Used for iterating over all alignments, e.g. for packing public Alignment nextAlignment() { if (nextIdx < alignments.size()) { Alignment tmp = alignments.get(nextIdx); nextIdx++; return tmp; } else { return null; } } public int getNextStartPos() { if (nextIdx < alignments.size()) { return alignments.get(nextIdx).getStart(); } else { return Integer.MAX_VALUE; } } public boolean hasNext() { return nextIdx < alignments.size(); } public void resetIdx() { nextIdx = 0; } /** * @return the score */ public double getScore() { return score; } /** * @param score the score to set */ public void setScore(double score) { this.score = score; } public int getStart() { return start; } public int getLastEnd() { return lastEnd; } @Override public int compareTo(Row o) { return (int) Math.signum(getScore() - o.getScore()); } // @Override // public boolean equals(Object object){ // if(!(object instanceof Row)){ // return false; // Row other = (Row) object; // boolean equals = this.getStart() == other.getStart(); // equals &= this.getLastEnd() == other.getLastEnd(); // equals &= this.getScore() == other.getScore(); // return equals; // @Override // public int hashCode(){ // int score = (int) getScore(); // score = score != 0 ? score : 1; // return (getStart() * getLastEnd() * score); } // end class row /** * An alignment iterator that iterates over packed rows. Used for * "repacking". Using the iterator avoids the need to copy alignments * from the rows */ class AlignmentIterator implements Iterator<Alignment> { PriorityQueue<AlignmentInterval.Row> rows; Alignment nextAlignment; AlignmentIterator() { rows = new PriorityQueue(5, new Comparator<AlignmentInterval.Row>() { public int compare(AlignmentInterval.Row o1, AlignmentInterval.Row o2) { return o1.getNextStartPos() - o2.getNextStartPos(); } }); for (List<AlignmentInterval.Row> alignmentRows : groupedAlignmentRows.values()) { for (AlignmentInterval.Row r : alignmentRows) { r.resetIdx(); rows.add(r); } } advance(); } public boolean hasNext() { return nextAlignment != null; } public Alignment next() { Alignment tmp = nextAlignment; if (tmp != null) { advance(); } return tmp; } private void advance() { nextAlignment = null; AlignmentInterval.Row nextRow = null; while (nextAlignment == null && !rows.isEmpty()) { while ((nextRow = rows.poll()) != null) { if (nextRow.hasNext()) { nextAlignment = nextRow.nextAlignment(); break; } } } if (nextRow != null && nextAlignment != null) { rows.add(nextRow); } } public void remove() { // ignore } } }
/* * To change this template, choose Tools | Templates * and open the template in the editor. */ package org.broad.igv.tools; import net.sf.samtools.util.CloseableIterator; import org.broad.igv.feature.*; import org.broad.igv.feature.genome.Genome; import org.broad.igv.sam.Alignment; import org.broad.igv.sam.AlignmentBlock; import org.broad.igv.sam.ReadMate; import org.broad.igv.sam.reader.AlignmentQueryReader; import org.broad.igv.sam.reader.MergedAlignmentReader; import org.broad.igv.sam.reader.MergedAlignmentReader2; import org.broad.igv.sam.reader.SamQueryReaderFactory; import org.broad.igv.tools.parsers.DataConsumer; import org.broad.igv.ui.filefilters.AlignmentFileFilter; import org.broad.igv.util.FileUtils; import org.broad.igv.util.stats.Distribution; import org.broad.tribble.Feature; import org.broad.tribble.util.HttpUtils; import java.io.File; import java.io.FileWriter; import java.io.IOException; import java.io.PrintWriter; import java.util.*; import java.util.List; /** * TODO -- normalize option * -n Normalize the count by the total number of reads. This option multiplies each count by (1,000,000 / total # of reads). It is useful when comparing multiple chip-seq experiments when the absolute coverage depth is not important. */ public class CoverageCounter { private int upperExpectedInsertSize = 600; private int lowerExpectedInsertSize = 200; enum Event { mismatch, indel, largeISize, smallISize, inversion, duplication, inter, unmappedMate } private String alignmentFile; private File tdfFile; private DataConsumer consumer; private float[] buffer; private int windowSize = 1; // TODO -- make mapping qulaity a parameter private int minMappingQuality = 0; private int strandOption = -1; private int extFactor; private int totalCount = 0; private File wigFile = null; private WigWriter wigWriter = null; private boolean keepZeroes = false; private Genome genome; private String readGroup; // The read group to count Map<Event, WigWriter> writers = new HashMap(); private boolean computeTDF = true; private Distribution coverageHistogram; private static final double LOG_1__1 = 0.09531018; private String interval = null; // TODO Sigma hack List<Feature> genes; public CoverageCounter(String alignmentFile, DataConsumer consumer, int windowSize, int extFactor, File tdfFile, // For reference File wigFile, Genome genome, int strandOption, String options) { this.alignmentFile = alignmentFile; this.tdfFile = tdfFile; this.consumer = consumer; this.windowSize = windowSize; this.extFactor = extFactor; this.wigFile = wigFile; this.genome = genome; this.strandOption = strandOption; buffer = strandOption < 0 ? new float[1] : new float[2]; if (options != null) { parseOptions(options); } // TODO Sigma hack genes = GeneManager.getGeneManager(genome.getId()).getGenesForChromosome("chr1"); } private void parseOptions(String options) { try { String[] opts = options.split(","); for (String opt : opts) { if (opt.startsWith("l:")) { String[] tmp = opt.split(":"); readGroup = tmp[1]; } else if (opt.startsWith("q")) { String[] tmp = opt.split("@"); interval = tmp[1]; } else if (opt.startsWith("i")) { writers.put(Event.largeISize, new WigWriter(new File(getFilenameBase() + ".large_isize.wig"), windowSize)); writers.put(Event.smallISize, new WigWriter(new File(getFilenameBase() + ".small_isize.wig"), windowSize)); // Optionally specify mean and std dev (todo -- just specify min and max) String[] tokens = opt.split(":"); if (tokens.length > 2) { //float median = Float.parseFloat(tokens[1]); //float mad = Float.parseFloat(tokens[2]); //upperExpectedInsertSize = (int) (median + 3 * mad); //lowerExpectedInsertSize = Math.max(50, (int) (median - 3 * mad)); int min = Integer.parseInt(tokens[1]); int max = Integer.parseInt(tokens[2]); upperExpectedInsertSize = min; lowerExpectedInsertSize = max; } else { PairedEndStats stats = PairedEndStats.compute(alignmentFile); if (stats == null) { System.out.println("Warning: error computing stats. Using default insert size settings"); } else { //double median = stats.getMedianInsertSize(); //double mad = stats.getMadInsertSize(); //upperExpectedInsertSize = (int) (median + 3 * mad); //lowerExpectedInsertSize = Math.max(50, (int) (median - 3 * mad)); upperExpectedInsertSize = (int) stats.getMaxPercentileInsertSize(); lowerExpectedInsertSize = (int) stats.getMinPercentileInsertSize(); System.out.println(alignmentFile + " min = " + lowerExpectedInsertSize + " max = " + upperExpectedInsertSize); } } } else if (opt.equals("o")) { writers.put(Event.inversion, new WigWriter(new File(getFilenameBase() + ".inversion.wig"), windowSize)); writers.put(Event.duplication, new WigWriter(new File(getFilenameBase() + ".duplication.wig"), windowSize)); } else if (opt.equals("m")) { writers.put(Event.mismatch, new WigWriter(new File(getFilenameBase() + ".mismatch.wig"), windowSize)); } else if (opt.equals("d")) { writers.put(Event.indel, new WigWriter(new File(getFilenameBase() + ".indel.wig"), windowSize)); } else if (opt.equals("u")) { writers.put(Event.unmappedMate, new WigWriter(new File(getFilenameBase() + ".nomate.wig"), windowSize)); } else if (opt.equals("r")) { writers.put(Event.inter, new WigWriter(new File(getFilenameBase() + ".inter.wig"), windowSize)); } else if (opt.equals("h")) { coverageHistogram = new Distribution(200); } else if (opt.equals("a")) { keepZeroes = true; } else { System.out.println("Unknown coverage option: " + opt); } } } catch (IOException e) { e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates. } } private String getFilenameBase() { String tmp = tdfFile.getAbsolutePath(); tmp = tmp.substring(0, tmp.length() - 4); if (readGroup != null) { tmp += "." + readGroup; } return tmp; } // TODO -- options to ovveride all of these checks private boolean passFilter(Alignment alignment) { return (readGroup == null || readGroup.equals(alignment.getReadGroup())) && alignment.isMapped() && !alignment.isDuplicate() && alignment.getMappingQuality() >= minMappingQuality && !alignment.isVendorFailedRead(); } public void parse() { int tolerance = (int) (windowSize * (Math.floor(extFactor / windowSize) + 2)); consumer.setSortTolerance(tolerance); AlignmentQueryReader reader = null; CloseableIterator<Alignment> iter = null; String lastChr = ""; ReadCounter counter = null; try { if (wigFile != null) { wigWriter = new WigWriter(wigFile, windowSize); } reader = getReader(alignmentFile, false); if (interval == null) { iter = reader.iterator(); } else { Locus locus = new Locus(interval); iter = reader.query(locus.getChr(), locus.getStart(), locus.getEnd(), false); } while (iter != null && iter.hasNext()) { Alignment alignment = iter.next(); if (passFilter(alignment)) { totalCount++; String alignmentChr = alignment.getChr(); // Close all counters with position < alignment.getStart() if (alignmentChr.equals(lastChr)) { if (counter != null) { counter.closeBucketsBefore(alignment.getAlignmentStart() - tolerance); } } else { if (counter != null) { counter.closeBucketsBefore(Integer.MAX_VALUE); } counter = new ReadCounter(alignmentChr); lastChr = alignmentChr; } if (alignment.getMappingQuality() == 0) { // TODO -- mq zero event } else if (alignment.isPaired()) { final int start = alignment.getStart(); final int end = alignment.getEnd(); counter.incrementPairedCount(start, end); ReadMate mate = alignment.getMate(); boolean mateMapped = mate != null && mate.isMapped(); boolean sameChromosome = mateMapped && mate.getChr().equals(alignment.getChr()); if (mateMapped) { if (sameChromosome) { // Pair orientation String oStr = alignment.getPairOrientation(); if (oStr.equals("R1F2") || oStr.equals("R2F1")) { counter.incrementPairedEvent(start, end, Event.duplication); } else if (oStr.equals("F1F2") || oStr.equals("F2F1") || oStr.equals("R1R2") || oStr.equals("R2R1")) { counter.incrementPairedEvent(start, end, Event.inversion); } // Insert size int isize = Math.abs(alignment.getInferredInsertSize()); if (isize > upperExpectedInsertSize) { counter.incrementPairedEvent(start, end, Event.largeISize); } if (isize < lowerExpectedInsertSize) { counter.incrementPairedEvent(start, end, Event.smallISize); } } else { counter.incrementPairedEvent(start, end, Event.inter); } } else { // unmapped mate counter.incrementPairedEvent(start, end, Event.unmappedMate); } } AlignmentBlock[] blocks = alignment.getAlignmentBlocks(); if (blocks != null) { int lastBlockEnd = -1; for (AlignmentBlock block : blocks) { if (!block.isSoftClipped()) { if (lastBlockEnd >= 0) { String c = alignment.getCigarString(); int s = block.getStart(); if (s > lastBlockEnd) { counter.incrementEvent(lastBlockEnd, Event.indel); } } byte[] bases = block.getBases(); int blockStart = block.getStart(); int adjustedStart = block.getStart(); int adjustedEnd = block.getEnd(); if (alignment.isNegativeStrand()) { adjustedStart = Math.max(0, adjustedStart - extFactor); } else { adjustedEnd += extFactor; } for (int pos = adjustedStart; pos < adjustedEnd; pos++) { byte base = 0; int baseIdx = pos - blockStart; if (bases != null && baseIdx >= 0 && baseIdx < bases.length) { base = bases[baseIdx]; } int idx = pos - blockStart; byte quality = (idx >= 0 && idx < block.qualities.length) ? block.qualities[pos - blockStart] : (byte) 0; counter.incrementCount(pos, base, quality); } lastBlockEnd = block.getEnd(); } } } else { int adjustedStart = alignment.getAlignmentStart(); int adjustedEnd = alignment.getAlignmentEnd(); if (alignment.isNegativeStrand()) { adjustedStart = Math.max(0, adjustedStart - extFactor); } else { adjustedEnd += extFactor; } for (int pos = adjustedStart; pos < adjustedEnd; pos++) { counter.incrementCount(pos, (byte) 0, (byte) 0); } } if (writers.containsKey(Event.indel)) { for (AlignmentBlock block : alignment.getInsertions()) { counter.incrementEvent(block.getStart(), Event.indel); } } } } } catch (Exception e) { e.printStackTrace(); } finally { if (counter != null) { counter.closeBucketsBefore(Integer.MAX_VALUE); } consumer.setAttribute("totalCount", String.valueOf(totalCount)); consumer.parsingComplete(); if (iter != null) { iter.close(); } if (reader != null) { try { reader.close(); } catch (IOException e) { e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates. } } if (wigWriter != null) { wigWriter.close(); } for (WigWriter writer : writers.values()) { writer.close(); } if (coverageHistogram != null) { try { PrintWriter pw = new PrintWriter(new FileWriter(getFilenameBase() + ".hist.txt")); coverageHistogram.print(pw); pw.close(); } catch (IOException e) { e.printStackTrace(); //To change body of catch statement use File | Settings | File Templates. } } } } private AlignmentQueryReader getReader(String alignmentFile, boolean b) throws IOException { boolean isList = alignmentFile.indexOf(",") > 0; if (isList) { String[] tokens = alignmentFile.split(","); List<AlignmentQueryReader> readers = new ArrayList(tokens.length); for (String f : tokens) { readers.add(SamQueryReaderFactory.getReader(f, b)); } return new MergedAlignmentReader(readers); } else { if (!FileUtils.isRemote(alignmentFile)) { File f = new File(alignmentFile); if (f.isDirectory()) { List<AlignmentQueryReader> readers = new ArrayList(); for (File file : f.listFiles(new AlignmentFileFilter())) { readers.add(SamQueryReaderFactory.getReader(file.getAbsolutePath(), b)); } return new MergedAlignmentReader(readers); } } return SamQueryReaderFactory.getReader(alignmentFile, b); } } class ReadCounter { String chr; TreeMap<Integer, Counter> counts = new TreeMap(); ReadCounter(String chr) { this.chr = chr; } void incrementCount(int position, byte base, byte quality) { final Counter counter = getCounterForPosition(position); counter.increment(position, base, quality); } void incrementEvent(int position, Event type) { final Counter counter = getCounterForPosition(position); counter.incrementEvent(type, 1); } void incrementPairedCount(int start, int end) { int startIdx = start / windowSize; int endIdx = end / windowSize; for (int idx = startIdx; idx <= endIdx; idx++) { Counter counter = getCounter(idx); counter.incrementPairedCount(fractionOverlap(counter, start, end)); } } // frac should be between 0 and 1 void incrementPairedEvent(int start, int end, Event type) { int startIdx = start / windowSize; int endIdx = end / windowSize; for (int idx = startIdx; idx <= endIdx; idx++) { Counter counter = getCounter(idx); counter.incrementEvent(type, fractionOverlap(counter, start, end)); } } // todo -- move to counter class? float fractionOverlap(Counter counter, int start, int end) { float counterLength = counter.end - counter.start; float overlapLength = Math.min(end, counter.end) - Math.max(start, counter.start); return overlapLength / counterLength; } //public void incrementISize(Alignment alignment) { // int startBucket = alignment.getStart() / windowSize; // int endBucket = alignment.getAlignmentEnd() / windowSize; // for (int bucket = startBucket; bucket <= endBucket; bucket++) { // int bucketStartPosition = bucket * windowSize; // int bucketEndPosition = bucketStartPosition + windowSize; // if (!counts.containsKey(bucket)) { // counts.put(bucket, new Counter(chr, bucketStartPosition, bucketEndPosition)); // final Counter counter = counts.get(bucket); // counter.incrementISize(alignment.getInferredInsertSize()); private Counter getCounterForPosition(int position) { int idx = position / windowSize; return getCounter(idx); } private Counter getCounter(int idx) { if (!counts.containsKey(idx)) { int counterStartPosition = idx * windowSize; int counterEndPosition = counterStartPosition + windowSize; counts.put(idx, new Counter(chr, counterStartPosition, counterEndPosition)); } final Counter counter = counts.get(idx); return counter; } //void incrementNegCount(int position) { // Integer bucket = position / windowSize; // if (!counts.containsKey(bucket)) { // counts.put(bucket, new Counter()); // counts.get(bucket).incrementNeg(); void closeBucketsBefore(int position) { List<Integer> bucketsToClose = new ArrayList(); Integer bucket = position / windowSize; for (Map.Entry<Integer, Counter> entry : counts.entrySet()) { if (entry.getKey() < bucket) { // Divide total count by window size. This is the average count per // base over the window, so 30x coverage remains 30x irrespective of window size. int bucketStartPosition = entry.getKey() * windowSize; int bucketEndPosition = bucketStartPosition + windowSize; if (genome != null) { Chromosome chromosome = genome.getChromosome(chr); if (chromosome != null) { bucketEndPosition = Math.min(bucketEndPosition, chromosome.getLength()); } } int bucketSize = bucketEndPosition - bucketStartPosition; final Counter counter = entry.getValue(); buffer[0] = ((float) counter.getCount()) / bucketSize; if (strandOption > 0) { buffer[1] = ((float) counter.getCount()) / bucketSize; } consumer.addData(chr, bucketStartPosition, bucketEndPosition, buffer, null); for (Map.Entry<Event, WigWriter> entries : writers.entrySet()) { Event evt = entries.getKey(); WigWriter writer = entries.getValue(); float score = counter.getEventScore(evt); writer.addData(chr, bucketStartPosition, bucketEndPosition, score); } if (wigWriter != null) { wigWriter.addData(chr, bucketStartPosition, bucketEndPosition, buffer[0]); } if (coverageHistogram != null) { List<Feature> transcripts = FeatureUtils.getAllFeaturesAt(bucketStartPosition, 10000, 5, genes, false); if (transcripts != null && !transcripts.isEmpty()) { boolean isCoding = false; for (Feature t : transcripts) { Exon exon = ((IGVFeature) t).getExonAt(bucketStartPosition); if (exon != null && !exon.isUTR(bucketStartPosition)) { isCoding = true; break; } } if (isCoding) { int[] baseCounts = counter.getBaseCount(); for (int i = 0; i < baseCounts.length; i++) { coverageHistogram.addDataPoint(baseCounts[i]); } } } } bucketsToClose.add(entry.getKey()); } } for (Integer key : bucketsToClose) { counts.remove(key); } } } /** * Events * base mismatch * translocation * insertion (small) * insertion (large, rearrangment) * deletion (small) * deletion (large, rearrangment) */ class Counter { int count = 0; int negCount = 0; int qualityCount = 0; float pairedCount = 0; float mismatchCount = 0; float indelCount = 0; float largeISizeCount = 0; float smallISizeCount = 0; float inversionCount = 0; float duplicationCount = 0; float unmappedMate = 0; float interChrCount = 0; float totalISizeCount = 0; String chr; int start; int end; byte[] ref; int[] baseCount; //int isizeCount = 0; //float isizeZScore = 0; //float totalIsize = 0; Counter(String chr, int start, int end) { this.chr = chr; this.start = start; this.end = end; baseCount = new int[end - start]; ref = SequenceManager.readSequence(genome.getId(), chr, start, end); } int getCount() { return count; } int getNegCount() { return negCount; } void incrementNeg() { negCount++; } // frac should be between 0 znd 1 void incrementPairedCount(float frac) { pairedCount += frac; } public int[] getBaseCount() { return baseCount; } void increment(int position, byte base, byte quality) { // Qualities of 2 or less => no idea what this base is //if (quality <= 2) { // return; int offset = position - start; baseCount[offset]++; if (ref != null) { byte refBase = ref[offset]; if (refBase != base) { mismatchCount += quality; } } count++; qualityCount += quality; } // frac should be between 0 and 1 void incrementEvent(Event evt, float frac) { switch (evt) { case indel: indelCount += frac; break; case largeISize: largeISizeCount += frac; break; case smallISize: smallISizeCount += frac; break; case inversion: inversionCount += frac; break; case duplication: duplicationCount += frac; break; case inter: interChrCount += frac; break; case unmappedMate: unmappedMate += frac; break; } } public float getEventScore(Event evt) { switch (evt) { case mismatch: return qualityCount < 25 ? 0 : mismatchCount / qualityCount; case indel: return count < 5 ? 0 : indelCount / count; case largeISize: return pairedCount < 5 ? 0 : largeISizeCount / pairedCount; case smallISize: return pairedCount < 5 ? 0 : smallISizeCount / pairedCount; case inversion: return pairedCount < 5 ? 0 : inversionCount / pairedCount; case duplication: return pairedCount < 5 ? 0 : duplicationCount / pairedCount; case inter: return (pairedCount < 5 ? 0 : interChrCount / pairedCount); case unmappedMate: return (pairedCount < 5 ? 0 : unmappedMate / pairedCount); } throw new RuntimeException("Unknown event type: " + evt); } public void incrementISize(int inferredInsertSize) { totalISizeCount++; if (inferredInsertSize > 600) { largeISizeCount++; } else if (inferredInsertSize < 200) { smallISizeCount++; } //float zs = Math.min(6, (Math.abs(inferredInsertSize) - meanInsertSize) / stdDevInsertSize); //isizeZScore += zs; //ppCount++; //if (Math.abs(Math.abs(inferredInsertSize) - meanInsertSize) > 2 * stdDevInsertSize) { // isizeCount++; //otalIsize += Math.abs(inferredInsertSize); } //float getISizeFraction() { // if (pairedCount < 3) { // return 0; // float frac = ((float) isizeCount) / pairedCount; // return frac; //float avg = isizeZScore / ppCount; //return avg; //float getAvgIsize() { // return pairedCount == 0 ? 0 : totalIsize / pairedCount; } /** * Creates a vary step wig file */ class WigWriter { Event event = null; String lastChr = null; int lastPosition = 0; int step; int span; PrintWriter pw; WigWriter(File file, int step) throws IOException { this.step = step; this.span = step; pw = new PrintWriter(new FileWriter(file)); } WigWriter(File file, int step, Event event) throws IOException { this.step = step; this.span = step; pw = new PrintWriter(new FileWriter(file)); this.event = event; } public void addData(String chr, int start, int end, float data) { if (Float.isNaN(data)) { return; } if (genome.getChromosome(chr) == null) { return; } if ((!keepZeroes && data == 0) || end <= start) { return; } int dataSpan = end - start; if (chr == null || !chr.equals(lastChr) || dataSpan != span) { span = dataSpan; outputStepLine(chr, start + 1); } pw.println((start + 1) + "\t" + data); lastPosition = start; lastChr = chr; } private void close() { pw.close(); } private void outputStepLine(String chr, int start) { pw.println("variableStep chrom=" + chr + " span=" + span); } } }
package org.java_websocket; import org.java_websocket.Framedata.Opcode; import org.java_websocket.exeptions.InvalidDataException; public abstract class WebSocketAdapter implements WebSocketListener { /** * This default implementation does not do anything. Go ahead and overwrite it. * * @see org.java_websocket.WebSocketListener#onWebsocketHandshakeRecievedAsServer(org.java_websocket.WebSocket, org.java_websocket.Draft, org.java_websocket.Handshakedata) */ @Override public HandshakeBuilder onWebsocketHandshakeRecievedAsServer( WebSocket conn, Draft draft, Handshakedata request ) throws InvalidDataException { return new HandshakedataImpl1(); } /** * This default implementation does not do anything which will cause connections to be accepted. Go ahead and overwrite it. * * @see org.java_websocket.WebSocketListener#onWebsocketHandshakeRecievedAsClient(org.java_websocket.WebSocket, org.java_websocket.Handshakedata, org.java_websocket.Handshakedata) */ @Override public void onWebsocketHandshakeRecievedAsClient( WebSocket conn, Handshakedata request, Handshakedata response ) throws InvalidDataException { } /** * This default implementation does not do anything. Go ahead and overwrite it. * * @see org.java_websocket.WebSocketListener#onWebsocketMessage(org.java_websocket.WebSocket, java.lang.String) */ @Override public void onWebsocketMessage( WebSocket conn, String message ) { } /** * This default implementation does not do anything. Go ahead and overwrite it. * * @see org.java_websocket.WebSocketListener#onWebsocketOpen(org.java_websocket.WebSocket, org.java_websocket.Handshakedata) */ @Override public void onWebsocketOpen( WebSocket conn, Handshakedata handshake ) { } /** * This default implementation does not do anything. Go ahead and overwrite it. * * @see org.java_websocket.WebSocketListener#onWebsocketClose(org.java_websocket.WebSocket, int, java.lang.String, boolean) */ @Override public void onWebsocketClose( WebSocket conn, int code, String reason, boolean remote ) { } /** * This default implementation does not do anything. Go ahead and overwrite it. * * @see org.java_websocket.WebSocketListener#onWebsocketMessage(org.java_websocket.WebSocket, byte[]) */ @Override public void onWebsocketMessage( WebSocket conn, byte[] blob ) { } /** * This default implementation will send a pong in response to the received ping. * The pong frame will have the same payload as the ping frame. * * @see org.java_websocket.WebSocketListener#onWebsocketPing(org.java_websocket.WebSocket, org.java_websocket.Framedata) */ @Override public void onWebsocketPing( WebSocket conn, Framedata f ) { FramedataImpl1 resp = new FramedataImpl1 ( f ); resp.setOptcode( Opcode.PONG ); try { conn.sendFrame ( resp ); } catch ( InterruptedException e ) { e.printStackTrace(); } } /** * This default implementation does not do anything. Go ahead and overwrite it. * * @see org.java_websocket.WebSocketListener#onWebsocketPong(org.java_websocket.WebSocket, org.java_websocket.Framedata) */ @Override public void onWebsocketPong( WebSocket conn, Framedata f ) { } @Override public String getFlashPolicy( WebSocket conn ) { return "<cross-domain-policy><allow-access-from domain=\"*\" to-ports=\"" + conn.getLocalSocketAddress().getPort() + "\" /></cross-domain-policy>\0"; } /** * This default implementation does not do anything. Go ahead and overwrite it. * @see org.java_websocket.WebSocketListener#onWebsocketError(org.java_websocket.WebSocket, java.lang.Exception) */ @Override public void onWebsocketError( WebSocket conn, Exception ex ) { } }
package org.jgroups.protocols.pbcast; import org.jgroups.Address; import org.jgroups.Event; import org.jgroups.Message; import org.jgroups.View; import org.jgroups.annotations.*; import org.jgroups.conf.PropertyConverters; import org.jgroups.stack.*; import org.jgroups.util.*; import java.io.FileWriter; import java.io.IOException; import java.io.Writer; import java.util.*; import java.util.concurrent.ConcurrentHashMap; import java.util.concurrent.ConcurrentMap; import java.util.concurrent.CopyOnWriteArrayList; import java.util.concurrent.TimeUnit; import java.util.concurrent.atomic.AtomicInteger; import java.util.concurrent.locks.Condition; import java.util.concurrent.locks.Lock; import java.util.concurrent.locks.ReentrantLock; /** * Negative AcKnowledgement layer (NAKs). Messages are assigned a monotonically increasing sequence number (seqno). * Receivers deliver messages ordered according to seqno and request retransmission of missing messages.<br/> * Retransmit requests are usually sent to the original sender of a message, but this can be changed by * xmit_from_random_member (send to random member) or use_mcast_xmit_req (send to everyone). Responses can also be sent * to everyone instead of the requester by setting use_mcast_xmit to true. * * @author Bela Ban * @version $Id: NAKACK.java,v 1.192 2008/06/12 15:18:25 belaban Exp $ */ @MBean(description="Reliable transmission multipoint FIFO protocol") @DeprecatedProperty(names={"max_xmit_size"}) public class NAKACK extends Protocol implements Retransmitter.RetransmitCommand, NakReceiverWindow.Listener { @Property(name="retransmit_timeout",converter=PropertyConverters.LongArray.class) private long[] retransmit_timeouts={600, 1200, 2400, 4800}; // time(s) to wait before requesting retransmission @Property boolean enable_xmit_time_stats = false; private boolean is_server=false; private Address local_addr=null; private final List<Address> members=new CopyOnWriteArrayList<Address>(); private View view; @GuardedBy("seqno_lock") private long seqno=0; // current message sequence number (starts with 1) private final Lock seqno_lock=new ReentrantLock(); @ManagedAttribute(description = "Garbage collection lag", writable = true) @Property private int gc_lag=20; // number of msgs garbage collection lags behind private Map<Thread,ReentrantLock> locks; private static final long INITIAL_SEQNO=0; /** * Retransmit messages using multicast rather than unicast. This has the advantage that, if many receivers lost a * message, the sender only retransmits once. */ @Property @ManagedAttribute(description = "Retransmit messages using multicast rather than unicast", writable = true) private boolean use_mcast_xmit=true; /** Use a multicast to request retransmission of missing messages. This may be costly as every member in the cluster * will send a response */ @Property private boolean use_mcast_xmit_req=false; /** * Ask a random member for retransmission of a missing message. If set to true, discard_delivered_msgs will be * set to false */ @Property @ManagedAttribute(description = "Ask a random member for retransmission of a missing message",writable = true) private boolean xmit_from_random_member=false; /** The first value (in milliseconds) to use in the exponential backoff retransmission mechanism. Only enabled * if the value is > 0 */ @Property private long exponential_backoff=0; /** If enabled, we use statistics gathered from actual retransmission times to compute the new retransmission times */ @Property private boolean use_stats_for_retransmission=false; /** * Messages that have been received in order are sent up the stack (= delivered to the application). Delivered * messages are removed from NakReceiverWindow.xmit_table and moved to NakReceiverWindow.delivered_msgs, where * they are later garbage collected (by STABLE). Since we do retransmits only from sent messages, never * received or delivered messages, we can turn the moving to delivered_msgs off, so we don't keep the message * around, and don't need to wait for garbage collection to remove them. */ @Property @ManagedAttribute(description = "Discard delivered messages",writable = true) private boolean discard_delivered_msgs=false; @Property private boolean eager_lock_release=true; /** If value is > 0, the retransmit buffer is bounded: only the max_xmit_buf_size latest messages are kept, * older ones are discarded when the buffer size is exceeded. A value <= 0 means unbounded buffers */ @Property @ManagedAttribute(description = "If value is > 0, the retransmit buffer is bounded. If value <= 0 unbounded buffers are used", writable = true) private int max_xmit_buf_size=0; /** Map to store sent and received messages (keyed by sender) */ private final ConcurrentMap<Address,NakReceiverWindow> xmit_table=new ConcurrentHashMap<Address,NakReceiverWindow>(11); /** Map which keeps track of threads removing messages from NakReceiverWindows, so we don't wait while a thread * is removing messages */ // private final ConcurrentMap<Address,AtomicBoolean> in_progress=new ConcurrentHashMap<Address,AtomicBoolean>(); private boolean leaving=false; private boolean started=false; private TimeScheduler timer=null; private static final String name="NAKACK"; @ManagedAttribute(description = "Number of retransmit requests received") private long xmit_reqs_received; @ManagedAttribute(description = "Number of retransmit requests sent") private long xmit_reqs_sent; @ManagedAttribute(description = "Number of retransmit responses received" ) private long xmit_rsps_received; @ManagedAttribute(description = "Number of retransmit responses sent" ) private long xmit_rsps_sent; @ManagedAttribute(description = "Number of missing messages received") private long missing_msgs_received; /** Captures stats on XMIT_REQS, XMIT_RSPS per sender */ private HashMap<Address,StatsEntry> sent=new HashMap<Address,StatsEntry>(); /** Captures stats on XMIT_REQS, XMIT_RSPS per receiver */ private HashMap<Address,StatsEntry> received=new HashMap<Address,StatsEntry>(); @Property private int stats_list_size=20; /** BoundedList<MissingMessage>. Keeps track of the last stats_list_size XMIT requests */ private BoundedList<MissingMessage> receive_history; /** BoundedList<XmitRequest>. Keeps track of the last stats_list_size missing messages received */ private BoundedList<XmitRequest> send_history; /** Per-sender map of seqnos and timestamps, to keep track of avg times for retransmission of messages */ private final ConcurrentMap<Address,ConcurrentMap<Long,Long>> xmit_stats=new ConcurrentHashMap<Address,ConcurrentMap<Long,Long>>(); @Property private int xmit_history_max_size=50; /** Maintains a list of the last N retransmission times (duration it took to retransmit a message) for all members */ private final ConcurrentMap<Address,BoundedList<Long>> xmit_times_history=new ConcurrentHashMap<Address,BoundedList<Long>>(); /** Maintains a smoothed average of the retransmission times per sender, these are the actual values that are used for * new retransmission requests */ private final Map<Address,Double> smoothed_avg_xmit_times=new HashMap<Address,Double>(); /** the weight with which we take the previous smoothed average into account, WEIGHT should be >0 and <= 1 */ private static final double WEIGHT=0.9; private static final double INITIAL_SMOOTHED_AVG=30.0; // private final ConcurrentMap<Address,LossRate> loss_rates=new ConcurrentHashMap<Address,LossRate>(); /** * Maintains retransmission related data across a time. Only used if enable_xmit_time_stats is set to true. * At program termination, accumulated data is dumped to a file named by the address of the member. Careful, * don't enable this in production as the data in this hashmap are never reaped ! Really only meant for * diagnostics ! */ private ConcurrentMap<Long,XmitTimeStat> xmit_time_stats=null; private long xmit_time_stats_start; /** Keeps track of OOB messages sent by myself, needed by {@link #handleMessage(org.jgroups.Message, NakAckHeader)} */ private final Set<Long> oob_loopback_msgs=Collections.synchronizedSet(new HashSet<Long>()); private final Lock rebroadcast_lock=new ReentrantLock(); private final Condition rebroadcast_done=rebroadcast_lock.newCondition(); // set during processing of a rebroadcast event private volatile boolean rebroadcasting=false; private final Lock rebroadcast_digest_lock=new ReentrantLock(); @GuardedBy("rebroadcast_digest_lock") private Digest rebroadcast_digest=null; @Property private long max_rebroadcast_timeout=2000; private static final int NUM_REBROADCAST_MSGS=3; /** BoundedList<Digest>, keeps the last 10 stability messages */ private final BoundedList<Digest> stability_msgs=new BoundedList<Digest>(10); /** When not finding a message on an XMIT request, include the last N stability messages in the error message */ @Property protected boolean print_stability_history_on_failed_xmit=false; /** If true, logs messages discarded because received from other members */ @ManagedAttribute(description="If true, logs messages discarded because received from other members",writable=true) private boolean log_discard_msgs=true; /** <em>Regular</em> messages which have been added, but not removed */ private final AtomicInteger undelivered_msgs=new AtomicInteger(0); @ManagedAttribute public int getUndeliveredMessages() { return undelivered_msgs.get(); } public NAKACK() { } public String getName() { return name; } public long getXmitRequestsReceived() {return xmit_reqs_received;} public long getXmitRequestsSent() {return xmit_reqs_sent;} public long getXmitResponsesReceived() {return xmit_rsps_received;} public long getXmitResponsesSent() {return xmit_rsps_sent;} public long getMissingMessagesReceived() {return missing_msgs_received;} @ManagedAttribute public int getPendingRetransmissionRequests() { int num=0; for(NakReceiverWindow win: xmit_table.values()) { num+=win.getPendingXmits(); } return num; } @ManagedAttribute public int getXmitTableSize() { int num=0; for(NakReceiverWindow win: xmit_table.values()) { num+=win.size(); } return num; } public int getReceivedTableSize() { return getPendingRetransmissionRequests(); } public void resetStats() { xmit_reqs_received=xmit_reqs_sent=xmit_rsps_received=xmit_rsps_sent=missing_msgs_received=0; sent.clear(); received.clear(); if(receive_history !=null) receive_history.clear(); if(send_history != null) send_history.clear(); } public void init() throws Exception { if(enable_xmit_time_stats) { if(log.isWarnEnabled()) log.warn("enable_xmit_time_stats is experimental, and may be removed in any release"); xmit_time_stats=new ConcurrentHashMap<Long,XmitTimeStat>(); xmit_time_stats_start=System.currentTimeMillis(); } if(xmit_from_random_member) { if(discard_delivered_msgs) { discard_delivered_msgs=false; log.warn("xmit_from_random_member set to true: changed discard_delivered_msgs to false"); } } if(stats) { send_history=new BoundedList<XmitRequest>(stats_list_size); receive_history=new BoundedList<MissingMessage>(stats_list_size); } } public int getGcLag() { return gc_lag; } public void setGcLag(int gc_lag) { this.gc_lag=gc_lag; } public boolean isUseMcastXmit() { return use_mcast_xmit; } public void setUseMcastXmit(boolean use_mcast_xmit) { this.use_mcast_xmit=use_mcast_xmit; } public boolean isXmitFromRandomMember() { return xmit_from_random_member; } public void setXmitFromRandomMember(boolean xmit_from_random_member) { this.xmit_from_random_member=xmit_from_random_member; } public boolean isDiscardDeliveredMsgs() { return discard_delivered_msgs; } public void setDiscardDeliveredMsgs(boolean discard_delivered_msgs) { boolean old=this.discard_delivered_msgs; this.discard_delivered_msgs=discard_delivered_msgs; if(old != this.discard_delivered_msgs) { for(NakReceiverWindow win: xmit_table.values()) { win.setDiscardDeliveredMessages(this.discard_delivered_msgs); } } } public int getMaxXmitBufSize() { return max_xmit_buf_size; } public void setMaxXmitBufSize(int max_xmit_buf_size) { this.max_xmit_buf_size=max_xmit_buf_size; } /** * * @return * @deprecated removed in 2.6 */ public long getMaxXmitSize() { return -1; } /** * * @param max_xmit_size * @deprecated removed in 2.6 */ public void setMaxXmitSize(long max_xmit_size) { } public void setLogDiscardMessages(boolean flag) { log_discard_msgs=flag; } public boolean getLogDiscardMessages() { return log_discard_msgs; } public Map<String,Object> dumpStats() { Map<String,Object> retval=super.dumpStats(); if(retval == null) retval=new HashMap<String,Object>(); retval.put("xmit_reqs_received", new Long(xmit_reqs_received)); retval.put("xmit_reqs_sent", new Long(xmit_reqs_sent)); retval.put("xmit_rsps_received", new Long(xmit_rsps_received)); retval.put("xmit_rsps_sent", new Long(xmit_rsps_sent)); retval.put("missing_msgs_received", new Long(missing_msgs_received)); retval.put("msgs", printMessages()); return retval; } public String printStats() { Map.Entry entry; Object key, val; StringBuilder sb=new StringBuilder(); sb.append("sent:\n"); for(Iterator it=sent.entrySet().iterator(); it.hasNext();) { entry=(Map.Entry)it.next(); key=entry.getKey(); if(key == null) key="<mcast dest>"; val=entry.getValue(); sb.append(key).append(": ").append(val).append("\n"); } sb.append("\nreceived:\n"); for(Iterator it=received.entrySet().iterator(); it.hasNext();) { entry=(Map.Entry)it.next(); key=entry.getKey(); val=entry.getValue(); sb.append(key).append(": ").append(val).append("\n"); } sb.append("\nXMIT_REQS sent:\n"); for(XmitRequest tmp: send_history) { sb.append(tmp).append("\n"); } sb.append("\nMissing messages received\n"); for(MissingMessage missing: receive_history) { sb.append(missing).append("\n"); } sb.append("\nStability messages received\n"); sb.append(printStabilityMessages()).append("\n"); return sb.toString(); } @ManagedOperation(description="TODO") public String printStabilityMessages() { StringBuilder sb=new StringBuilder(); sb.append(Util.printListWithDelimiter(stability_msgs, "\n")); return sb.toString(); } public String printStabilityHistory() { StringBuilder sb=new StringBuilder(); int i=1; for(Digest digest: stability_msgs) { sb.append(i++).append(": ").append(digest).append("\n"); } return sb.toString(); } @ManagedOperation(description="TODO") public String printLossRates() { StringBuilder sb=new StringBuilder(); NakReceiverWindow win; for(Map.Entry<Address,NakReceiverWindow> entry: xmit_table.entrySet()) { win=entry.getValue(); sb.append(entry.getKey()).append(": ").append(win.printLossRate()).append("\n"); } return sb.toString(); } @ManagedAttribute public double getAverageLossRate() { double retval=0.0; int count=0; if(xmit_table.isEmpty()) return 0.0; for(NakReceiverWindow win: xmit_table.values()) { retval+=win.getLossRate(); count++; } return retval / (double)count; } @ManagedAttribute public double getAverageSmoothedLossRate() { double retval=0.0; int count=0; if(xmit_table.isEmpty()) return 0.0; for(NakReceiverWindow win: xmit_table.values()) { retval+=win.getSmoothedLossRate(); count++; } return retval / (double)count; } public Vector<Integer> providedUpServices() { Vector<Integer> retval=new Vector<Integer>(5); retval.addElement(new Integer(Event.GET_DIGEST)); retval.addElement(new Integer(Event.SET_DIGEST)); retval.addElement(new Integer(Event.MERGE_DIGEST)); return retval; } public void start() throws Exception { timer=getTransport().getTimer(); if(timer == null) throw new Exception("timer is null"); locks=stack.getLocks(); started=true; if(xmit_time_stats != null) { Runtime.getRuntime().addShutdownHook(new Thread() { public void run() { String filename="xmit-stats-" + local_addr + ".log"; System.out.println("-- dumping runtime xmit stats to " + filename); try { dumpXmitStats(filename); } catch(IOException e) { e.printStackTrace(); } } }); } } public void stop() { started=false; reset(); // clears sent_msgs and destroys all NakReceiverWindows oob_loopback_msgs.clear(); } /** * <b>Callback</b>. Called by superclass when event may be handled.<p> <b>Do not use <code>down_prot.down()</code> in this * method as the event is passed down by default by the superclass after this method returns !</b> */ public Object down(Event evt) { switch(evt.getType()) { case Event.MSG: Message msg=(Message)evt.getArg(); Address dest=msg.getDest(); if(dest != null && !dest.isMulticastAddress()) { break; // unicast address: not null and not mcast, pass down unchanged } send(evt, msg); return null; // don't pass down the stack case Event.STABLE: // generated by STABLE layer. Delete stable messages passed in arg stable((Digest)evt.getArg()); return null; // do not pass down further (Bela Aug 7 2001) case Event.GET_DIGEST: return getDigest(); case Event.SET_DIGEST: setDigest((Digest)evt.getArg()); return null; case Event.MERGE_DIGEST: mergeDigest((Digest)evt.getArg()); return null; case Event.TMP_VIEW: View tmp_view=(View)evt.getArg(); Vector<Address> mbrs=tmp_view.getMembers(); members.clear(); members.addAll(mbrs); // adjustReceivers(false); break; case Event.VIEW_CHANGE: tmp_view=(View)evt.getArg(); mbrs=tmp_view.getMembers(); members.clear(); members.addAll(mbrs); adjustReceivers(members); is_server=true; // check vids from now on Set<Address> tmp=new LinkedHashSet<Address>(members); tmp.add(null); // for null destination (= mcast) sent.keySet().retainAll(tmp); received.keySet().retainAll(tmp); view=tmp_view; xmit_stats.keySet().retainAll(tmp); // in_progress.keySet().retainAll(mbrs); // remove elements which are not in the membership break; case Event.BECOME_SERVER: is_server=true; break; case Event.DISCONNECT: leaving=true; reset(); break; case Event.REBROADCAST: rebroadcasting=true; rebroadcast_digest=(Digest)evt.getArg(); try { rebroadcastMessages(); } finally { rebroadcasting=false; rebroadcast_digest_lock.lock(); try { rebroadcast_digest=null; } finally { rebroadcast_digest_lock.unlock(); } } return null; } return down_prot.down(evt); } /** * <b>Callback</b>. Called by superclass when event may be handled.<p> <b>Do not use <code>PassUp</code> in this * method as the event is passed up by default by the superclass after this method returns !</b> */ public Object up(Event evt) { switch(evt.getType()) { case Event.MSG: Message msg=(Message)evt.getArg(); NakAckHeader hdr=(NakAckHeader)msg.getHeader(name); if(hdr == null) break; // pass up (e.g. unicast msg) // discard messages while not yet server (i.e., until JOIN has returned) if(!is_server) { if(log.isTraceEnabled()) log.trace("message was discarded (not yet server)"); return null; } // Changed by bela Jan 29 2003: we must not remove the header, otherwise // further xmit requests will fail ! //hdr=(NakAckHeader)msg.removeHeader(getName()); switch(hdr.type) { case NakAckHeader.MSG: handleMessage(msg, hdr); return null; // transmitter passes message up for us ! case NakAckHeader.XMIT_REQ: if(hdr.range == null) { if(log.isErrorEnabled()) { log.error("XMIT_REQ: range of xmit msg is null; discarding request from " + msg.getSrc()); } return null; } handleXmitReq(msg.getSrc(), hdr.range.low, hdr.range.high, hdr.sender); return null; case NakAckHeader.XMIT_RSP: if(log.isTraceEnabled()) log.trace("received missing message " + msg.getSrc() + ":" + hdr.seqno); handleXmitRsp(msg); return null; default: if(log.isErrorEnabled()) { log.error("NakAck header type " + hdr.type + " not known !"); } return null; } case Event.STABLE: // generated by STABLE layer. Delete stable messages passed in arg stable((Digest)evt.getArg()); return null; // do not pass up further (Bela Aug 7 2001) case Event.SET_LOCAL_ADDRESS: local_addr=(Address)evt.getArg(); break; case Event.SUSPECT: // release the promise if rebroadcasting is in progress... otherwise we wait forever. there will be a new // flush round anyway if(rebroadcasting) { cancelRebroadcasting(); } break; } return up_prot.up(evt); } private void send(Event evt, Message msg) { if(msg == null) throw new NullPointerException("msg is null; event is " + evt); if(!started) { if(log.isTraceEnabled()) log.trace("[" + local_addr + "] discarded message as start() has not been called, message: " + msg); return; } long msg_id; NakReceiverWindow win=xmit_table.get(local_addr); msg.setSrc(local_addr); // this needs to be done so we can check whether the message sender is the local_addr seqno_lock.lock(); try { try { // incrementing seqno and adding the msg to sent_msgs needs to be atomic msg_id=seqno +1; msg.putHeader(name, new NakAckHeader(NakAckHeader.MSG, msg_id)); win.add(msg_id, msg); seqno=msg_id; } catch(Throwable t) { throw new RuntimeException("failure adding msg " + msg + " to the retransmit table for " + local_addr, t); } } finally { seqno_lock.unlock(); } try { if(msg.isFlagSet(Message.OOB)) oob_loopback_msgs.add(msg_id); if(log.isTraceEnabled()) log.trace("sending " + local_addr + "#" + msg_id); down_prot.down(evt); // if this fails, since msg is in sent_msgs, it can be retransmitted } catch(Throwable t) { // eat the exception, don't pass it up the stack if(log.isWarnEnabled()) { log.warn("failure passing message down", t); } } } /** * Finds the corresponding NakReceiverWindow and adds the message to it (according to seqno). Then removes as many * messages as possible from the NRW and passes them up the stack. Discards messages from non-members. */ private void handleMessage(Message msg, NakAckHeader hdr) { Address sender=msg.getSrc(); if(sender == null) { if(log.isErrorEnabled()) log.error("sender of message is null"); return; } if(log.isTraceEnabled()) log.trace(new StringBuilder().append('[').append(local_addr).append(": received ").append(sender).append('#').append(hdr.seqno)); NakReceiverWindow win=xmit_table.get(sender); if(win == null) { // discard message if there is no entry for sender if(leaving) return; if(log.isWarnEnabled() && log_discard_msgs) log.warn(local_addr + "] discarded message from non-member " + sender + ", my view is " + view); return; } boolean loopback=local_addr.equals(sender); boolean added=loopback || win.add(hdr.seqno, msg); boolean regular_msg_added=added && !msg.isFlagSet(Message.OOB); // message is passed up if OOB. Later, when remove() is called, we discard it. This affects ordering ! if(added && msg.isFlagSet(Message.OOB)) { if(!loopback || oob_loopback_msgs.remove(hdr.seqno)) { up_prot.up(new Event(Event.MSG, msg)); win.removeOOBMessage(); if(!(win.hasMessagesToRemove() && undelivered_msgs.get() > 0)) return; } } // where lots of threads can come up to this point concurrently, but only 1 is allowed to pass at a time // We *can* deliver messages from *different* senders concurrently, e.g. reception of P1, Q1, P2, Q2 can result in // delivery of P1, Q1, Q2, P2: FIFO (implemented by NAKACK) says messages need to be delivered in the // order in which they were sent by the sender Message msg_to_deliver; ReentrantLock lock=win.getLock(); lock.lock(); try { if(eager_lock_release) locks.put(Thread.currentThread(), lock); short removed_regular_msgs=0; while((msg_to_deliver=win.remove()) != null) { if(msg_to_deliver.isFlagSet(Message.OOB)) { continue; } removed_regular_msgs++; // Changed by bela Jan 29 2003: not needed (see above) //msg_to_deliver.removeHeader(getName()); up_prot.up(new Event(Event.MSG, msg_to_deliver)); } // We keep track of regular messages that we added, but couldn't remove (because of ordering). // When we have such messages pending, then even OOB threads will remove and process them if(regular_msg_added && removed_regular_msgs == 0) { undelivered_msgs.incrementAndGet(); } if(removed_regular_msgs > 0) { // regardless of whether a message was added or not ! int num_msgs_added=regular_msg_added? 1 : 0; undelivered_msgs.addAndGet(-(removed_regular_msgs -num_msgs_added)); } } finally { if(eager_lock_release) locks.remove(Thread.currentThread()); if(lock.isHeldByCurrentThread()) lock.unlock(); } } /** * Retransmits messsages first_seqno to last_seqno from original_sender from xmit_table to xmit_requester, * called when XMIT_REQ is received. * @param xmit_requester The sender of the XMIT_REQ, we have to send the requested copy of the message to this address * @param first_seqno The first sequence number to be retransmitted (<= last_seqno) * @param last_seqno The last sequence number to be retransmitted (>= first_seqno) * @param original_sender The member who originally sent the messsage. Guaranteed to be non-null */ private void handleXmitReq(Address xmit_requester, long first_seqno, long last_seqno, Address original_sender) { Message msg; if(log.isTraceEnabled()) { StringBuilder sb=new StringBuilder(); sb.append(local_addr).append(": received xmit request from ").append(xmit_requester).append(" for "); sb.append(original_sender).append(" [").append(first_seqno).append(" - ").append(last_seqno).append("]"); log.trace(sb.toString()); } if(first_seqno > last_seqno) { if(log.isErrorEnabled()) log.error("first_seqno (" + first_seqno + ") > last_seqno (" + last_seqno + "): not able to retransmit"); return; } if(stats) { xmit_reqs_received+=last_seqno - first_seqno +1; updateStats(received, xmit_requester, 1, 0, 0); } if(xmit_time_stats != null) { long key=(System.currentTimeMillis() - xmit_time_stats_start) / 1000; XmitTimeStat stat=xmit_time_stats.get(key); if(stat == null) { stat=new XmitTimeStat(); XmitTimeStat stat2=xmit_time_stats.putIfAbsent(key, stat); if(stat2 != null) stat=stat2; } stat.xmit_reqs_received.addAndGet((int)(last_seqno - first_seqno +1)); stat.xmit_rsps_sent.addAndGet((int)(last_seqno - first_seqno +1)); } NakReceiverWindow win=xmit_table.get(original_sender); if(win == null) { if(log.isErrorEnabled()) { StringBuilder sb=new StringBuilder(); sb.append("(requester=").append(xmit_requester).append(", local_addr=").append(this.local_addr); sb.append(") ").append(original_sender).append(" not found in retransmission table:\n").append(printMessages()); if(print_stability_history_on_failed_xmit) { sb.append(" (stability history:\n").append(printStabilityHistory()); } log.error(sb); } return; } for(long i=first_seqno; i <= last_seqno; i++) { msg=win.get(i); if(msg == null || msg == NakReceiverWindow.NULL_MSG) { if(log.isWarnEnabled() && !local_addr.equals(xmit_requester)) { StringBuilder sb=new StringBuilder(); sb.append("(requester=").append(xmit_requester).append(", local_addr=").append(this.local_addr); sb.append(") message ").append(original_sender).append("::").append(i); sb.append(" not found in retransmission table of ").append(original_sender).append(":\n").append(win); if(print_stability_history_on_failed_xmit) { sb.append(" (stability history:\n").append(printStabilityHistory()); } log.warn(sb); } continue; } sendXmitRsp(xmit_requester, msg, i); } } private void cancelRebroadcasting() { rebroadcast_lock.lock(); try { rebroadcasting=false; rebroadcast_done.signalAll(); } finally { rebroadcast_lock.unlock(); } } private static void updateStats(HashMap<Address,StatsEntry> map, Address key, int req, int rsp, int missing) { StatsEntry entry=map.get(key); if(entry == null) { entry=new StatsEntry(); map.put(key, entry); } entry.xmit_reqs+=req; entry.xmit_rsps+=rsp; entry.missing_msgs_rcvd+=missing; } /** * Sends a message msg to the requester. We have to wrap the original message into a retransmit message, as we need * to preserve the original message's properties, such as src, headers etc. * @param dest * @param msg * @param seqno */ private void sendXmitRsp(Address dest, Message msg, long seqno) { Buffer buf; if(msg == null) { if(log.isErrorEnabled()) log.error("message is null, cannot send retransmission"); return; } if(use_mcast_xmit) dest=null; if(stats) { xmit_rsps_sent++; updateStats(sent, dest, 0, 1, 0); } if(msg.getSrc() == null) msg.setSrc(local_addr); try { buf=Util.messageToByteBuffer(msg); Message xmit_msg=new Message(dest, null, buf.getBuf(), buf.getOffset(), buf.getLength()); // changed Bela Jan 4 2007: we should not use OOB for retransmitted messages, otherwise we tax the OOB thread pool // too much // msg.setFlag(Message.OOB); xmit_msg.putHeader(name, new NakAckHeader(NakAckHeader.XMIT_RSP, seqno)); down_prot.down(new Event(Event.MSG, xmit_msg)); } catch(IOException ex) { log.error("failed marshalling xmit list", ex); } } private void handleXmitRsp(Message msg) { if(msg == null) { if(log.isWarnEnabled()) log.warn("message is null"); return; } try { Message wrapped_msg=Util.byteBufferToMessage(msg.getRawBuffer(), msg.getOffset(), msg.getLength()); if(xmit_time_stats != null) { long key=(System.currentTimeMillis() - xmit_time_stats_start) / 1000; XmitTimeStat stat=xmit_time_stats.get(key); if(stat == null) { stat=new XmitTimeStat(); XmitTimeStat stat2=xmit_time_stats.putIfAbsent(key, stat); if(stat2 != null) stat=stat2; } stat.xmit_rsps_received.incrementAndGet(); } if(stats) { xmit_rsps_received++; updateStats(received, msg.getSrc(), 0, 1, 0); } up(new Event(Event.MSG, wrapped_msg)); if(rebroadcasting) { Digest tmp=getDigest(); boolean cancel_rebroadcasting; rebroadcast_digest_lock.lock(); try { cancel_rebroadcasting=tmp.isGreaterThanOrEqual(rebroadcast_digest); } finally { rebroadcast_digest_lock.unlock(); } if(cancel_rebroadcasting) { cancelRebroadcasting(); } } } catch(Exception ex) { if(log.isErrorEnabled()) { log.error("failed reading retransmitted message", ex); } } } /** * Takes the argument highest_seqnos and compares it to the current digest. If the current digest has fewer messages, * then send retransmit messages for the missing messages. Return when all missing messages have been received. If * we're waiting for a missing message from P, and P crashes while waiting, we need to exclude P from the wait set. */ private void rebroadcastMessages() { Digest my_digest; Map<Address,Digest.Entry> their_digest; Address sender; Digest.Entry their_entry, my_entry; long their_high, my_high; long sleep=max_rebroadcast_timeout / NUM_REBROADCAST_MSGS; long wait_time=max_rebroadcast_timeout, start=System.currentTimeMillis(); while(wait_time > 0) { rebroadcast_digest_lock.lock(); try { if(rebroadcast_digest == null) break; their_digest=rebroadcast_digest.getSenders(); } finally { rebroadcast_digest_lock.unlock(); } my_digest=getDigest(); boolean xmitted=false; for(Map.Entry<Address,Digest.Entry> entry: their_digest.entrySet()) { sender=entry.getKey(); their_entry=entry.getValue(); my_entry=my_digest.get(sender); if(my_entry == null) continue; their_high=their_entry.getHighest(); my_high=my_entry.getHighest(); if(their_high > my_high) { if(log.isTraceEnabled()) log.trace("sending XMIT request to " + sender + " for messages " + my_high + " - " + their_high); retransmit(my_high, their_high, sender, true); // use multicast to send retransmit request xmitted=true; } } if(!xmitted) return; // we're done; no retransmissions are needed anymore. our digest is >= rebroadcast_digest rebroadcast_lock.lock(); try { try { my_digest=getDigest(); rebroadcast_digest_lock.lock(); try { if(!rebroadcasting || my_digest.isGreaterThanOrEqual(rebroadcast_digest)) return; } finally { rebroadcast_digest_lock.unlock(); } rebroadcast_done.await(sleep, TimeUnit.MILLISECONDS); wait_time-=(System.currentTimeMillis() - start); } catch(InterruptedException e) { } } finally { rebroadcast_lock.unlock(); } } } /** * Remove old members from NakReceiverWindows and add new members (starting seqno=0). Essentially removes all * entries from xmit_table that are not in <code>members</code>. This method is not called concurrently * multiple times */ private void adjustReceivers(List<Address> new_members) { NakReceiverWindow win; // 1. Remove all senders in xmit_table that are not members anymore for(Iterator<Address> it=xmit_table.keySet().iterator(); it.hasNext();) { Address sender=it.next(); if(!new_members.contains(sender)) { if(local_addr != null && local_addr.equals(sender)) { if(log.isErrorEnabled()) log.error("will not remove myself (" + sender + ") from xmit_table, received incorrect new membership of " + new_members); continue; } win=xmit_table.get(sender); win.reset(); if(log.isDebugEnabled()) { log.debug("removing " + sender + " from xmit_table (not member anymore)"); } it.remove(); } } // 2. Add newly joined members to xmit_table (starting seqno=0) for(Address sender: new_members) { if(!xmit_table.containsKey(sender)) { win=createNakReceiverWindow(sender, INITIAL_SEQNO, 0); xmit_table.put(sender, win); } } } /** * Returns a message digest: for each member P the lowest, highest delivered and highest received seqno is added */ private Digest getDigest() { Digest.Entry entry; Map<Address,Digest.Entry> map=new HashMap<Address,Digest.Entry>(members.size()); for(Address sender: members) { entry=getEntry(sender); if(entry == null) { if(log.isErrorEnabled()) { log.error("range is null"); } continue; } map.put(sender, entry); } return new Digest(map); } /** * Creates a NakReceiverWindow for each sender in the digest according to the sender's seqno. If NRW already exists, * reset it. */ private void setDigest(Digest digest) { if(digest == null) { if(log.isErrorEnabled()) { log.error("digest or digest.senders is null"); } return; } if(local_addr != null && digest.contains(local_addr)) { clear(); } else { // remove all but local_addr (if not null) for(Iterator<Address> it=xmit_table.keySet().iterator(); it.hasNext();) { Address key=it.next(); if(local_addr != null && local_addr.equals(key)) { ; } else { it.remove(); } } } Address sender; Digest.Entry val; long initial_seqno; NakReceiverWindow win; for(Map.Entry<Address, Digest.Entry> entry: digest.getSenders().entrySet()) { sender=entry.getKey(); val=entry.getValue(); if(sender == null || val == null) { if(log.isWarnEnabled()) { log.warn("sender or value is null"); } continue; } initial_seqno=val.getHighestDeliveredSeqno(); win=createNakReceiverWindow(sender, initial_seqno, val.getLow()); xmit_table.put(sender, win); } if(!xmit_table.containsKey(local_addr)) { if(log.isWarnEnabled()) { log.warn("digest does not contain local address (local_addr=" + local_addr + ", digest=" + digest); } } } private void mergeDigest(Digest digest) { if(digest == null) { if(log.isErrorEnabled()) { log.error("digest or digest.senders is null"); } return; } StringBuilder sb=null; if(log.isDebugEnabled()) { sb=new StringBuilder(); sb.append("existing digest: " + getDigest()).append("\nnew digest: " + digest); } Address sender; Digest.Entry val; NakReceiverWindow win; long highest_delivered_seqno, low_seqno; for(Map.Entry<Address, Digest.Entry> entry: digest.getSenders().entrySet()) { sender=entry.getKey(); val=entry.getValue(); if(sender == null || val == null) { if(log.isWarnEnabled()) { log.warn("sender or value is null"); } continue; } highest_delivered_seqno=val.getHighestDeliveredSeqno(); low_seqno=val.getLow(); // except for myself win=xmit_table.get(sender); if(win != null) { if(local_addr != null && local_addr.equals(sender)) { continue; } else { win.reset(); // stops retransmission xmit_table.remove(sender); } } win=createNakReceiverWindow(sender, highest_delivered_seqno, low_seqno); xmit_table.put(sender, win); } if(log.isDebugEnabled() && sb != null) { sb.append("\n").append("resulting digest: " + getDigest()); log.debug(sb); } if(!xmit_table.containsKey(local_addr)) { if(log.isWarnEnabled()) { log.warn("digest does not contain local address (local_addr=" + local_addr + ", digest=" + digest); } } } private NakReceiverWindow createNakReceiverWindow(Address sender, long initial_seqno, long lowest_seqno) { NakReceiverWindow win=new NakReceiverWindow(local_addr, sender, this, initial_seqno, lowest_seqno, timer); if(use_stats_for_retransmission) { win.setRetransmitTimeouts(new ActualInterval(sender)); } else if(exponential_backoff > 0) { win.setRetransmitTimeouts(new ExponentialInterval(exponential_backoff)); } else { win.setRetransmitTimeouts(new StaticInterval(retransmit_timeouts)); } win.setDiscardDeliveredMessages(discard_delivered_msgs); win.setMaxXmitBufSize(this.max_xmit_buf_size); if(stats) win.setListener(this); return win; } private void dumpXmitStats(String filename) throws IOException { Writer out=new FileWriter(filename); try { TreeMap<Long,XmitTimeStat> map=new TreeMap<Long,XmitTimeStat>(xmit_time_stats); StringBuilder sb; XmitTimeStat stat; out.write("time (secs) gaps-detected xmit-reqs-sent xmit-reqs-received xmit-rsps-sent xmit-rsps-received missing-msgs-received\n\n"); for(Map.Entry<Long,XmitTimeStat> entry: map.entrySet()) { sb=new StringBuilder(); stat=entry.getValue(); sb.append(entry.getKey()).append(" "); sb.append(stat.gaps_detected).append(" "); sb.append(stat.xmit_reqs_sent).append(" "); sb.append(stat.xmit_reqs_received).append(" "); sb.append(stat.xmit_rsps_sent).append(" "); sb.append(stat.xmit_rsps_received).append(" "); sb.append(stat.missing_msgs_received).append("\n"); out.write(sb.toString()); } } finally { out.close(); } } private Digest.Entry getEntry(Address sender) { if(sender == null) { if(log.isErrorEnabled()) { log.error("sender is null"); } return null; } NakReceiverWindow win=xmit_table.get(sender); if(win == null) { if(log.isErrorEnabled()) { log.error("sender " + sender + " not found in xmit_table"); } return null; } long low=win.getLowestSeen(), highest_delivered=win.getHighestDelivered(), highest_received=win.getHighestReceived(); return new Digest.Entry(low, highest_delivered, highest_received); } /** * Garbage collect messages that have been seen by all members. Update sent_msgs: for the sender P in the digest * which is equal to the local address, garbage collect all messages <= seqno at digest[P]. Update xmit_table: * for each sender P in the digest and its highest seqno seen SEQ, garbage collect all delivered_msgs in the * NakReceiverWindow corresponding to P which are <= seqno at digest[P]. */ private void stable(Digest digest) { NakReceiverWindow recv_win; long my_highest_rcvd; // highest seqno received in my digest for a sender P long stability_highest_rcvd; // highest seqno received in the stability vector for a sender P if(members == null || local_addr == null || digest == null) { if(log.isWarnEnabled()) log.warn("members, local_addr or digest are null !"); return; } if(log.isTraceEnabled()) { log.trace("received stable digest " + digest); } stability_msgs.add(digest); Address sender; Digest.Entry val; long high_seqno_delivered, high_seqno_received; for(Map.Entry<Address, Digest.Entry> entry: digest.getSenders().entrySet()) { sender=entry.getKey(); if(sender == null) continue; val=entry.getValue(); high_seqno_delivered=val.getHighestDeliveredSeqno(); high_seqno_received=val.getHighestReceivedSeqno(); // check whether the last seqno received for a sender P in the stability vector is > last seqno // received for P in my digest. if yes, request retransmission (see "Last Message Dropped" topic // in DESIGN) recv_win=xmit_table.get(sender); if(recv_win != null) { my_highest_rcvd=recv_win.getHighestReceived(); stability_highest_rcvd=high_seqno_received; if(stability_highest_rcvd >= 0 && stability_highest_rcvd > my_highest_rcvd) { if(log.isTraceEnabled()) { log.trace("my_highest_rcvd (" + my_highest_rcvd + ") < stability_highest_rcvd (" + stability_highest_rcvd + "): requesting retransmission of " + sender + '#' + stability_highest_rcvd); } retransmit(stability_highest_rcvd, stability_highest_rcvd, sender); } } high_seqno_delivered-=gc_lag; if(high_seqno_delivered < 0) { continue; } if(log.isTraceEnabled()) log.trace("deleting msgs <= " + high_seqno_delivered + " from " + sender); // delete *delivered* msgs that are stable if(recv_win != null) { recv_win.stable(high_seqno_delivered); // delete all messages with seqnos <= seqno } } } /** * Implementation of Retransmitter.RetransmitCommand. Called by retransmission thread when gap is detected. */ public void retransmit(long first_seqno, long last_seqno, Address sender) { retransmit(first_seqno, last_seqno, sender, false); } protected void retransmit(long first_seqno, long last_seqno, Address sender, boolean multicast_xmit_request) { NakAckHeader hdr; Message retransmit_msg; Address dest=sender; // to whom do we send the XMIT request ? if(multicast_xmit_request || this.use_mcast_xmit_req) { dest=null; } else { if(xmit_from_random_member && !local_addr.equals(sender)) { Address random_member=(Address)Util.pickRandomElement(members); if(random_member != null && !local_addr.equals(random_member)) { dest=random_member; if(log.isTraceEnabled()) log.trace("picked random member " + dest + " to send XMIT request to"); } } } hdr=new NakAckHeader(NakAckHeader.XMIT_REQ, first_seqno, last_seqno, sender); retransmit_msg=new Message(dest, null, null); retransmit_msg.setFlag(Message.OOB); if(log.isTraceEnabled()) log.trace(local_addr + ": sending XMIT_REQ ([" + first_seqno + ", " + last_seqno + "]) to " + dest); retransmit_msg.putHeader(name, hdr); ConcurrentMap<Long,Long> tmp=xmit_stats.get(sender); if(tmp == null) { tmp=new ConcurrentHashMap<Long,Long>(); ConcurrentMap<Long,Long> tmp2=xmit_stats.putIfAbsent(sender, tmp); if(tmp2 != null) tmp=tmp2; } for(long seq=first_seqno; seq < last_seqno; seq++) { tmp.putIfAbsent(seq, System.currentTimeMillis()); } if(xmit_time_stats != null) { long key=(System.currentTimeMillis() - xmit_time_stats_start) / 1000; XmitTimeStat stat=xmit_time_stats.get(key); if(stat == null) { stat=new XmitTimeStat(); XmitTimeStat stat2=xmit_time_stats.putIfAbsent(key, stat); if(stat2 != null) stat=stat2; } stat.xmit_reqs_sent.addAndGet((int)(last_seqno - first_seqno +1)); } down_prot.down(new Event(Event.MSG, retransmit_msg)); if(stats) { xmit_reqs_sent+=last_seqno - first_seqno +1; updateStats(sent, dest, 1, 0, 0); XmitRequest req=new XmitRequest(sender, first_seqno, last_seqno, dest); send_history.add(req); } } public void missingMessageReceived(long seqno, Address original_sender) { ConcurrentMap<Long,Long> tmp=xmit_stats.get(original_sender); if(tmp != null) { Long timestamp=tmp.remove(seqno); if(timestamp != null) { long diff=System.currentTimeMillis() - timestamp; BoundedList<Long> list=xmit_times_history.get(original_sender); if(list == null) { list=new BoundedList<Long>(xmit_history_max_size); BoundedList<Long> list2=xmit_times_history.putIfAbsent(original_sender, list); if(list2 != null) list=list2; } list.add(diff); // compute the smoothed average for retransmission times for original_sender synchronized(smoothed_avg_xmit_times) { Double smoothed_avg=smoothed_avg_xmit_times.get(original_sender); if(smoothed_avg == null) smoothed_avg=INITIAL_SMOOTHED_AVG; // the smoothed avg takes 90% of the previous value, 100% of the new value and averages them // then, we add 10% to be on the safe side (an xmit value should rather err on the higher than lower side) smoothed_avg=((smoothed_avg * WEIGHT) + diff) / 2; smoothed_avg=smoothed_avg * (2 - WEIGHT); smoothed_avg_xmit_times.put(original_sender, smoothed_avg); } } } if(xmit_time_stats != null) { long key=(System.currentTimeMillis() - xmit_time_stats_start) / 1000; XmitTimeStat stat=xmit_time_stats.get(key); if(stat == null) { stat=new XmitTimeStat(); XmitTimeStat stat2=xmit_time_stats.putIfAbsent(key, stat); if(stat2 != null) stat=stat2; } stat.missing_msgs_received.incrementAndGet(); } if(stats) { missing_msgs_received++; updateStats(received, original_sender, 0, 0, 1); MissingMessage missing=new MissingMessage(original_sender, seqno); receive_history.add(missing); } } /** Called when a message gap is detected */ public void messageGapDetected(long from, long to, Address src) { if(xmit_time_stats != null) { long key=(System.currentTimeMillis() - xmit_time_stats_start) / 1000; XmitTimeStat stat=xmit_time_stats.get(key); if(stat == null) { stat=new XmitTimeStat(); XmitTimeStat stat2=xmit_time_stats.putIfAbsent(key, stat); if(stat2 != null) stat=stat2; } stat.gaps_detected.addAndGet((int)(to - from +1)); } } private void clear() { // changed April 21 2004 (bela): SourceForge bug# 938584. We cannot delete our own messages sent between // a join() and a getState(). Otherwise retransmission requests from members who missed those msgs might // fail. Not to worry though: those msgs will be cleared by STABLE (message garbage collection) // sent_msgs.clear(); for(NakReceiverWindow win: xmit_table.values()) { win.reset(); } xmit_table.clear(); undelivered_msgs.set(0); } private void reset() { seqno_lock.lock(); try { seqno=0; } finally { seqno_lock.unlock(); } for(NakReceiverWindow win: xmit_table.values()) { win.destroy(); } xmit_table.clear(); undelivered_msgs.set(0); } @ManagedOperation(description="TODO") public String printMessages() { StringBuilder ret=new StringBuilder(); Map.Entry<Address,NakReceiverWindow> entry; Address addr; Object w; for(Iterator<Map.Entry<Address,NakReceiverWindow>> it=xmit_table.entrySet().iterator(); it.hasNext();) { entry=it.next(); addr=entry.getKey(); w=entry.getValue(); ret.append(addr).append(": ").append(w.toString()).append('\n'); } return ret.toString(); } @ManagedOperation(description="TODO") public String printRetransmissionAvgs() { StringBuilder sb=new StringBuilder(); for(Map.Entry<Address,BoundedList<Long>> entry: xmit_times_history.entrySet()) { Address sender=entry.getKey(); BoundedList<Long> list=entry.getValue(); long tmp=0; int i=0; for(Long val: list) { tmp+=val; i++; } double avg=i > 0? tmp / i: -1; sb.append(sender).append(": ").append(avg).append("\n"); } return sb.toString(); } @ManagedOperation(description="TODO") public String printSmoothedRetransmissionAvgs() { StringBuilder sb=new StringBuilder(); for(Map.Entry<Address,Double> entry: smoothed_avg_xmit_times.entrySet()) { sb.append(entry.getKey()).append(": ").append(entry.getValue()).append("\n"); } return sb.toString(); } @ManagedOperation(description="TODO") public String printRetransmissionTimes() { StringBuilder sb=new StringBuilder(); for(Map.Entry<Address,BoundedList<Long>> entry: xmit_times_history.entrySet()) { Address sender=entry.getKey(); BoundedList<Long> list=entry.getValue(); sb.append(sender).append(": ").append(list).append("\n"); } return sb.toString(); } @ManagedAttribute public double getTotalAverageRetransmissionTime() { long total=0; int i=0; for(BoundedList<Long> list: xmit_times_history.values()) { for(Long val: list) { total+=val; i++; } } return i > 0? total / i: -1; } @ManagedAttribute public double getTotalAverageSmoothedRetransmissionTime() { double total=0.0; int cnt=0; synchronized(smoothed_avg_xmit_times) { for(Double val: smoothed_avg_xmit_times.values()) { if(val != null) { total+=val; cnt++; } } } return cnt > 0? total / cnt : -1; } /** Returns the smoothed average retransmission time for a given sender */ public double getSmoothedAverageRetransmissionTime(Address sender) { synchronized(smoothed_avg_xmit_times) { Double retval=smoothed_avg_xmit_times.get(sender); if(retval == null) { retval=INITIAL_SMOOTHED_AVG; smoothed_avg_xmit_times.put(sender, retval); } return retval; } } // public static final class LossRate { // private final Set<Long> received=new HashSet<Long>(); // private final Set<Long> missing=new HashSet<Long>(); // private double smoothed_loss_rate=0.0; // public synchronized void addReceived(long seqno) { // received.add(seqno); // missing.remove(seqno); // setSmoothedLossRate(); // public synchronized void addReceived(Long ... seqnos) { // for(int i=0; i < seqnos.length; i++) { // Long seqno=seqnos[i]; // received.add(seqno); // missing.remove(seqno); // setSmoothedLossRate(); // public synchronized void addMissing(long from, long to) { // for(long i=from; i <= to; i++) { // if(!received.contains(i)) // missing.add(i); // setSmoothedLossRate(); // public synchronized double computeLossRate() { // int num_missing=missing.size(); // if(num_missing == 0) // return 0.0; // int num_received=received.size(); // int total=num_missing + num_received; // return num_missing / (double)total; // public synchronized double getSmoothedLossRate() { // return smoothed_loss_rate; // public synchronized String toString() { // StringBuilder sb=new StringBuilder(); // int num_missing=missing.size(); // int num_received=received.size(); // int total=num_missing + num_received; // sb.append("total=").append(total).append(" (received=").append(received.size()).append(", missing=") // .append(missing.size()).append(", loss rate=").append(computeLossRate()) // .append(", smoothed loss rate=").append(smoothed_loss_rate).append(")"); // return sb.toString(); // /** Set the new smoothed_loss_rate value to 70% of the new value and 30% of the old value */ // private void setSmoothedLossRate() { // double new_loss_rate=computeLossRate(); // if(smoothed_loss_rate == 0) { // smoothed_loss_rate=new_loss_rate; // else { // smoothed_loss_rate=smoothed_loss_rate * .3 + new_loss_rate * .7; private static class XmitTimeStat { final AtomicInteger gaps_detected=new AtomicInteger(0); final AtomicInteger xmit_reqs_sent=new AtomicInteger(0); final AtomicInteger xmit_reqs_received=new AtomicInteger(0); final AtomicInteger xmit_rsps_sent=new AtomicInteger(0); final AtomicInteger xmit_rsps_received=new AtomicInteger(0); final AtomicInteger missing_msgs_received=new AtomicInteger(0); } private class ActualInterval implements Interval { private final Address sender; public ActualInterval(Address sender) { this.sender=sender; } public long next() { return (long)getSmoothedAverageRetransmissionTime(sender); } public Interval copy() { return this; } } static class StatsEntry { long xmit_reqs, xmit_rsps, missing_msgs_rcvd; public String toString() { StringBuilder sb=new StringBuilder(); sb.append(xmit_reqs).append(" xmit_reqs").append(", ").append(xmit_rsps).append(" xmit_rsps"); sb.append(", ").append(missing_msgs_rcvd).append(" missing msgs"); return sb.toString(); } } static class XmitRequest { Address original_sender; // original sender of message long low, high, timestamp=System.currentTimeMillis(); Address xmit_dest; // destination to which XMIT_REQ is sent, usually the original sender XmitRequest(Address original_sender, long low, long high, Address xmit_dest) { this.original_sender=original_sender; this.xmit_dest=xmit_dest; this.low=low; this.high=high; } public String toString() { StringBuilder sb=new StringBuilder(); sb.append(new Date(timestamp)).append(": ").append(original_sender).append(" #[").append(low); sb.append("-").append(high).append("]"); sb.append(" (XMIT_REQ sent to ").append(xmit_dest).append(")"); return sb.toString(); } } static class MissingMessage { Address original_sender; long seq, timestamp=System.currentTimeMillis(); MissingMessage(Address original_sender, long seqno) { this.original_sender=original_sender; this.seq=seqno; } public String toString() { StringBuilder sb=new StringBuilder(); sb.append(new Date(timestamp)).append(": ").append(original_sender).append(" #").append(seq); return sb.toString(); } } }
package org.jgroups.protocols.pbcast; import org.jgroups.*; import org.jgroups.annotations.*; import org.jgroups.conf.PropertyConverters; import org.jgroups.stack.*; import org.jgroups.util.*; import java.io.FileWriter; import java.io.IOException; import java.io.Writer; import java.util.*; import java.util.concurrent.ConcurrentHashMap; import java.util.concurrent.ConcurrentMap; import java.util.concurrent.CopyOnWriteArrayList; import java.util.concurrent.TimeUnit; import java.util.concurrent.atomic.AtomicInteger; import java.util.concurrent.atomic.AtomicBoolean; import java.util.concurrent.locks.Condition; import java.util.concurrent.locks.Lock; import java.util.concurrent.locks.ReentrantLock; /** * Negative AcKnowledgement layer (NAKs). Messages are assigned a monotonically * increasing sequence number (seqno). Receivers deliver messages ordered * according to seqno and request retransmission of missing messages.<br/> * Retransmit requests are usually sent to the original sender of a message, but * this can be changed by xmit_from_random_member (send to random member) or * use_mcast_xmit_req (send to everyone). Responses can also be sent to everyone * instead of the requester by setting use_mcast_xmit to true. * * @author Bela Ban * @version $Id: NAKACK.java,v 1.205 2008/10/08 15:05:29 belaban Exp $ */ @MBean(description="Reliable transmission multipoint FIFO protocol") @DeprecatedProperty(names={"max_xmit_size"}) public class NAKACK extends Protocol implements Retransmitter.RetransmitCommand, NakReceiverWindow.Listener { private static final long INITIAL_SEQNO=0; private static final String name="NAKACK"; /** * the weight with which we take the previous smoothed average into account, * WEIGHT should be >0 and <= 1 */ private static final double WEIGHT=0.9; private static final double INITIAL_SMOOTHED_AVG=30.0; private static final int NUM_REBROADCAST_MSGS=3; @Property(name="retransmit_timeout", converter=PropertyConverters.LongArray.class, description="Timeout before requesting retransmissions") private long[] retransmit_timeouts= { 600, 1200, 2400, 4800 }; // time(s) to wait before requesting retransmission @Property(description="If true, retransmissions stats will be captured. Default is false") boolean enable_xmit_time_stats=false; @ManagedAttribute(description="Garbage collection lag", writable=true) @Property private int gc_lag=20; // number of msgs garbage collection lags behind /** * Retransmit messages using multicast rather than unicast. This has the * advantage that, if many receivers lost a message, the sender only * retransmits once. */ @Property(description="Retransmit messages using multicast rather than unicast. Default is true") @ManagedAttribute(description="Retransmit messages using multicast rather than unicast", writable=true) private boolean use_mcast_xmit=true; /** * Use a multicast to request retransmission of missing messages. This may * be costly as every member in the cluster will send a response */ @Property(description="Use a multicast to request retransmission of missing messages. Default is false") private boolean use_mcast_xmit_req=false; /** * Ask a random member for retransmission of a missing message. If set to * true, discard_delivered_msgs will be set to false */ @Property(description="Ask a random member for retransmission of a missing message. Default is false") @ManagedAttribute(description="Ask a random member for retransmission of a missing message", writable=true) private boolean xmit_from_random_member=false; /** * The first value (in milliseconds) to use in the exponential backoff * retransmission mechanism. Only enabled if the value is > 0 */ @Property(description="The first value (in milliseconds) to use in the exponential backoff. Enabled if freater than 0. Default is 0") private long exponential_backoff=0; /** * If enabled, we use statistics gathered from actual retransmission times * to compute the new retransmission times */ @Property(description="Use statistics gathered from actual retransmission times to compute new retransmission times. Default is false") private boolean use_stats_for_retransmission=false; /** * Messages that have been received in order are sent up the stack (= * delivered to the application). Delivered messages are removed from * NakReceiverWindow.xmit_table and moved to * NakReceiverWindow.delivered_msgs, where they are later garbage collected * (by STABLE). Since we do retransmits only from sent messages, never * received or delivered messages, we can turn the moving to delivered_msgs * off, so we don't keep the message around, and don't need to wait for * garbage collection to remove them. */ @Property(description="Should messages delivere to application be discarded. Default is false") @ManagedAttribute(description="Discard delivered messages", writable=true) private boolean discard_delivered_msgs=false; @Property(description="See http://jira.jboss.com/jira/browse/JGRP-656. Default is true") private boolean eager_lock_release=true; /** * If value is > 0, the retransmit buffer is bounded: only the * max_xmit_buf_size latest messages are kept, older ones are discarded when * the buffer size is exceeded. A value <= 0 means unbounded buffers */ @Property(description="If value is > 0, the retransmit buffer is bounded. If value <= 0 unbounded buffers are used. Default is 0") @ManagedAttribute(description="If value is > 0, the retransmit buffer is bounded. If value <= 0 unbounded buffers are used", writable=true) private int max_xmit_buf_size=0; @Property(description="Size of retransmission history. Default is 50 entries") private int xmit_history_max_size=50; @Property private long max_rebroadcast_timeout=2000; /** * When not finding a message on an XMIT request, include the last N * stability messages in the error message */ @Property(description="Should stability history be printed if we fail in retransmission. Default is false") protected boolean print_stability_history_on_failed_xmit=false; @Property(description="Size of send and receive history. Default is 20 entries") private int stats_list_size=20; @ManagedAttribute(description="Number of retransmit requests received") private long xmit_reqs_received; @ManagedAttribute(description="Number of retransmit requests sent") private long xmit_reqs_sent; @ManagedAttribute(description="Number of retransmit responses received") private long xmit_rsps_received; @ManagedAttribute(description="Number of retransmit responses sent") private long xmit_rsps_sent; @ManagedAttribute(description="Number of missing messages received") private long missing_msgs_received; /** * Maintains retransmission related data across a time. Only used if enable_xmit_time_stats is set to true. * At program termination, accumulated data is dumped to a file named by the address of the member. * Careful, don't enable this in production as the data in this hashmap are * never reaped ! Really only meant for diagnostics ! */ private ConcurrentMap<Long,XmitTimeStat> xmit_time_stats=null; private long xmit_time_stats_start; /** * BoundedList<MissingMessage>. Keeps track of the last stats_list_size * XMIT requests */ private BoundedList<MissingMessage> receive_history; /** * BoundedList<XmitRequest>. Keeps track of the last stats_list_size * missing messages received */ private BoundedList<XmitRequest> send_history; /** Captures stats on XMIT_REQS, XMIT_RSPS per sender */ private ConcurrentMap<Address,StatsEntry> sent=new ConcurrentHashMap<Address,StatsEntry>(); /** Captures stats on XMIT_REQS, XMIT_RSPS per receiver */ private ConcurrentMap<Address,StatsEntry> received=new ConcurrentHashMap<Address,StatsEntry>(); /** * Per-sender map of seqnos and timestamps, to keep track of avg times for retransmission of messages */ private final ConcurrentMap<Address,ConcurrentMap<Long,Long>> xmit_stats=new ConcurrentHashMap<Address,ConcurrentMap<Long,Long>>(); /** * Maintains a list of the last N retransmission times (duration it took to * retransmit a message) for all members */ private final ConcurrentMap<Address,BoundedList<Long>> xmit_times_history=new ConcurrentHashMap<Address,BoundedList<Long>>(); /** * Maintains a smoothed average of the retransmission times per sender, * these are the actual values that are used for new retransmission requests */ private final Map<Address,Double> smoothed_avg_xmit_times=new HashMap<Address,Double>(); private Map<Thread,ReentrantLock> locks; private boolean is_server=false; private Address local_addr=null; private final List<Address> members=new CopyOnWriteArrayList<Address>(); private View view; @GuardedBy("seqno_lock") private long seqno=0; // current message sequence number (starts with 1) private final Lock seqno_lock=new ReentrantLock(); /** Map to store sent and received messages (keyed by sender) */ private final ConcurrentMap<Address,NakReceiverWindow> xmit_table=new ConcurrentHashMap<Address,NakReceiverWindow>(11); private volatile boolean leaving=false; private volatile boolean started=false; private TimeScheduler timer=null; /** * Keeps track of OOB messages sent by myself, needed by * {@link #handleMessage(org.jgroups.Message, NakAckHeader)} */ private final Set<Long> oob_loopback_msgs=Collections.synchronizedSet(new HashSet<Long>()); private final Lock rebroadcast_lock=new ReentrantLock(); private final Condition rebroadcast_done=rebroadcast_lock.newCondition(); // set during processing of a rebroadcast event private volatile boolean rebroadcasting=false; private final Lock rebroadcast_digest_lock=new ReentrantLock(); @GuardedBy("rebroadcast_digest_lock") private Digest rebroadcast_digest=null; /** BoundedList<Digest>, keeps the last 10 stability messages */ private final BoundedList<Digest> stability_msgs=new BoundedList<Digest>(10); /** If true, logs messages discarded because received from other members */ @ManagedAttribute(description="If true, logs messages discarded because received from other members", writable=true) private boolean log_discard_msgs=true; /** <em>Regular</em> messages which have been added, but not removed */ private final AtomicInteger undelivered_msgs=new AtomicInteger(0); public NAKACK() { } public String getName() { return name; } @ManagedAttribute public int getUndeliveredMessages() { return undelivered_msgs.get(); } public long getXmitRequestsReceived() {return xmit_reqs_received;} public long getXmitRequestsSent() {return xmit_reqs_sent;} public long getXmitResponsesReceived() {return xmit_rsps_received;} public long getXmitResponsesSent() {return xmit_rsps_sent;} public long getMissingMessagesReceived() {return missing_msgs_received;} @ManagedAttribute public int getPendingRetransmissionRequests() { int num=0; for(NakReceiverWindow win: xmit_table.values()) { num+=win.getPendingXmits(); } return num; } @ManagedAttribute public int getXmitTableSize() { int num=0; for(NakReceiverWindow win: xmit_table.values()) { num+=win.size(); } return num; } public int getReceivedTableSize() { return getPendingRetransmissionRequests(); } public void resetStats() { xmit_reqs_received=xmit_reqs_sent=xmit_rsps_received=xmit_rsps_sent=missing_msgs_received=0; sent.clear(); received.clear(); if(receive_history !=null) receive_history.clear(); if(send_history != null) send_history.clear(); } public void init() throws Exception { if(enable_xmit_time_stats) { if(log.isWarnEnabled()) log.warn("enable_xmit_time_stats is experimental, and may be removed in any release"); xmit_time_stats=new ConcurrentHashMap<Long,XmitTimeStat>(); xmit_time_stats_start=System.currentTimeMillis(); } if(xmit_from_random_member) { if(discard_delivered_msgs) { discard_delivered_msgs=false; log.warn("xmit_from_random_member set to true: changed discard_delivered_msgs to false"); } } if(stats) { send_history=new BoundedList<XmitRequest>(stats_list_size); receive_history=new BoundedList<MissingMessage>(stats_list_size); } } public int getGcLag() { return gc_lag; } public void setGcLag(int gc_lag) { this.gc_lag=gc_lag; } public boolean isUseMcastXmit() { return use_mcast_xmit; } public void setUseMcastXmit(boolean use_mcast_xmit) { this.use_mcast_xmit=use_mcast_xmit; } public boolean isXmitFromRandomMember() { return xmit_from_random_member; } public void setXmitFromRandomMember(boolean xmit_from_random_member) { this.xmit_from_random_member=xmit_from_random_member; } public boolean isDiscardDeliveredMsgs() { return discard_delivered_msgs; } public void setDiscardDeliveredMsgs(boolean discard_delivered_msgs) { boolean old=this.discard_delivered_msgs; this.discard_delivered_msgs=discard_delivered_msgs; if(old != this.discard_delivered_msgs) { for(NakReceiverWindow win: xmit_table.values()) { win.setDiscardDeliveredMessages(this.discard_delivered_msgs); } } } public int getMaxXmitBufSize() { return max_xmit_buf_size; } public void setMaxXmitBufSize(int max_xmit_buf_size) { this.max_xmit_buf_size=max_xmit_buf_size; } /** * * @return * @deprecated removed in 2.6 */ public long getMaxXmitSize() { return -1; } /** * * @param max_xmit_size * @deprecated removed in 2.6 */ public void setMaxXmitSize(long max_xmit_size) { } public void setLogDiscardMessages(boolean flag) { log_discard_msgs=flag; } public boolean getLogDiscardMessages() { return log_discard_msgs; } public Map<String,Object> dumpStats() { Map<String,Object> retval=super.dumpStats(); if(retval == null) retval=new HashMap<String,Object>(); retval.put("xmit_reqs_received", new Long(xmit_reqs_received)); retval.put("xmit_reqs_sent", new Long(xmit_reqs_sent)); retval.put("xmit_rsps_received", new Long(xmit_rsps_received)); retval.put("xmit_rsps_sent", new Long(xmit_rsps_sent)); retval.put("missing_msgs_received", new Long(missing_msgs_received)); retval.put("msgs", printMessages()); return retval; } public String printStats() { Map.Entry entry; Object key, val; StringBuilder sb=new StringBuilder(); sb.append("sent:\n"); for(Iterator it=sent.entrySet().iterator(); it.hasNext();) { entry=(Map.Entry)it.next(); key=entry.getKey(); if(key == null || key == Global.NULL) key="<mcast dest>"; val=entry.getValue(); sb.append(key).append(": ").append(val).append("\n"); } sb.append("\nreceived:\n"); for(Iterator it=received.entrySet().iterator(); it.hasNext();) { entry=(Map.Entry)it.next(); key=entry.getKey(); if(key == null || key == Global.NULL) key="<mcast dest>"; val=entry.getValue(); sb.append(key).append(": ").append(val).append("\n"); } sb.append("\nXMIT_REQS sent:\n"); for(XmitRequest tmp: send_history) { sb.append(tmp).append("\n"); } sb.append("\nMissing messages received\n"); for(MissingMessage missing: receive_history) { sb.append(missing).append("\n"); } sb.append("\nStability messages received\n"); sb.append(printStabilityMessages()).append("\n"); return sb.toString(); } @ManagedOperation(description="TODO") public String printStabilityMessages() { StringBuilder sb=new StringBuilder(); sb.append(Util.printListWithDelimiter(stability_msgs, "\n")); return sb.toString(); } public String printStabilityHistory() { StringBuilder sb=new StringBuilder(); int i=1; for(Digest digest: stability_msgs) { sb.append(i++).append(": ").append(digest).append("\n"); } return sb.toString(); } @ManagedOperation(description="TODO") public String printLossRates() { StringBuilder sb=new StringBuilder(); NakReceiverWindow win; for(Map.Entry<Address,NakReceiverWindow> entry: xmit_table.entrySet()) { win=entry.getValue(); sb.append(entry.getKey()).append(": ").append(win.printLossRate()).append("\n"); } return sb.toString(); } @ManagedAttribute public double getAverageLossRate() { double retval=0.0; int count=0; if(xmit_table.isEmpty()) return 0.0; for(NakReceiverWindow win: xmit_table.values()) { retval+=win.getLossRate(); count++; } return retval / (double)count; } @ManagedAttribute public double getAverageSmoothedLossRate() { double retval=0.0; int count=0; if(xmit_table.isEmpty()) return 0.0; for(NakReceiverWindow win: xmit_table.values()) { retval+=win.getSmoothedLossRate(); count++; } return retval / (double)count; } public Vector<Integer> providedUpServices() { Vector<Integer> retval=new Vector<Integer>(5); retval.addElement(new Integer(Event.GET_DIGEST)); retval.addElement(new Integer(Event.SET_DIGEST)); retval.addElement(new Integer(Event.MERGE_DIGEST)); return retval; } public void start() throws Exception { timer=getTransport().getTimer(); if(timer == null) throw new Exception("timer is null"); locks=stack.getLocks(); started=true; leaving=false; if(xmit_time_stats != null) { Runtime.getRuntime().addShutdownHook(new Thread() { public void run() { String filename="xmit-stats-" + local_addr + ".log"; System.out.println("-- dumping runtime xmit stats to " + filename); try { dumpXmitStats(filename); } catch(IOException e) { e.printStackTrace(); } } }); } } public void stop() { started=false; reset(); // clears sent_msgs and destroys all NakReceiverWindows oob_loopback_msgs.clear(); } /** * <b>Callback</b>. Called by superclass when event may be handled.<p> <b>Do not use <code>down_prot.down()</code> in this * method as the event is passed down by default by the superclass after this method returns !</b> */ public Object down(Event evt) { switch(evt.getType()) { case Event.MSG: Message msg=(Message)evt.getArg(); Address dest=msg.getDest(); if(dest != null && !dest.isMulticastAddress()) { break; // unicast address: not null and not mcast, pass down unchanged } send(evt, msg); return null; // don't pass down the stack case Event.STABLE: // generated by STABLE layer. Delete stable messages passed in arg stable((Digest)evt.getArg()); return null; // do not pass down further (Bela Aug 7 2001) case Event.GET_DIGEST: return getDigest(); case Event.SET_DIGEST: setDigest((Digest)evt.getArg()); return null; case Event.MERGE_DIGEST: mergeDigest((Digest)evt.getArg()); return null; case Event.TMP_VIEW: View tmp_view=(View)evt.getArg(); Vector<Address> mbrs=tmp_view.getMembers(); members.clear(); members.addAll(mbrs); // adjustReceivers(false); break; case Event.VIEW_CHANGE: tmp_view=(View)evt.getArg(); mbrs=tmp_view.getMembers(); members.clear(); members.addAll(mbrs); view=tmp_view; adjustReceivers(members); is_server=true; // check vids from now on Set<Address> tmp=new LinkedHashSet<Address>(members); tmp.add(null); // for null destination (= mcast) sent.keySet().retainAll(tmp); received.keySet().retainAll(tmp); xmit_stats.keySet().retainAll(tmp); // in_progress.keySet().retainAll(mbrs); // remove elements which are not in the membership break; case Event.BECOME_SERVER: is_server=true; break; case Event.DISCONNECT: leaving=true; reset(); break; case Event.REBROADCAST: rebroadcasting=true; rebroadcast_digest=(Digest)evt.getArg(); try { rebroadcastMessages(); } finally { rebroadcasting=false; rebroadcast_digest_lock.lock(); try { rebroadcast_digest=null; } finally { rebroadcast_digest_lock.unlock(); } } return null; } return down_prot.down(evt); } /** * <b>Callback</b>. Called by superclass when event may be handled.<p> <b>Do not use <code>PassUp</code> in this * method as the event is passed up by default by the superclass after this method returns !</b> */ public Object up(Event evt) { switch(evt.getType()) { case Event.MSG: Message msg=(Message)evt.getArg(); NakAckHeader hdr=(NakAckHeader)msg.getHeader(name); if(hdr == null) break; // pass up (e.g. unicast msg) // discard messages while not yet server (i.e., until JOIN has returned) if(!is_server) { if(log.isTraceEnabled()) log.trace("message was discarded (not yet server)"); return null; } // Changed by bela Jan 29 2003: we must not remove the header, otherwise // further xmit requests will fail ! //hdr=(NakAckHeader)msg.removeHeader(getName()); switch(hdr.type) { case NakAckHeader.MSG: handleMessage(msg, hdr); return null; // transmitter passes message up for us ! case NakAckHeader.XMIT_REQ: if(hdr.range == null) { if(log.isErrorEnabled()) { log.error("XMIT_REQ: range of xmit msg is null; discarding request from " + msg.getSrc()); } return null; } handleXmitReq(msg.getSrc(), hdr.range.low, hdr.range.high, hdr.sender); return null; case NakAckHeader.XMIT_RSP: if(log.isTraceEnabled()) log.trace("received missing message " + msg.getSrc() + ":" + hdr.seqno); handleXmitRsp(msg); return null; default: if(log.isErrorEnabled()) { log.error("NakAck header type " + hdr.type + " not known !"); } return null; } case Event.STABLE: // generated by STABLE layer. Delete stable messages passed in arg stable((Digest)evt.getArg()); return null; // do not pass up further (Bela Aug 7 2001) case Event.SET_LOCAL_ADDRESS: local_addr=(Address)evt.getArg(); break; case Event.SUSPECT: // release the promise if rebroadcasting is in progress... otherwise we wait forever. there will be a new // flush round anyway if(rebroadcasting) { cancelRebroadcasting(); } break; } return up_prot.up(evt); } private void send(Event evt, Message msg) { if(msg == null) throw new NullPointerException("msg is null; event is " + evt); if(!started) { if(log.isTraceEnabled()) log.trace("[" + local_addr + "] discarded message as start() has not been called, message: " + msg); return; } long msg_id; NakReceiverWindow win=xmit_table.get(local_addr); msg.setSrc(local_addr); // this needs to be done so we can check whether the message sender is the local_addr seqno_lock.lock(); try { try { // incrementing seqno and adding the msg to sent_msgs needs to be atomic msg_id=seqno +1; msg.putHeader(name, new NakAckHeader(NakAckHeader.MSG, msg_id)); win.add(msg_id, msg); seqno=msg_id; } catch(Throwable t) { throw new RuntimeException("failure adding msg " + msg + " to the retransmit table for " + local_addr, t); } } finally { seqno_lock.unlock(); } try { if(msg.isFlagSet(Message.OOB)) oob_loopback_msgs.add(msg_id); if(log.isTraceEnabled()) log.trace("sending " + local_addr + "#" + msg_id); down_prot.down(evt); // if this fails, since msg is in sent_msgs, it can be retransmitted } catch(Throwable t) { // eat the exception, don't pass it up the stack if(log.isWarnEnabled()) { log.warn("failure passing message down", t); } } } /** * Finds the corresponding NakReceiverWindow and adds the message to it (according to seqno). Then removes as many * messages as possible from the NRW and passes them up the stack. Discards messages from non-members. */ private void handleMessage(Message msg, NakAckHeader hdr) { Address sender=msg.getSrc(); if(sender == null) { if(log.isErrorEnabled()) log.error("sender of message is null"); return; } if(log.isTraceEnabled()) log.trace(new StringBuilder().append('[').append(local_addr).append(": received ").append(sender).append('#').append(hdr.seqno)); NakReceiverWindow win=xmit_table.get(sender); if(win == null) { // discard message if there is no entry for sender if(leaving) return; if(log.isWarnEnabled() && log_discard_msgs) log.warn(local_addr + "] discarded message from non-member " + sender + ", my view is " + view); return; } boolean loopback=local_addr.equals(sender); boolean added=loopback || win.add(hdr.seqno, msg); boolean regular_msg_added=added && !msg.isFlagSet(Message.OOB); // message is passed up if OOB. Later, when remove() is called, we discard it. This affects ordering ! if(added && msg.isFlagSet(Message.OOB)) { if(!loopback || oob_loopback_msgs.remove(hdr.seqno)) { up_prot.up(new Event(Event.MSG, msg)); win.removeOOBMessage(); if(!(win.hasMessagesToRemove() && undelivered_msgs.get() > 0)) return; } } // Efficient way of checking whether another thread is already processing messages from 'sender'. // If that's the case, we return immediately and let the exiting thread process our message // can be returned to the thread pool final AtomicBoolean processing=win.getProcessing(); if(!processing.compareAndSet(false, true)) { return; } // where lots of threads can come up to this point concurrently, but only 1 is allowed to pass at a time // We *can* deliver messages from *different* senders concurrently, e.g. reception of P1, Q1, P2, Q2 can result in // delivery of P1, Q1, Q2, P2: FIFO (implemented by NAKACK) says messages need to be delivered in the // order in which they were sent by the sender short removed_regular_msgs=0; // 2nd line of defense: in case of an exception, remove() might not be called, therefore processing would never // be set back to false. If we get an exception and released_processing is not true, then we set // processing to false in the finally clause boolean released_processing=false; final ReentrantLock lock=win.getLock(); try { lock.lock(); if(eager_lock_release) locks.put(Thread.currentThread(), lock); while(true) { Message msg_to_deliver=win.remove(processing); if(msg_to_deliver == null) { released_processing=true; return; // processing will be set to false now } if(msg_to_deliver.isFlagSet(Message.OOB)) { continue; } removed_regular_msgs++; // Changed by bela Jan 29 2003: not needed (see above) //msg_to_deliver.removeHeader(getName()); up_prot.up(new Event(Event.MSG, msg_to_deliver)); } } finally { if(!released_processing) processing.set(false); if(eager_lock_release) locks.remove(Thread.currentThread()); if(lock.isHeldByCurrentThread()) lock.unlock(); // We keep track of regular messages that we added, but couldn't remove (because of ordering). // When we have such messages pending, then even OOB threads will remove and process them if(regular_msg_added && removed_regular_msgs == 0) { undelivered_msgs.incrementAndGet(); } if(removed_regular_msgs > 0) { // regardless of whether a message was added or not ! int num_msgs_added=regular_msg_added? 1 : 0; undelivered_msgs.addAndGet(-(removed_regular_msgs -num_msgs_added)); } } } /** * Retransmits messsages first_seqno to last_seqno from original_sender from xmit_table to xmit_requester, * called when XMIT_REQ is received. * @param xmit_requester The sender of the XMIT_REQ, we have to send the requested copy of the message to this address * @param first_seqno The first sequence number to be retransmitted (<= last_seqno) * @param last_seqno The last sequence number to be retransmitted (>= first_seqno) * @param original_sender The member who originally sent the messsage. Guaranteed to be non-null */ private void handleXmitReq(Address xmit_requester, long first_seqno, long last_seqno, Address original_sender) { Message msg; if(log.isTraceEnabled()) { StringBuilder sb=new StringBuilder(); sb.append(local_addr).append(": received xmit request from ").append(xmit_requester).append(" for "); sb.append(original_sender).append(" [").append(first_seqno).append(" - ").append(last_seqno).append("]"); log.trace(sb.toString()); } if(first_seqno > last_seqno) { if(log.isErrorEnabled()) log.error("first_seqno (" + first_seqno + ") > last_seqno (" + last_seqno + "): not able to retransmit"); return; } if(stats) { xmit_reqs_received+=last_seqno - first_seqno +1; updateStats(received, xmit_requester, 1, 0, 0); } if(xmit_time_stats != null) { long key=(System.currentTimeMillis() - xmit_time_stats_start) / 1000; XmitTimeStat stat=xmit_time_stats.get(key); if(stat == null) { stat=new XmitTimeStat(); XmitTimeStat stat2=xmit_time_stats.putIfAbsent(key, stat); if(stat2 != null) stat=stat2; } stat.xmit_reqs_received.addAndGet((int)(last_seqno - first_seqno +1)); stat.xmit_rsps_sent.addAndGet((int)(last_seqno - first_seqno +1)); } NakReceiverWindow win=xmit_table.get(original_sender); if(win == null) { if(log.isErrorEnabled()) { StringBuilder sb=new StringBuilder(); sb.append("(requester=").append(xmit_requester).append(", local_addr=").append(this.local_addr); sb.append(") ").append(original_sender).append(" not found in retransmission table:\n").append(printMessages()); if(print_stability_history_on_failed_xmit) { sb.append(" (stability history:\n").append(printStabilityHistory()); } log.error(sb); } return; } for(long i=first_seqno; i <= last_seqno; i++) { msg=win.get(i); if(msg == null) { if(log.isWarnEnabled() && !local_addr.equals(xmit_requester)) { StringBuilder sb=new StringBuilder(); sb.append("(requester=").append(xmit_requester).append(", local_addr=").append(this.local_addr); sb.append(") message ").append(original_sender).append("::").append(i); sb.append(" not found in retransmission table of ").append(original_sender).append(":\n").append(win); if(print_stability_history_on_failed_xmit) { sb.append(" (stability history:\n").append(printStabilityHistory()); } log.warn(sb); } continue; } sendXmitRsp(xmit_requester, msg, i); } } private void cancelRebroadcasting() { rebroadcast_lock.lock(); try { rebroadcasting=false; rebroadcast_done.signalAll(); } finally { rebroadcast_lock.unlock(); } } private static void updateStats(ConcurrentMap<Address,StatsEntry> map, Address key, int req, int rsp, int missing) { StatsEntry entry=map.get(key); if(entry == null) { entry=new StatsEntry(); StatsEntry tmp=map.putIfAbsent(key, entry); if(tmp != null) entry=tmp; } entry.xmit_reqs+=req; entry.xmit_rsps+=rsp; entry.missing_msgs_rcvd+=missing; } /** * Sends a message msg to the requester. We have to wrap the original message into a retransmit message, as we need * to preserve the original message's properties, such as src, headers etc. * @param dest * @param msg * @param seqno */ private void sendXmitRsp(Address dest, Message msg, long seqno) { Buffer buf; if(msg == null) { if(log.isErrorEnabled()) log.error("message is null, cannot send retransmission"); return; } if(stats) { xmit_rsps_sent++; updateStats(sent, dest, 0, 1, 0); } if(use_mcast_xmit) dest=null; if(msg.getSrc() == null) msg.setSrc(local_addr); try { buf=Util.messageToByteBuffer(msg); Message xmit_msg=new Message(dest, null, buf.getBuf(), buf.getOffset(), buf.getLength()); // changed Bela Jan 4 2007: we should not use OOB for retransmitted messages, otherwise we tax the OOB thread pool // too much // msg.setFlag(Message.OOB); xmit_msg.putHeader(name, new NakAckHeader(NakAckHeader.XMIT_RSP, seqno)); down_prot.down(new Event(Event.MSG, xmit_msg)); } catch(IOException ex) { log.error("failed marshalling xmit list", ex); } } private void handleXmitRsp(Message msg) { if(msg == null) { if(log.isWarnEnabled()) log.warn("message is null"); return; } try { Message wrapped_msg=Util.byteBufferToMessage(msg.getRawBuffer(), msg.getOffset(), msg.getLength()); if(xmit_time_stats != null) { long key=(System.currentTimeMillis() - xmit_time_stats_start) / 1000; XmitTimeStat stat=xmit_time_stats.get(key); if(stat == null) { stat=new XmitTimeStat(); XmitTimeStat stat2=xmit_time_stats.putIfAbsent(key, stat); if(stat2 != null) stat=stat2; } stat.xmit_rsps_received.incrementAndGet(); } if(stats) { xmit_rsps_received++; updateStats(received, msg.getSrc(), 0, 1, 0); } up(new Event(Event.MSG, wrapped_msg)); if(rebroadcasting) { Digest tmp=getDigest(); boolean cancel_rebroadcasting; rebroadcast_digest_lock.lock(); try { cancel_rebroadcasting=tmp.isGreaterThanOrEqual(rebroadcast_digest); } finally { rebroadcast_digest_lock.unlock(); } if(cancel_rebroadcasting) { cancelRebroadcasting(); } } } catch(Exception ex) { if(log.isErrorEnabled()) { log.error("failed reading retransmitted message", ex); } } } /** * Takes the argument highest_seqnos and compares it to the current digest. If the current digest has fewer messages, * then send retransmit messages for the missing messages. Return when all missing messages have been received. If * we're waiting for a missing message from P, and P crashes while waiting, we need to exclude P from the wait set. */ private void rebroadcastMessages() { Digest my_digest; Map<Address,Digest.Entry> their_digest; Address sender; Digest.Entry their_entry, my_entry; long their_high, my_high; long sleep=max_rebroadcast_timeout / NUM_REBROADCAST_MSGS; long wait_time=max_rebroadcast_timeout, start=System.currentTimeMillis(); while(wait_time > 0) { rebroadcast_digest_lock.lock(); try { if(rebroadcast_digest == null) break; their_digest=rebroadcast_digest.getSenders(); } finally { rebroadcast_digest_lock.unlock(); } my_digest=getDigest(); boolean xmitted=false; for(Map.Entry<Address,Digest.Entry> entry: their_digest.entrySet()) { sender=entry.getKey(); their_entry=entry.getValue(); my_entry=my_digest.get(sender); if(my_entry == null) continue; their_high=their_entry.getHighest(); my_high=my_entry.getHighest(); if(their_high > my_high) { if(log.isTraceEnabled()) log.trace("sending XMIT request to " + sender + " for messages " + my_high + " - " + their_high); retransmit(my_high, their_high, sender, true); // use multicast to send retransmit request xmitted=true; } } if(!xmitted) return; // we're done; no retransmissions are needed anymore. our digest is >= rebroadcast_digest rebroadcast_lock.lock(); try { try { my_digest=getDigest(); rebroadcast_digest_lock.lock(); try { if(!rebroadcasting || my_digest.isGreaterThanOrEqual(rebroadcast_digest)) return; } finally { rebroadcast_digest_lock.unlock(); } rebroadcast_done.await(sleep, TimeUnit.MILLISECONDS); wait_time-=(System.currentTimeMillis() - start); } catch(InterruptedException e) { } } finally { rebroadcast_lock.unlock(); } } } /** * Remove old members from NakReceiverWindows and add new members (starting seqno=0). Essentially removes all * entries from xmit_table that are not in <code>members</code>. This method is not called concurrently * multiple times */ private void adjustReceivers(List<Address> new_members) { NakReceiverWindow win; // 1. Remove all senders in xmit_table that are not members anymore for(Iterator<Address> it=xmit_table.keySet().iterator(); it.hasNext();) { Address sender=it.next(); if(!new_members.contains(sender)) { if(local_addr != null && local_addr.equals(sender)) { if(log.isErrorEnabled()) log.error("will not remove myself (" + sender + ") from xmit_table, received incorrect new membership of " + new_members); continue; } win=xmit_table.get(sender); win.reset(); if(log.isDebugEnabled()) { log.debug("removing " + sender + " from xmit_table (not member anymore)"); } it.remove(); } } // 2. Add newly joined members to xmit_table (starting seqno=0) for(Address sender: new_members) { if(!xmit_table.containsKey(sender)) { win=createNakReceiverWindow(sender, INITIAL_SEQNO, 0); xmit_table.put(sender, win); } } } /** * Returns a message digest: for each member P the lowest, highest delivered and highest received seqno is added */ private Digest getDigest() { Digest.Entry entry; Map<Address,Digest.Entry> map=new HashMap<Address,Digest.Entry>(members.size()); for(Address sender: members) { entry=getEntry(sender); if(entry == null) { if(log.isErrorEnabled()) { log.error("range is null"); } continue; } map.put(sender, entry); } return new Digest(map); } /** * Creates a NakReceiverWindow for each sender in the digest according to the sender's seqno. If NRW already exists, * reset it. */ private void setDigest(Digest digest) { if(digest == null) { if(log.isErrorEnabled()) { log.error("digest or digest.senders is null"); } return; } if(local_addr != null && digest.contains(local_addr)) { clear(); } else { // remove all but local_addr (if not null) for(Iterator<Address> it=xmit_table.keySet().iterator(); it.hasNext();) { Address key=it.next(); if(local_addr != null && local_addr.equals(key)) { ; } else { it.remove(); } } } Address sender; Digest.Entry val; long initial_seqno; NakReceiverWindow win; for(Map.Entry<Address, Digest.Entry> entry: digest.getSenders().entrySet()) { sender=entry.getKey(); val=entry.getValue(); if(sender == null || val == null) { if(log.isWarnEnabled()) { log.warn("sender or value is null"); } continue; } initial_seqno=val.getHighestDeliveredSeqno(); win=createNakReceiverWindow(sender, initial_seqno, val.getLow()); xmit_table.put(sender, win); } if(!xmit_table.containsKey(local_addr)) { if(log.isWarnEnabled()) { log.warn("digest does not contain local address (local_addr=" + local_addr + ", digest=" + digest); } } } private void mergeDigest(Digest digest) { if(digest == null) { if(log.isErrorEnabled()) { log.error("digest or digest.senders is null"); } return; } StringBuilder sb=null; if(log.isDebugEnabled()) { sb=new StringBuilder(); sb.append("existing digest: " + getDigest()).append("\nnew digest: " + digest); } Address sender; Digest.Entry val; NakReceiverWindow win; long highest_delivered_seqno, low_seqno; for(Map.Entry<Address, Digest.Entry> entry: digest.getSenders().entrySet()) { sender=entry.getKey(); val=entry.getValue(); if(sender == null || val == null) { if(log.isWarnEnabled()) { log.warn("sender or value is null"); } continue; } highest_delivered_seqno=val.getHighestDeliveredSeqno(); low_seqno=val.getLow(); // except for myself win=xmit_table.get(sender); if(win != null) { if(local_addr != null && local_addr.equals(sender)) { continue; } else { win.reset(); // stops retransmission xmit_table.remove(sender); } } win=createNakReceiverWindow(sender, highest_delivered_seqno, low_seqno); xmit_table.put(sender, win); } if(log.isDebugEnabled() && sb != null) { sb.append("\n").append("resulting digest: " + getDigest()); log.debug(sb); } if(!xmit_table.containsKey(local_addr)) { if(log.isWarnEnabled()) { log.warn("digest does not contain local address (local_addr=" + local_addr + ", digest=" + digest); } } } private NakReceiverWindow createNakReceiverWindow(Address sender, long initial_seqno, long lowest_seqno) { NakReceiverWindow win=new NakReceiverWindow(local_addr, sender, this, initial_seqno, lowest_seqno, timer); if(use_stats_for_retransmission) { win.setRetransmitTimeouts(new ActualInterval(sender)); } else if(exponential_backoff > 0) { win.setRetransmitTimeouts(new ExponentialInterval(exponential_backoff)); } else { win.setRetransmitTimeouts(new StaticInterval(retransmit_timeouts)); } win.setDiscardDeliveredMessages(discard_delivered_msgs); win.setMaxXmitBufSize(this.max_xmit_buf_size); if(stats) win.setListener(this); return win; } private void dumpXmitStats(String filename) throws IOException { Writer out=new FileWriter(filename); try { TreeMap<Long,XmitTimeStat> map=new TreeMap<Long,XmitTimeStat>(xmit_time_stats); StringBuilder sb; XmitTimeStat stat; out.write("time (secs) gaps-detected xmit-reqs-sent xmit-reqs-received xmit-rsps-sent xmit-rsps-received missing-msgs-received\n\n"); for(Map.Entry<Long,XmitTimeStat> entry: map.entrySet()) { sb=new StringBuilder(); stat=entry.getValue(); sb.append(entry.getKey()).append(" "); sb.append(stat.gaps_detected).append(" "); sb.append(stat.xmit_reqs_sent).append(" "); sb.append(stat.xmit_reqs_received).append(" "); sb.append(stat.xmit_rsps_sent).append(" "); sb.append(stat.xmit_rsps_received).append(" "); sb.append(stat.missing_msgs_received).append("\n"); out.write(sb.toString()); } } finally { out.close(); } } private Digest.Entry getEntry(Address sender) { if(sender == null) { if(log.isErrorEnabled()) { log.error("sender is null"); } return null; } NakReceiverWindow win=xmit_table.get(sender); if(win == null) { if(log.isErrorEnabled()) { log.error("sender " + sender + " not found in xmit_table"); } return null; } long low=win.getLowestSeen(), highest_delivered=win.getHighestDelivered(), highest_received=win.getHighestReceived(); return new Digest.Entry(low, highest_delivered, highest_received); } /** * Garbage collect messages that have been seen by all members. Update sent_msgs: for the sender P in the digest * which is equal to the local address, garbage collect all messages <= seqno at digest[P]. Update xmit_table: * for each sender P in the digest and its highest seqno seen SEQ, garbage collect all delivered_msgs in the * NakReceiverWindow corresponding to P which are <= seqno at digest[P]. */ private void stable(Digest digest) { NakReceiverWindow recv_win; long my_highest_rcvd; // highest seqno received in my digest for a sender P long stability_highest_rcvd; // highest seqno received in the stability vector for a sender P if(members == null || local_addr == null || digest == null) { if(log.isWarnEnabled()) log.warn("members, local_addr or digest are null !"); return; } if(log.isTraceEnabled()) { log.trace("received stable digest " + digest); } stability_msgs.add(digest); Address sender; Digest.Entry val; long high_seqno_delivered, high_seqno_received; for(Map.Entry<Address, Digest.Entry> entry: digest.getSenders().entrySet()) { sender=entry.getKey(); if(sender == null) continue; val=entry.getValue(); high_seqno_delivered=val.getHighestDeliveredSeqno(); high_seqno_received=val.getHighestReceivedSeqno(); // check whether the last seqno received for a sender P in the stability vector is > last seqno // received for P in my digest. if yes, request retransmission (see "Last Message Dropped" topic // in DESIGN) recv_win=xmit_table.get(sender); if(recv_win != null) { my_highest_rcvd=recv_win.getHighestReceived(); stability_highest_rcvd=high_seqno_received; if(stability_highest_rcvd >= 0 && stability_highest_rcvd > my_highest_rcvd) { if(log.isTraceEnabled()) { log.trace("my_highest_rcvd (" + my_highest_rcvd + ") < stability_highest_rcvd (" + stability_highest_rcvd + "): requesting retransmission of " + sender + '#' + stability_highest_rcvd); } retransmit(stability_highest_rcvd, stability_highest_rcvd, sender); } } high_seqno_delivered-=gc_lag; if(high_seqno_delivered < 0) { continue; } if(log.isTraceEnabled()) log.trace("deleting msgs <= " + high_seqno_delivered + " from " + sender); // delete *delivered* msgs that are stable if(recv_win != null) { recv_win.stable(high_seqno_delivered); // delete all messages with seqnos <= seqno } } } /** * Implementation of Retransmitter.RetransmitCommand. Called by retransmission thread when gap is detected. */ public void retransmit(long first_seqno, long last_seqno, Address sender) { retransmit(first_seqno, last_seqno, sender, false); } protected void retransmit(long first_seqno, long last_seqno, final Address sender, boolean multicast_xmit_request) { NakAckHeader hdr; Message retransmit_msg; Address dest=sender; // to whom do we send the XMIT request ? if(multicast_xmit_request || this.use_mcast_xmit_req) { dest=null; } else { if(xmit_from_random_member && !local_addr.equals(sender)) { Address random_member=(Address)Util.pickRandomElement(members); if(random_member != null && !local_addr.equals(random_member)) { dest=random_member; if(log.isTraceEnabled()) log.trace("picked random member " + dest + " to send XMIT request to"); } } } hdr=new NakAckHeader(NakAckHeader.XMIT_REQ, first_seqno, last_seqno, sender); retransmit_msg=new Message(dest, null, null); retransmit_msg.setFlag(Message.OOB); if(log.isTraceEnabled()) log.trace(local_addr + ": sending XMIT_REQ ([" + first_seqno + ", " + last_seqno + "]) to " + dest); retransmit_msg.putHeader(name, hdr); ConcurrentMap<Long,Long> tmp=xmit_stats.get(sender); if(tmp == null) { tmp=new ConcurrentHashMap<Long,Long>(); ConcurrentMap<Long,Long> tmp2=xmit_stats.putIfAbsent(sender, tmp); if(tmp2 != null) tmp=tmp2; } for(long seq=first_seqno; seq < last_seqno; seq++) { tmp.putIfAbsent(seq, System.currentTimeMillis()); } if(xmit_time_stats != null) { long key=(System.currentTimeMillis() - xmit_time_stats_start) / 1000; XmitTimeStat stat=xmit_time_stats.get(key); if(stat == null) { stat=new XmitTimeStat(); XmitTimeStat stat2=xmit_time_stats.putIfAbsent(key, stat); if(stat2 != null) stat=stat2; } stat.xmit_reqs_sent.addAndGet((int)(last_seqno - first_seqno +1)); } down_prot.down(new Event(Event.MSG, retransmit_msg)); if(stats) { xmit_reqs_sent+=last_seqno - first_seqno +1; updateStats(sent, sender, 1, 0, 0); XmitRequest req=new XmitRequest(sender, first_seqno, last_seqno, sender); send_history.add(req); } } public void missingMessageReceived(long seqno, final Address original_sender) { ConcurrentMap<Long,Long> tmp=xmit_stats.get(original_sender); if(tmp != null) { Long timestamp=tmp.remove(seqno); if(timestamp != null) { long diff=System.currentTimeMillis() - timestamp; BoundedList<Long> list=xmit_times_history.get(original_sender); if(list == null) { list=new BoundedList<Long>(xmit_history_max_size); BoundedList<Long> list2=xmit_times_history.putIfAbsent(original_sender, list); if(list2 != null) list=list2; } list.add(diff); // compute the smoothed average for retransmission times for original_sender // needs to be synchronized because we rely on the previous value for computation of the next value synchronized(smoothed_avg_xmit_times) { Double smoothed_avg=smoothed_avg_xmit_times.get(original_sender); if(smoothed_avg == null) smoothed_avg=INITIAL_SMOOTHED_AVG; // the smoothed avg takes 90% of the previous value, 100% of the new value and averages them // then, we add 10% to be on the safe side (an xmit value should rather err on the higher than lower side) smoothed_avg=((smoothed_avg * WEIGHT) + diff) / 2; smoothed_avg=smoothed_avg * (2 - WEIGHT); smoothed_avg_xmit_times.put(original_sender, smoothed_avg); } } } if(xmit_time_stats != null) { long key=(System.currentTimeMillis() - xmit_time_stats_start) / 1000; XmitTimeStat stat=xmit_time_stats.get(key); if(stat == null) { stat=new XmitTimeStat(); XmitTimeStat stat2=xmit_time_stats.putIfAbsent(key, stat); if(stat2 != null) stat=stat2; } stat.missing_msgs_received.incrementAndGet(); } if(stats) { missing_msgs_received++; updateStats(received, original_sender, 0, 0, 1); MissingMessage missing=new MissingMessage(original_sender, seqno); receive_history.add(missing); } } /** Called when a message gap is detected */ public void messageGapDetected(long from, long to, Address src) { if(xmit_time_stats != null) { long key=(System.currentTimeMillis() - xmit_time_stats_start) / 1000; XmitTimeStat stat=xmit_time_stats.get(key); if(stat == null) { stat=new XmitTimeStat(); XmitTimeStat stat2=xmit_time_stats.putIfAbsent(key, stat); if(stat2 != null) stat=stat2; } stat.gaps_detected.addAndGet((int)(to - from +1)); } } private void clear() { // changed April 21 2004 (bela): SourceForge bug# 938584. We cannot delete our own messages sent between // a join() and a getState(). Otherwise retransmission requests from members who missed those msgs might // fail. Not to worry though: those msgs will be cleared by STABLE (message garbage collection) // sent_msgs.clear(); for(NakReceiverWindow win: xmit_table.values()) { win.reset(); } xmit_table.clear(); undelivered_msgs.set(0); } private void reset() { seqno_lock.lock(); try { seqno=0; } finally { seqno_lock.unlock(); } for(NakReceiverWindow win: xmit_table.values()) { win.destroy(); } xmit_table.clear(); undelivered_msgs.set(0); } @ManagedOperation(description="TODO") public String printMessages() { StringBuilder ret=new StringBuilder(); Map.Entry<Address,NakReceiverWindow> entry; Address addr; Object w; for(Iterator<Map.Entry<Address,NakReceiverWindow>> it=xmit_table.entrySet().iterator(); it.hasNext();) { entry=it.next(); addr=entry.getKey(); w=entry.getValue(); ret.append(addr).append(": ").append(w.toString()).append('\n'); } return ret.toString(); } @ManagedOperation(description="TODO") public String printRetransmissionAvgs() { StringBuilder sb=new StringBuilder(); for(Map.Entry<Address,BoundedList<Long>> entry: xmit_times_history.entrySet()) { Address sender=entry.getKey(); BoundedList<Long> list=entry.getValue(); long tmp=0; int i=0; for(Long val: list) { tmp+=val; i++; } double avg=i > 0? tmp / i: -1; sb.append(sender).append(": ").append(avg).append("\n"); } return sb.toString(); } @ManagedOperation(description="TODO") public String printSmoothedRetransmissionAvgs() { StringBuilder sb=new StringBuilder(); for(Map.Entry<Address,Double> entry: smoothed_avg_xmit_times.entrySet()) { sb.append(entry.getKey()).append(": ").append(entry.getValue()).append("\n"); } return sb.toString(); } @ManagedOperation(description="TODO") public String printRetransmissionTimes() { StringBuilder sb=new StringBuilder(); for(Map.Entry<Address,BoundedList<Long>> entry: xmit_times_history.entrySet()) { Address sender=entry.getKey(); BoundedList<Long> list=entry.getValue(); sb.append(sender).append(": ").append(list).append("\n"); } return sb.toString(); } @ManagedAttribute public double getTotalAverageRetransmissionTime() { long total=0; int i=0; for(BoundedList<Long> list: xmit_times_history.values()) { for(Long val: list) { total+=val; i++; } } return i > 0? total / i: -1; } @ManagedAttribute public double getTotalAverageSmoothedRetransmissionTime() { double total=0.0; int cnt=0; synchronized(smoothed_avg_xmit_times) { for(Double val: smoothed_avg_xmit_times.values()) { if(val != null) { total+=val; cnt++; } } } return cnt > 0? total / cnt : -1; } /** Returns the smoothed average retransmission time for a given sender */ public double getSmoothedAverageRetransmissionTime(Address sender) { synchronized(smoothed_avg_xmit_times) { Double retval=smoothed_avg_xmit_times.get(sender); if(retval == null) { retval=INITIAL_SMOOTHED_AVG; smoothed_avg_xmit_times.put(sender, retval); } return retval; } } // public static final class LossRate { // private final Set<Long> received=new HashSet<Long>(); // private final Set<Long> missing=new HashSet<Long>(); // private double smoothed_loss_rate=0.0; // public synchronized void addReceived(long seqno) { // received.add(seqno); // missing.remove(seqno); // setSmoothedLossRate(); // public synchronized void addReceived(Long ... seqnos) { // for(int i=0; i < seqnos.length; i++) { // Long seqno=seqnos[i]; // received.add(seqno); // missing.remove(seqno); // setSmoothedLossRate(); // public synchronized void addMissing(long from, long to) { // for(long i=from; i <= to; i++) { // if(!received.contains(i)) // missing.add(i); // setSmoothedLossRate(); // public synchronized double computeLossRate() { // int num_missing=missing.size(); // if(num_missing == 0) // return 0.0; // int num_received=received.size(); // int total=num_missing + num_received; // return num_missing / (double)total; // public synchronized double getSmoothedLossRate() { // return smoothed_loss_rate; // public synchronized String toString() { // StringBuilder sb=new StringBuilder(); // int num_missing=missing.size(); // int num_received=received.size(); // int total=num_missing + num_received; // sb.append("total=").append(total).append(" (received=").append(received.size()).append(", missing=") // .append(missing.size()).append(", loss rate=").append(computeLossRate()) // .append(", smoothed loss rate=").append(smoothed_loss_rate).append(")"); // return sb.toString(); // /** Set the new smoothed_loss_rate value to 70% of the new value and 30% of the old value */ // private void setSmoothedLossRate() { // double new_loss_rate=computeLossRate(); // if(smoothed_loss_rate == 0) { // smoothed_loss_rate=new_loss_rate; // else { // smoothed_loss_rate=smoothed_loss_rate * .3 + new_loss_rate * .7; private static class XmitTimeStat { final AtomicInteger gaps_detected=new AtomicInteger(0); final AtomicInteger xmit_reqs_sent=new AtomicInteger(0); final AtomicInteger xmit_reqs_received=new AtomicInteger(0); final AtomicInteger xmit_rsps_sent=new AtomicInteger(0); final AtomicInteger xmit_rsps_received=new AtomicInteger(0); final AtomicInteger missing_msgs_received=new AtomicInteger(0); } private class ActualInterval implements Interval { private final Address sender; public ActualInterval(Address sender) { this.sender=sender; } public long next() { return (long)getSmoothedAverageRetransmissionTime(sender); } public Interval copy() { return this; } } static class StatsEntry { long xmit_reqs, xmit_rsps, missing_msgs_rcvd; public String toString() { StringBuilder sb=new StringBuilder(); sb.append(xmit_reqs).append(" xmit_reqs").append(", ").append(xmit_rsps).append(" xmit_rsps"); sb.append(", ").append(missing_msgs_rcvd).append(" missing msgs"); return sb.toString(); } } static class XmitRequest { final Address original_sender; // original sender of message final long low, high, timestamp=System.currentTimeMillis(); final Address xmit_dest; // destination to which XMIT_REQ is sent, usually the original sender XmitRequest(Address original_sender, long low, long high, Address xmit_dest) { this.original_sender=original_sender; this.xmit_dest=xmit_dest; this.low=low; this.high=high; } public String toString() { StringBuilder sb=new StringBuilder(); sb.append(new Date(timestamp)).append(": ").append(original_sender).append(" #[").append(low); sb.append("-").append(high).append("]"); sb.append(" (XMIT_REQ sent to ").append(xmit_dest).append(")"); return sb.toString(); } } static class MissingMessage { final Address original_sender; final long seq, timestamp=System.currentTimeMillis(); MissingMessage(Address original_sender, long seqno) { this.original_sender=original_sender; this.seq=seqno; } public String toString() { StringBuilder sb=new StringBuilder(); sb.append(new Date(timestamp)).append(": ").append(original_sender).append(" #").append(seq); return sb.toString(); } } }
/* Open Source Software - may be modified and shared by FRC teams. The code */ /* the project. */ // FILE NAME: Kilroy.java (Team 339 - Kilroy) // ABSTRACT: // This file is where almost all code for Kilroy will be // written. All of these functions are functions that should // override methods in the base class (IterativeRobot). The // functions are as follows: // autonomousInit() - Initialization code for autonomous mode // should go here. Will be called each time the robot enters // autonomous mode. // disabledInit() - Initialization code for disabled mode should // go here. This function will be called one time when the // robot first enters disabled mode. // robotInit() - Robot-wide initialization code should go here. // It will be called exactly 1 time. // teleopInit() - Initialization code for teleop mode should go here. // Will be called each time the robot enters teleop mode. // autonomousPeriodic() - Periodic code for autonomous mode should // go here. Will be called periodically at a regular rate while // the robot is in autonomous mode. // disabledPeriodic() - Periodic code for disabled mode should go here. // Will be called periodically at a regular rate while the robot // is in disabled mode. // teleopPeriodic() - Periodic code for teleop mode should go here. // Will be called periodically at a regular rate while the robot // is in teleop mode. // autonomousContinuous() - Continuous code for autonomous mode should // go here. Will be called repeatedly as frequently as possible // while the robot is in autonomous mode. // disabledContinuous() - Continuous code for disabled mode should go // here. Will be called repeatedly as frequently as possible while // the robot is in disabled mode. // teleopContinuous() - Continuous code for teleop mode should go here. // Will be called repeatedly as frequently as possible while the // robot is in teleop mode. // Other functions not normally used // startCompetition() - This function is a replacement for the WPI // supplied 'main loop'. This should not normally be written or // used. // Team 339. package org.usfirst.frc.team339.robot; import org.usfirst.frc.team339.Hardware.Hardware; import edu.wpi.first.wpilibj.DoubleSolenoid; import edu.wpi.first.wpilibj.IterativeRobot; import edu.wpi.first.wpilibj.MotorSafetyHelper; import edu.wpi.first.wpilibj.Relay.Direction; /** * The VM is configured to automatically run this class, and to call the * functions corresponding to each mode, as described in the IterativeRobot * documentation. If you change the name of this class or the package after * creating this project, you must also update the manifest file in the resource * directory. */ public class Robot extends IterativeRobot { // private data for the class // new watchdog object MotorSafetyHelper watchdog; @Override public void autonomousInit () { // start setup - tell the user we are beginning // setup System.out.println("Started AutonousInit()."); // Dims the brightness level so that we can take a better picture // of the retroreflective tape. // of the retroreflective tape. Hardware.axisCamera.writeBrightness(5); // Call the Autonomous class's Init function, // which contains the user code. Autonomous.init(); // done setup - tell the user we are complete // setup System.out.println("Completed AutonousInit()."); } // end autonomousInit @Override public void autonomousPeriodic () { // Call the Autonomous class's Periodic function, // which contains the user code. Autonomous.periodic(); } // end autonomousPeriodic @Override public void disabledInit () { // start setup - tell the user we are beginning // setup System.out.println("Started DisabledInit()."); // User code goes below here Hardware.leftRearMotorSafety.setSafetyEnabled(false); Hardware.rightRearMotorSafety.setSafetyEnabled(false); Hardware.leftFrontMotorSafety.setSafetyEnabled(false); Hardware.rightFrontMotorSafety.setSafetyEnabled(false); // User code goes above here // done setup - tell the user we are complete // setup System.out.println("Completed DisabledInit()."); } // end disabledInit @Override public void disabledPeriodic () { // Watch dog code used to go here. // User code goes below here // User code goes above here } // end disabledPeriodic @Override public void robotInit () { // Watch dog code used to go here. // User code goes below here // Encoder Initialization Hardware.leftRearEncoder.setDistancePerPulse(0.019706); Hardware.leftRearEncoder.reset(); Hardware.rightRearEncoder.setDistancePerPulse(0.019706); Hardware.rightRearEncoder.reset(); Hardware.transmission.initEncoders(Hardware.rightRearEncoder, Hardware.leftRearEncoder); Hardware.leftRearEncoder .setDistancePerPulse(distancePerTickForMotorEncoders); Hardware.leftRearEncoder.reset(); Hardware.rightRearEncoder .setDistancePerPulse(distancePerTickForMotorEncoders); Hardware.rightRearEncoder.reset(); Hardware.transmission.setMaxGear(2); Hardware.transmission.initEncoders(Hardware.rightRearEncoder, Hardware.leftRearEncoder); // USB camera initialization Hardware.transmission.initEncoders(Hardware.rightRearEncoder, Hardware.leftRearEncoder); // USB camera initialization // Settings for the USB Camera Hardware.cam0.setBrightness(50); Hardware.cam0.setExposureAuto(); Hardware.cam0.setSize(160, 120); Hardware.cam0.setFPS(20); Hardware.cam0.setWhiteBalanceAuto(); Hardware.cam0.setWhiteBalanceHoldCurrent(); Hardware.cam0.updateSettings(); // Starts streaming video Hardware.cameraServer.startAutomaticCapture(Hardware.cam0); // Sets FPS and Resolution of camera Hardware.axisCamera.writeMaxFPS(Hardware.AXIS_FPS); Hardware.axisCamera.writeResolution(Hardware.AXIS_RESOLUTION); Hardware.axisCamera .writeBrightness(Hardware.NORMAL_AXIS_CAMERA_BRIGHTNESS); // Hardware.axisCamera // .writeWhiteBalance(AxisCamera.WhiteBalance.kHold); // Tells the relay which way is on (kBackward is unable to be used) Hardware.ringLightRelay.setDirection(Direction.kForward); // motor initialization Hardware.leftRearMotorSafety.setSafetyEnabled(true); Hardware.rightRearMotorSafety.setSafetyEnabled(true); Hardware.leftFrontMotorSafety.setSafetyEnabled(true); Hardware.rightFrontMotorSafety.setSafetyEnabled(true); Hardware.rightRearMotor.setInverted(true); // Compressor Initialization Hardware.compressor.setClosedLoopControl(true); // Encoder Initialization Hardware.leftRearEncoder.reset(); Hardware.leftRearEncoder .setDistancePerPulse(distancePerTickForMotorEncoders); Hardware.rightRearEncoder.reset(); Hardware.rightRearEncoder .setDistancePerPulse(distancePerTickForMotorEncoders); // Solenoid Initialization // initializes the solenoids...duh duh duh... Hardware.cameraSolenoid.set(DoubleSolenoid.Value.kForward); Hardware.catapultSolenoid0.set(false); Hardware.catapultSolenoid1.set(false); Hardware.catapultSolenoid2.set(false); Hardware.rightRearEncoder.setReverseDirection(true); // User code goes above here // done setup - tell the user we are complete // setup System.out.println( "Kilroy XVII is started. All hardware items created."); System.out.println(); System.out.println(); } // end robotInit @Override public void teleopInit () { // start setup - tell the user we are beginning // setup System.out.println("Started teleopInit()."); // Call the Teleop class's Init function, // which contains the user code. Teleop.init(); // done setup - tell the user we are complete // setup System.out.println("Completed TeleopInit()."); } // end teleopInit @Override public void teleopPeriodic () { // Watch dog code used to go here. // Call the Teleop class's Periodic function, // which contains the user code. Teleop.periodic(); } // end teleopPeriodic @Override public void testInit () { // User code goes below here // User code goes above here } // end testInit @Override public void testPeriodic () { // User code goes below here // User code goes above here } // end testPeriodic // TUNEABLES private final double distancePerTickForMotorEncoders = 0.019706; } // end class
package org.usfirst.frc.team997.robot; import org.usfirst.frc.team997.robot.commands.AutoCheval; import org.usfirst.frc.team997.robot.commands.AutoDriveBackwards; import org.usfirst.frc.team997.robot.commands.AutoDriveForward; import org.usfirst.frc.team997.robot.commands.DriveToSetpoint; import org.usfirst.frc.team997.robot.commands.NullCommand; import org.usfirst.frc.team997.robot.subsystems.DriveTrain; import org.usfirst.frc.team997.robot.subsystems.Gatherer; import org.usfirst.frc.team997.robot.subsystems.GathererArm; //import org.usfirst.frc.team997.robot.subsystems.GathererArmNoSP; import org.usfirst.frc.team997.robot.subsystems.Shooter; import org.usfirst.frc.team997.robot.subsystems.ShooterPivot; import edu.wpi.first.wpilibj.ADXRS450_Gyro; import edu.wpi.first.wpilibj.CameraServer; import edu.wpi.first.wpilibj.IterativeRobot; import edu.wpi.first.wpilibj.PowerDistributionPanel; import edu.wpi.first.wpilibj.Relay; import edu.wpi.first.wpilibj.command.Command; import edu.wpi.first.wpilibj.command.Scheduler; import edu.wpi.first.wpilibj.livewindow.LiveWindow; import edu.wpi.first.wpilibj.smartdashboard.SendableChooser; import edu.wpi.first.wpilibj.smartdashboard.SmartDashboard; /** * The VM is configured to automatically run this class, and to call the * functions corresponding to each mode, as described in the IterativeRobot * documentation. If you change the name of this class or the package after * creating this project, you must also update the manifest file in the resource * directory. */ public class Robot extends IterativeRobot { public static Relay clight; private CameraServer camera; public static final Shooter shooter = new Shooter( RobotMap.shooterBallSensor, RobotMap.shooterMotorPort, RobotMap.servoMotorFirstPort, RobotMap.servoMotorSecondPort); public static final ShooterPivot shooterPivot = new ShooterPivot( RobotMap.aimingMotorPort, RobotMap.shooterPivotAnglePort); public static final DriveTrain driveTrain = new DriveTrain(RobotMap.leftMotorPort, RobotMap.rightMotorPort, RobotMap.leftEncoderFirstPort, RobotMap.leftEncoderSecondPort, RobotMap.rightEncoderFirstPort, RobotMap.rightEncoderSecondPort); public static final Gatherer gatherer = new Gatherer(RobotMap.rollerMotorPort); public static final GathererArm gathererArm = new GathererArm(RobotMap.gatherArmMotorPort, RobotMap.gathererArmAnglePort); //public static final GathererArmNoSP gathererArm = new GathererArmNoSP(RobotMap.gatherArmMotorPort); public static ADXRS450_Gyro gyro; public static OI oi; private Command autonomousCommand; private SendableChooser chooser; //public static Compressor compressor; public static PowerDistributionPanel pdp; public void robotInit() { oi = new OI(); chooser = new SendableChooser(); chooser.addDefault("Forward", new AutoDriveForward()); chooser.addObject("Backward", new AutoDriveBackwards()); //use this for low bar chooser.addObject("Cheval", new AutoCheval()); chooser.addObject("Nothing", new NullCommand()); SmartDashboard.putData("Auto mode", chooser); gyro = new ADXRS450_Gyro(); gyro.calibrate(); pdp = new PowerDistributionPanel(); camera = CameraServer.getInstance(); camera.setQuality(42); camera.startAutomaticCapture("cam1"); //clight = new Relay(RobotMap.circleLightPort); // Need to reset the servo's position to be ready to capture a ball. Retracts kicker servos. Robot.shooter.retractKicker(); autonomousCommand = new AutoCheval(); } public void disabledInit() { } public void disabledPeriodic() { Scheduler.getInstance().run(); } public void autonomousInit() { gyro.reset(); //autonomousCommand = (Command) chooser.getSelected(); // schedule the autonomous command (example) // if (autonomousCommand != null) autonomousCommand.start(); getSelected().start(); } // private Command getSelected() { return autonomousCommand; } private Command getSelected() { return (Command) chooser.getSelected(); } public void autonomousPeriodic() { Scheduler.getInstance().run(); smartDashboard(); } public void teleopInit() { Robot.gathererArm.lockArmPosition(); } public void teleopPeriodic() { Scheduler.getInstance().run(); smartDashboard(); } public void testPeriodic() { LiveWindow.run(); } public void smartDashboard(){ Robot.driveTrain.smartDashboard(); Robot.shooter.smartDashboard(); Robot.gathererArm.smartDashboard(); Robot.shooterPivot.smartDashboard(); //imu info put on the smartdashboard SmartDashboard.putNumber("Gyro Angle", Robot.gyro.getAngle()); SmartDashboard.putNumber("Gyro Rate", Robot.gyro.getRate()); } }
package cn.cerc.core; import java.text.ParseException; import java.text.SimpleDateFormat; import java.util.Date; /** * * * @author */ public class TDate extends TDateTime { private static final long serialVersionUID = 1L; public TDate(Date date) { this.setData(date); } public TDate(String date) { TDateTime val = TDateTime.fromDate(date); if (val == null) { throw new RuntimeException(String.format("%s ", date)); } this.setData(val.getData()); } @Deprecated public static TDate Today() { return today(); } public static TDate today() { SimpleDateFormat sdf = new SimpleDateFormat("yyyy-MM-dd"); Date date = new Date(); String str = sdf.format(date); try { date = sdf.parse(str); } catch (ParseException e) { e.printStackTrace(); throw new RuntimeException(""); } return new TDate(date); } public static void main(String[] args) { TDate val; val = new TDate(TDateTime.now().incMonth(-13).getData()); System.out.println(val.getShortValue()); val = TDate.Today(); System.out.println(val.getShortValue()); } @Override public String toString() { return this.getDate(); } public String getShortValue() { String year = this.getYearMonth().substring(2, 4); int month = this.getMonth(); int day = this.getDay(); if (TDateTime.now().compareYear(this) != 0) { return String.format("%s%d", year, month); } else { return String.format("%d%d", month, day); } } }
package org.jetel.graph; import java.io.IOException; import java.nio.ByteBuffer; import java.sql.SQLException; import java.util.ArrayList; import java.util.Collection; import java.util.Iterator; import java.util.List; import java.util.NoSuchElementException; import java.util.TreeMap; import java.util.concurrent.CyclicBarrier; import org.apache.commons.logging.Log; import org.apache.commons.logging.LogFactory; import org.apache.log4j.MDC; import org.jetel.data.DataRecord; import org.jetel.enums.EnabledEnum; import org.jetel.exception.ComponentNotReadyException; import org.jetel.exception.ConfigurationProblem; import org.jetel.exception.ConfigurationStatus; import org.jetel.exception.ConfigurationStatus.Priority; import org.jetel.exception.ConfigurationStatus.Severity; import org.jetel.exception.TransformException; import org.jetel.exception.XMLConfigurationException; import org.jetel.graph.distribution.NodeAllocation; import org.jetel.graph.runtime.CloverPost; import org.jetel.graph.runtime.CloverWorkerListener; import org.jetel.graph.runtime.ErrorMsgBody; import org.jetel.graph.runtime.Message; import org.jetel.metadata.DataRecordMetadata; import org.jetel.util.string.StringUtils; import org.w3c.dom.Element; /** * A class that represents atomic transformation task. It is a base class for * all kinds of transformation components. * *@author D.Pavlis *@created January 31, 2003 *@since April 2, 2002 *@see org.jetel.component *@revision $Revision$ */ public abstract class Node extends GraphElement implements Runnable, CloverWorkerListener { private static final Log logger = LogFactory.getLog(Node.class); protected Thread nodeThread; /** * List of all threads under this component. * For instance parallel reader uses threads for parallel reading. * It is component's responsibility to register all inner threads via addChildThread() method. */ protected List<Thread> childThreads; protected EnabledEnum enabled; protected int passThroughInputPort; protected int passThroughOutputPort; protected TreeMap<Integer, OutputPort> outPorts; protected TreeMap<Integer, InputPort> inPorts; protected volatile boolean runIt = true; protected volatile Result runResult; protected Throwable resultException; protected String resultMessage; protected Phase phase; /** * Distribution of this node processing at cluster environment. */ protected NodeAllocation allocation; // buffered values protected OutputPort[] outPortsArray; protected int outPortsSize; //synchronization barrier for all components in a phase //all components have to finish pre-execution before execution method private CyclicBarrier executeBarrier; //synchronization barrier for all components in a phase //watchdog needs to have all components with thread assignment before can continue to watch the phase private CyclicBarrier preExecuteBarrier; /** * Various PORT kinds identifiers * *@since August 13, 2002 */ public final static char OUTPUT_PORT = 'O'; /** Description of the Field */ public final static char INPUT_PORT = 'I'; /** * XML attributes of every cloverETL component */ public final static String XML_NAME_ATTRIBUTE = "guiName"; public final static String XML_TYPE_ATTRIBUTE="type"; public final static String XML_ENABLED_ATTRIBUTE="enabled"; public final static String XML_ALLOCATION_ATTRIBUTE = "allocation"; /** * Standard constructor. * *@param id Unique ID of the Node *@since April 4, 2002 */ public Node(String id){ this(id,null); } /** * Standard constructor. * *@param id Unique ID of the Node *@since April 4, 2002 */ public Node(String id, TransformationGraph graph) { super(id,graph); outPorts = new TreeMap<Integer, OutputPort>(); inPorts = new TreeMap<Integer, InputPort>(); phase = null; runResult=Result.N_A; // result is not known yet childThreads = new ArrayList<Thread>(); allocation = NodeAllocation.createBasedOnNeighbours(); } /** * Sets the EOF for particular output port. EOF indicates that no more data * will be sent throught the output port. * *@param portNum The new EOF value * @throws IOException * @throws IOException *@since April 18, 2002 */ public void setEOF(int portNum) throws InterruptedException, IOException { try { ((OutputPort) outPorts.get(Integer.valueOf(portNum))).eof(); } catch (IndexOutOfBoundsException ex) { ex.printStackTrace(); } } /** * Returns the type of this Node (subclasses/Components should override * this method to return appropriate type). * *@return The Type value *@since April 4, 2002 */ public abstract String getType(); /** * Returns True if this Node is Leaf Node - i.e. only consumes data (has only * input ports connected to it) * *@return True if Node is a Leaf *@since April 4, 2002 */ public boolean isLeaf() { if (outPorts.size() == 0) { return true; } else { return false; } } /** * Returns True if this Node is Phase Leaf Node - i.e. only consumes data within * phase it belongs to (has only input ports connected or any connected output ports * connects this Node with Node in different phase) * * @return True if this Node is Phase Leaf */ public boolean isPhaseLeaf() { for (OutputPort outputPort : getOutPorts()) { if (phase != outputPort.getReader().getPhase()) { return true; } } return false; } /** * Returns True if this node is Root Node - i.e. it produces data (has only output ports * connected to id). * *@return True if Node is a Root *@since April 4, 2002 */ public boolean isRoot() { if (inPorts.size() == 0) { return true; } else { return false; } } /** * Sets the processing phase of the Node object.<br> * Default is 0 (ZERO). * *@param phase The new phase number */ public void setPhase(Phase phase) { this.phase = phase; } /** * Gets the processing phase of the Node object * *@return The phase value */ public Phase getPhase() { return phase; } /** * @return phase number */ public int getPhaseNum(){ return phase.getPhaseNum(); } /** * Gets the OutPorts attribute of the Node object * *@return Collection of OutPorts *@since April 18, 2002 */ public Collection<OutputPort> getOutPorts() { return outPorts.values(); } /** * Gets the InPorts attribute of the Node object * *@return Collection of InPorts *@since April 18, 2002 */ public Collection<InputPort> getInPorts() { return inPorts.values(); } /** * Gets the metadata on output ports of the Node object * *@return Collection of output ports metadata */ public List<DataRecordMetadata> getOutMetadata() { List<DataRecordMetadata> ret = new ArrayList<DataRecordMetadata>(outPorts.size()); for(Iterator<OutputPort> it = getOutPorts().iterator(); it.hasNext();) { ret.add(it.next().getMetadata()); } return ret; } /** * Gets the metadata on input ports of the Node object * *@return Collection of input ports metadata */ public List<DataRecordMetadata> getInMetadata() { List<DataRecordMetadata> ret = new ArrayList<DataRecordMetadata>(inPorts.size()); for(Iterator<InputPort> it = getInPorts().iterator(); it.hasNext();) { ret.add(it.next().getMetadata()); } return ret; } /** * Gets the number of records passed through specified port type and number * *@param portType Port type (IN, OUT, LOG) *@param portNum port number (0...) *@return The RecordCount value *@since May 17, 2002 *@deprecated */ public int getRecordCount(char portType, int portNum) { int count; // Integer used as key to TreeMap containing ports Integer port = Integer.valueOf(portNum); try { switch (portType) { case OUTPUT_PORT: count = ((OutputPort) outPorts.get(port)).getOutputRecordCounter(); break; case INPUT_PORT: count = ((InputPort) inPorts.get(port)).getInputRecordCounter(); break; default: count = -1; } } catch (Exception ex) { count = -1; } return count; } /** * Gets the result code of finished Node.<br> * *@return The Result value *@since July 29, 2002 *@see org.jetel.graph.Node.Result */ public Result getResultCode() { return runResult; } /** * Sets the result code of component. * @param result */ public void setResultCode(Result result) { this.runResult = result; } /** * Gets the ResultMsg of finished Node.<br> * This message briefly describes what caused and error (if there was any). * *@return The ResultMsg value *@since July 29, 2002 */ public String getResultMsg() { return runResult!=null ? runResult.message() : null; } /** * Gets exception which caused Node to fail execution - if * there was such failure. * * @return * @since 13.12.2006 */ public Throwable getResultException(){ return resultException; } // Operations /* (non-Javadoc) * @see org.jetel.graph.GraphElement#init() */ @Override public void init() throws ComponentNotReadyException { super.init(); runResult = Result.READY; refreshBufferedValues(); } /* (non-Javadoc) * @see org.jetel.graph.GraphElement#preExecute() */ public void preExecute() throws ComponentNotReadyException { super.preExecute(); runResult = Result.RUNNING; } /** * main execution method of Node (calls in turn execute()) * *@since April 2, 2002 */ public void run() { runResult = Result.RUNNING; // set running result, so we know run() method was started //store the current thread like a node executor setNodeThread(Thread.currentThread()); try { //we need a synchronization point for all components in a phase //watchdog starts all components in phase and wait on this barrier for real startup preExecuteBarrier.await(); //preExecute() invocation try { preExecute(); } catch (ComponentNotReadyException e) { throw new ComponentNotReadyException(this, "Component pre-execute initialization failed. " + e.getMessage(), e); } //waiting for other nodes in the current phase - first all pre-execution has to be done at all nodes executeBarrier.await(); //execute() invocation if((runResult = execute()) == Result.ERROR) { Message<ErrorMsgBody> msg = Message.createErrorMessage(this, new ErrorMsgBody(runResult.code(), resultMessage != null ? resultMessage : runResult.message(), null)); getCloverPost().sendMessage(msg); } if (runResult == Result.FINISHED_OK) { if (runIt = false) { //component returns ok tag, but the component was actually aborted runResult = Result.ABORTED; } else { //check whether all input ports are already closed for (InputPort inputPort : getInPorts()) { if (!inputPort.isEOF()) { runResult = Result.ERROR; Message<ErrorMsgBody> msg = Message.createErrorMessage(this, new ErrorMsgBody(runResult.code(), "Component has finished and input port " + inputPort.getInputPortNumber() + " still contains some unread records.", null)); getCloverPost().sendMessage(msg); return; } } } //broadcast all output ports with EOF information broadcastEOF(); } } catch (InterruptedException ex) { runResult=Result.ABORTED; return; } catch (IOException ex) { // may be handled differently later runResult=Result.ERROR; resultException = ex; Message<ErrorMsgBody> msg = Message.createErrorMessage(this, new ErrorMsgBody(runResult.code(), runResult.message(), ex)); getCloverPost().sendMessage(msg); return; } catch (TransformException ex){ runResult=Result.ERROR; resultException = ex; Message<ErrorMsgBody> msg = Message.createErrorMessage(this, new ErrorMsgBody(runResult.code(), "Error occurred in nested transformation: " + runResult.message(), ex)); getCloverPost().sendMessage(msg); return; } catch (SQLException ex){ runResult=Result.ERROR; resultException = ex; Message<ErrorMsgBody> msg = Message.createErrorMessage(this, new ErrorMsgBody(runResult.code(), runResult.message(), ex)); getCloverPost().sendMessage(msg); return; } catch (Exception ex) { // may be handled differently later runResult=Result.ERROR; resultException = ex; Message<ErrorMsgBody> msg = Message.createErrorMessage(this, new ErrorMsgBody(runResult.code(), runResult.message(), ex)); getCloverPost().sendMessage(msg); return; } catch (Throwable ex) { logger.fatal(ex); runResult=Result.ERROR; resultException = ex; Message<ErrorMsgBody> msg = Message.createErrorMessage(this, new ErrorMsgBody(runResult.code(), runResult.message(), ex)); getCloverPost().sendMessage(msg); return; } finally { sendFinishMessage(); setNodeThread(null); } } public abstract Result execute() throws Exception; /** * This method should be called every time when node finishes its work. */ private void sendFinishMessage() { //sends notification - node has finished Message<Object> msg = Message.createNodeFinishedMessage(this); if (getCloverPost() != null) //that condition should be removed - graph aborting is not well synchronized now getCloverPost().sendMessage(msg); } /** * Abort execution of Node - only inform node, that should finish processing. * *@since April 4, 2002 */ public void abort() { abort(null); } synchronized public void abort(Throwable cause ) { int attempts = 30; runIt = false; while (runResult == Result.RUNNING && attempts if (logger.isTraceEnabled()) logger.trace("try to interrupt thread "+getNodeThread()); getNodeThread().interrupt(); try { Thread.sleep(10); } catch (InterruptedException e) { } } if (cause != null) { runResult=Result.ERROR; resultException = cause; Message<ErrorMsgBody> msg = Message.createErrorMessage(this, new ErrorMsgBody(runResult.code(), runResult.message(), cause)); getCloverPost().sendMessage(msg); sendFinishMessage(); } else if (runResult == Result.RUNNING) { logger.debug("Node '" + getId() + "' was not interrupted in legal way."); runResult = Result.ABORTED; sendFinishMessage(); } } /** * @return thread of running node; <b>null</b> if node does not running */ public synchronized Thread getNodeThread() { return nodeThread; } /** * Sets actual thread in which this node current running. * @param nodeThread */ private synchronized void setNodeThread(Thread nodeThread) { if(nodeThread != null) { this.nodeThread = nodeThread; //thread context classloader is preset to a reasonable classloader //this is just for sure, threads are recycled and no body can guarantee which context classloader remains preset nodeThread.setContextClassLoader(this.getClass().getClassLoader()); String oldName = nodeThread.getName(); ContextProvider.registerNode(this); long runId = getGraph().getRuntimeContext().getRunId(); nodeThread.setName(getId()+"_"+runId); MDC.put("runId", getGraph().getRuntimeContext().getRunId()); if (logger.isTraceEnabled()) { logger.trace("set thread name; old:"+oldName+" new:"+ nodeThread.getName()); logger.trace("set thread runId; runId:"+runId+" thread name:"+Thread.currentThread().getName()); } } else { ContextProvider.unregister(); MDC.remove("runId"); long runId = getGraph().getRuntimeContext().getRunId(); if (logger.isTraceEnabled()) logger.trace("reset thread runId; runId:"+runId+" thread name:"+Thread.currentThread().getName()); this.nodeThread.setName("<unnamed>"); this.nodeThread = null; } } /** * End execution of Node - let Node finish gracefully * *@since April 4, 2002 */ public void end() { runIt = false; } /** * Provides CloverRuntime - object providing * various run-time services * * @return * @since 13.12.2006 */ public CloverPost getCloverPost(){ return getGraph().getPost(); } /** * An operation that adds port to list of all InputPorts * *@param port Port (Input connection) to be added *@since April 2, 2002 *@deprecated Use the other method which takes 2 arguments (portNum, port) */ public void addInputPort(InputPort port) { Integer portNum; int keyVal; try { portNum = (Integer) inPorts.lastKey(); keyVal = portNum.intValue() + 1; } catch (NoSuchElementException ex) { keyVal = 0; } inPorts.put(Integer.valueOf(keyVal), port); port.connectReader(this, keyVal); } /** * An operation that adds port to list of all InputPorts * *@param portNum Number to be associated with this port *@param port Port (Input connection) to be added *@since April 2, 2002 */ public void addInputPort(int portNum, InputPort port) { inPorts.put(Integer.valueOf(portNum), port); port.connectReader(this, portNum); } /** * An operation that adds port to list of all OutputPorts * *@param port Port (Output connection) to be added *@since April 4, 2002 *@deprecated Use the other method which takes 2 arguments (portNum, port) */ public void addOutputPort(OutputPort port) { Integer portNum; int keyVal; try { portNum = (Integer) inPorts.lastKey(); keyVal = portNum.intValue() + 1; } catch (NoSuchElementException ex) { keyVal = 0; } outPorts.put(Integer.valueOf(keyVal), port); port.connectWriter(this, keyVal); resetBufferedValues(); } /** * An operation that adds port to list of all OutputPorts * *@param portNum Number to be associated with this port *@param port The feature to be added to the OutputPort attribute *@since April 4, 2002 */ public void addOutputPort(int portNum, OutputPort port) { outPorts.put(Integer.valueOf(portNum), port); port.connectWriter(this, portNum); resetBufferedValues(); } /** * Gets the port which has associated the num specified * *@param portNum number associated with the port *@return The outputPort */ public OutputPort getOutputPort(int portNum) { Object outPort=outPorts.get(Integer.valueOf(portNum)); if (outPort instanceof OutputPort) { return (OutputPort)outPort ; }else if (outPort==null) { return null; } throw new RuntimeException("Port number \""+portNum+"\" does not implement OutputPort interface "+outPort.getClass().getName()); } /** * Gets the port which has associated the num specified * *@param portNum number associated with the port *@return The outputPort */ public OutputPortDirect getOutputPortDirect(int portNum) { Object outPort=outPorts.get(Integer.valueOf(portNum)); if (outPort instanceof OutputPortDirect) { return (OutputPortDirect)outPort ; }else if (outPort==null) { return null; } throw new RuntimeException("Port number \""+portNum+"\" does not implement OutputPortDirect interface"); } /** * Gets the port which has associated the num specified * *@param portNum portNum number associated with the port *@return The inputPort */ public InputPort getInputPort(int portNum) { Object inPort=inPorts.get(Integer.valueOf(portNum)); if (inPort instanceof InputPort) { return (InputPort)inPort ; }else if (inPort==null){ return null; } throw new RuntimeException("Port number \""+portNum+"\" does not implement InputPort interface"); } /** * Gets the port which has associated the num specified * *@param portNum portNum number associated with the port *@return The inputPort */ public InputPortDirect getInputPortDirect(int portNum) { Object inPort=inPorts.get(Integer.valueOf(portNum)); if (inPort instanceof InputPortDirect) { return (InputPortDirect)inPort ; }else if (inPort==null){ return null; } throw new RuntimeException("Port number \""+portNum+"\" does not implement InputPortDirect interface"); } /** * Removes input port. * @param inputPort */ public void removeInputPort(InputPort inputPort) { inPorts.remove(Integer.valueOf(inputPort.getInputPortNumber())); } /** * Removes output port. * @param outputPort */ public void removeOutputPort(OutputPort outputPort) { outPorts.remove(Integer.valueOf(outputPort.getOutputPortNumber())); resetBufferedValues(); } /** * An operation that does removes/unregisteres por<br> * Not yet implemented. * *@param _portNum Description of Parameter *@param _portType Description of Parameter *@since April 2, 2002 */ public void deletePort(int _portNum, char _portType) { throw new UnsupportedOperationException("Deleting port is not supported !"); } /** * An operation that writes one record through specified output port.<br> * As this operation gets the Port object from TreeMap, don't use it in loops * or when time is critical. Instead obtain the Port object directly and * use it's writeRecord() method. * *@param _portNum Description of Parameter *@param _record Description of Parameter *@exception IOException Description of Exception *@exception InterruptedException Description of Exception *@since April 2, 2002 */ public void writeRecord(int _portNum, DataRecord _record) throws IOException, InterruptedException { ((OutputPort) outPorts.get(Integer.valueOf(_portNum))).writeRecord(_record); } /** * An operation that reads one record through specified input port.<br> * As this operation gets the Port object from TreeMap, don't use it in loops * or when time is critical. Instead obtain the Port object directly and * use it's readRecord() method. * *@param _portNum Description of Parameter *@param record Description of Parameter *@return Description of the Returned Value *@exception IOException Description of Exception *@exception InterruptedException Description of Exception *@since April 2, 2002 */ public DataRecord readRecord(int _portNum, DataRecord record) throws IOException, InterruptedException { return ((InputPort) inPorts.get(Integer.valueOf(_portNum))).readRecord(record); } /** * An operation that does ... * *@param record Description of Parameter *@exception IOException Description of Exception *@exception InterruptedException Description of Exception *@since April 2, 2002 */ public void writeRecordBroadcast(DataRecord record) throws IOException, InterruptedException { for(int i=0;i<outPortsSize;i++){ outPortsArray[i].writeRecord(record); } } /** * Description of the Method * *@param recordBuffer Description of Parameter *@exception IOException Description of Exception *@exception InterruptedException Description of Exception *@since August 13, 2002 */ public void writeRecordBroadcastDirect(ByteBuffer recordBuffer) throws IOException, InterruptedException { for(int i=0;i<outPortsSize;i++){ ((OutputPortDirect) outPortsArray[i]).writeRecordDirect(recordBuffer); recordBuffer.rewind(); } } /** * Closes all output ports - sends EOF signal to them. * @throws IOException * *@since April 11, 2002 */ public void closeAllOutputPorts() throws InterruptedException, IOException { for (OutputPort outputPort : getOutPorts()) { outputPort.eof(); } } /** * Send EOF (no more data) to all connected output ports * @throws IOException * *@since April 18, 2002 */ public void broadcastEOF() throws InterruptedException, IOException{ closeAllOutputPorts(); } /** * Closes specified output port - sends EOF signal. * *@param portNum Which port to close * @throws IOException *@since April 11, 2002 */ public void closeOutputPort(int portNum) throws InterruptedException, IOException { OutputPort port = (OutputPort) outPorts.get(Integer.valueOf(portNum)); if (port == null) { throw new RuntimeException(this.getId()+" - can't close output port \"" + portNum + "\" - does not exists!"); } port.eof(); } /** * Compares this Node to specified Object * * @param obj * Node to compare with * @return True if obj represents node with the same ID * @since April 18, 2002 */ @Override public boolean equals(Object obj) { if (obj == null || !(obj instanceof Node)) { return false; } final Node other = (Node) obj; return getId().equals(other.getId()); } @Override public int hashCode(){ return getId().hashCode(); } /** * Description of the Method * *@return Description of the Returned Value *@since May 21, 2002 */ public void toXML(Element xmlElement) { // set basic XML attributes of all graph components xmlElement.setAttribute(XML_ID_ATTRIBUTE, getId()); xmlElement.setAttribute(XML_TYPE_ATTRIBUTE, getType()); } /** * Description of the Method * *@param nodeXML Description of Parameter *@return Description of the Returned Value *@since May 21, 2002 */ public static Node fromXML(TransformationGraph graph, Element xmlElement)throws XMLConfigurationException { throw new UnsupportedOperationException("not implemented in org.jetel.graph.Node"); } /** * @return <b>true</b> if node is enabled; <b>false</b> else */ public EnabledEnum getEnabled() { return enabled; } /** * @param enabled whether node is enabled */ public void setEnabled(String enabledStr) { enabled = EnabledEnum.fromString(enabledStr, EnabledEnum.ENABLED); } /** * @return index of "pass through" input port */ public int getPassThroughInputPort() { return passThroughInputPort; } /** * Sets "pass through" input port. * @param passThroughInputPort */ public void setPassThroughInputPort(int passThroughInputPort) { this.passThroughInputPort = passThroughInputPort; } /** * @return index of "pass through" output port */ public int getPassThroughOutputPort() { return passThroughOutputPort; } /** * Sets "pass through" output port * @param passThroughOutputPort */ public void setPassThroughOutputPort(int passThroughOutputPort) { this.passThroughOutputPort = passThroughOutputPort; } /** * @return node allocation in parallel processing (cluster environment) */ public NodeAllocation getAllocation() { return allocation; } /** * @param required node allocation in parallel processing (cluster environment) */ public void setAllocation(NodeAllocation alloc) { this.allocation = alloc; } protected void resetBufferedValues(){ outPortsArray=null; outPortsSize=0; } protected void refreshBufferedValues(){ Collection<OutputPort> op = getOutPorts(); outPortsArray = (OutputPort[]) op.toArray(new OutputPort[op.size()]); outPortsSize = outPortsArray.length; } /** * Checks number of input ports, whether is in the given interval. * @param status * @param min * @param max * @param checkNonAssignedPorts should be checked non-assigned ports (for example first port without edge and second port with edge) * @return true if the number of input ports is in the given interval; else false */ protected boolean checkInputPorts(ConfigurationStatus status, int min, int max, boolean checkNonAssignedPorts) { boolean retValue = true; Collection<InputPort> inPorts = getInPorts(); if(inPorts.size() < min) { status.add(new ConfigurationProblem("At least " + min + " input port must be defined!", Severity.ERROR, this, Priority.NORMAL)); retValue = false; } if(inPorts.size() > max) { status.add(new ConfigurationProblem("At most " + max + " input ports can be defined!", Severity.ERROR, this, Priority.NORMAL)); retValue = false; } int index = 0; for (InputPort inputPort : inPorts) { if (inputPort.getMetadata() == null){ //TODO interface for matadata status.add(new ConfigurationProblem("Metadata on input port " + inputPort.getInputPortNumber() + " are not defined!", Severity.WARNING, this, Priority.NORMAL)); retValue = false; } if (checkNonAssignedPorts && inputPort.getInputPortNumber() != index){ status.add(new ConfigurationProblem("Input port " + index + " is not defined!", Severity.ERROR, this, Priority.NORMAL)); retValue = false; } index++; } return retValue; } protected boolean checkInputPorts(ConfigurationStatus status, int min, int max) { return checkInputPorts(status, min, max, true); } /** * Checks number of output ports, whether is in the given interval. * @param status * @param min * @param max * @param checkNonAssignedPorts should be checked non-assigned ports (for example first port without edge and second port with edge) * @return true if the number of output ports is in the given interval; else false */ protected boolean checkOutputPorts(ConfigurationStatus status, int min, int max, boolean checkNonAssignedPorts) { Collection<OutputPort> outPorts = getOutPorts(); if(outPorts.size() < min) { status.add(new ConfigurationProblem("At least " + min + " output port must be defined!", Severity.ERROR, this, Priority.NORMAL)); return false; } if(outPorts.size() > max) { status.add(new ConfigurationProblem("At most " + max + " output ports can be defined!", Severity.ERROR, this, Priority.NORMAL)); return false; } int index = 0; for (OutputPort outputPort : outPorts) { if (outputPort.getMetadata() == null){ status.add(new ConfigurationProblem("Metadata on output port " + outputPort.getOutputPortNumber() + " are not defined!", Severity.WARNING, this, Priority.NORMAL)); return false; } if (checkNonAssignedPorts && outputPort.getOutputPortNumber() != index){ status.add(new ConfigurationProblem("Output port " + index + " is not defined!", Severity.ERROR, this, Priority.NORMAL)); return false; } index++; } return true; } protected boolean checkOutputPorts(ConfigurationStatus status, int min, int max) { return checkOutputPorts(status, min, max, true); } /** * Checks if metadatas in given list are all equal * * @param status * @param metadata list of metadata to check * @return */ protected ConfigurationStatus checkMetadata(ConfigurationStatus status, Collection<DataRecordMetadata> metadata){ return checkMetadata(status, metadata, (Collection<DataRecordMetadata>)null); } /** * Checks if all metadata (in inMetadata list as well as in outMetadata list) are equal * * @param status * @param inMetadata * @param outMetadata * @return */ protected ConfigurationStatus checkMetadata(ConfigurationStatus status, Collection<DataRecordMetadata> inMetadata, Collection<DataRecordMetadata> outMetadata){ return checkMetadata(status, inMetadata, outMetadata, true); } /** * Checks if all metadata (in inMetadata list as well as in outMetadata list) are equal * If checkFixDelType is true then checks fixed/delimited state. * * @param status * @param inMetadata * @param outMetadata * @param checkFixDelType * @return */ protected ConfigurationStatus checkMetadata(ConfigurationStatus status, Collection<DataRecordMetadata> inMetadata, Collection<DataRecordMetadata> outMetadata, boolean checkFixDelType){ Iterator<DataRecordMetadata> iterator = inMetadata.iterator(); DataRecordMetadata metadata = null, nextMetadata; if (iterator.hasNext()) { metadata = iterator.next(); } //check input metadata while (iterator.hasNext()) { nextMetadata = iterator.next(); if (metadata == null || !metadata.equals(nextMetadata)) { status.add(new ConfigurationProblem("Metadata " + StringUtils.quote(metadata == null ? "null" : metadata.getName()) + " does not equal to metadata " + StringUtils.quote(nextMetadata == null ? "null" : nextMetadata.getName()), metadata == null || nextMetadata == null ? Severity.WARNING : Severity.ERROR, this, Priority.NORMAL)); } metadata = nextMetadata; } if (outMetadata == null) { return status; } //check if input metadata equals output metadata iterator = outMetadata.iterator(); if (iterator.hasNext()) { nextMetadata = iterator.next(); if (metadata == null || !metadata.equals(nextMetadata, checkFixDelType)) { status.add(new ConfigurationProblem("Metadata " + StringUtils.quote(metadata == null ? "null" : metadata.getName()) + " does not equal to metadata " + StringUtils.quote(nextMetadata == null ? "null" : nextMetadata.getName()), metadata == null || nextMetadata == null ? Severity.WARNING : Severity.ERROR, this, Priority.NORMAL)); } metadata = nextMetadata; } //check output metadata while (iterator.hasNext()) { nextMetadata = iterator.next(); if (metadata == null || !metadata.equals(nextMetadata)) { status.add(new ConfigurationProblem("Metadata " + StringUtils.quote(metadata == null ? "null" : metadata.getName()) + " does not equal to metadata " + StringUtils.quote(nextMetadata == null ? "null" : nextMetadata.getName()), metadata == null || nextMetadata == null ? Severity.WARNING : Severity.ERROR, this, Priority.NORMAL)); } metadata = nextMetadata; } return status; } protected ConfigurationStatus checkMetadata(ConfigurationStatus status, DataRecordMetadata inMetadata, Collection<DataRecordMetadata> outMetadata){ Collection<DataRecordMetadata> inputMetadata = new ArrayList<DataRecordMetadata>(1); inputMetadata.add(inMetadata); return checkMetadata(status, inputMetadata, outMetadata); } protected ConfigurationStatus checkMetadata(ConfigurationStatus status, Collection<DataRecordMetadata> inMetadata, DataRecordMetadata outMetadata){ Collection<DataRecordMetadata> outputMetadata = new ArrayList<DataRecordMetadata>(1); outputMetadata.add(outMetadata); return checkMetadata(status, inMetadata, outputMetadata); } protected ConfigurationStatus checkMetadata(ConfigurationStatus status, DataRecordMetadata inMetadata, DataRecordMetadata outMetadata) { Collection<DataRecordMetadata> inputMetadata = new ArrayList<DataRecordMetadata>(1); inputMetadata.add(inMetadata); Collection<DataRecordMetadata> outputMetadata = new ArrayList<DataRecordMetadata>(1); outputMetadata.add(outMetadata); return checkMetadata(status, inputMetadata, outputMetadata); } /** * The given thread is registered as a child thread of this component. * The child threads are exploited for grabing of tracking information - CPU usage of this component * is sum of all threads. * @param childThread */ public void registerChildThread(Thread childThread) { childThreads.add(childThread); } /** * The given threads are registered as child threads of this component. * The child threads are exploited for grabing of tracking information - for instance * CPU usage of this component is sum of all threads. * @param childThreads */ protected void registerChildThreads(List<Thread> childThreads) { childThreads.addAll(childThreads); } /** * @return list of all child threads - threads running under this component */ public List<Thread> getChildThreads() { return childThreads; } /* (non-Javadoc) * @see org.jetel.graph.GraphElement#reset() * @deprecated see {@link org.jetel.graph.IGraphElement#preExecute()} and {@link org.jetel.graph.IGraphElement#postExecute()} methods */ @Deprecated synchronized public void reset() throws ComponentNotReadyException { super.reset(); runIt = true; runResult=Result.READY; resultMessage = null; resultException = null; childThreads.clear(); } @Override public synchronized void free() { super.free(); childThreads.clear(); } /** * This method is intended to be overridden. * @return URLs which this component is using */ public String[] getUsedUrls() { return new String[0]; } public void setPreExecuteBarrier(CyclicBarrier preExecuteBarrier) { this.preExecuteBarrier = preExecuteBarrier; } public void setExecuteBarrier(CyclicBarrier executeBarrier) { this.executeBarrier = executeBarrier; } /** * That is not nice solution to make public this variable. Unfortunately this is necessary * for new ComponentAlgorithm interface. Whenever this class will be removed also this * getter can be removed. * @return current status of runIt variable */ public boolean runIt() { return runIt; } @Override public void workerFinished(Event e) { // ignore by default } @Override public void workerCrashed(Event e) { //e.getException().printStackTrace(); resultException = e.getException(); abort(e.getException()); } }
package com.github.sormuras.listing; import java.io.ByteArrayInputStream; import java.io.ByteArrayOutputStream; import java.io.ObjectInput; import java.io.ObjectInputStream; import java.io.ObjectOutput; import java.io.ObjectOutputStream; import java.lang.reflect.InvocationHandler; import java.lang.reflect.Proxy; import java.nio.ByteBuffer; import java.nio.charset.StandardCharsets; import java.nio.file.Files; import java.nio.file.Path; import java.nio.file.Paths; import org.junit.jupiter.api.Assertions; public interface Tests { static void assertEquals(Class<?> testClass, String testName, Listable listable) { assertEquals(testClass, testName, new Listing().add(listable)); } static void assertEquals(Class<?> testClass, String testName, Listing listing) { try { Assertions.assertEquals(load(testClass, testName), listing.toString()); } catch (Exception e) { Assertions.fail(e.toString()); } } static void assertSerializable(Listable listable) { try { String expected = listable.list(); Assertions.assertEquals(expected, listable.list()); byte[] bytes = convertToBytes(listable); Object converted = convertFromBytes(bytes); String actual = ((Listable) converted).list(); Assertions.assertEquals(expected, actual); } catch (Exception e) { Assertions.fail(e.toString()); } } static Object convertFromBytes(byte[] bytes) throws Exception { try (ByteArrayInputStream bis = new ByteArrayInputStream(bytes); ObjectInput in = new ObjectInputStream(bis)) { return in.readObject(); } } static byte[] convertToBytes(Object object) throws Exception { try (ByteArrayOutputStream bos = new ByteArrayOutputStream(); ObjectOutput out = new ObjectOutputStream(bos)) { out.writeObject(object); return bos.toByteArray(); } } static String load(Class<?> testClass, String testName) { String fileName = testClass.getName().replace('.', '/') + "." + testName + ".txt"; try { Path path = Paths.get(testClass.getClassLoader().getResource(fileName).toURI()); return new String(Files.readAllBytes(path), StandardCharsets.UTF_8); } catch (Exception e) { throw new AssertionError("Loading `" + fileName + "` failed!", e); } } static <T> T proxy(Class<T> type, InvocationHandler handler) { ClassLoader loader = type.getClassLoader(); Class<?>[] interfaces = {type}; return type.cast(Proxy.newProxyInstance(loader, interfaces, handler)); } /** Same as: <code>toString(bytes, 16, 16)</code>. */ static String toString(byte[] bytes) { return toString(bytes, 16, 16); } /** Same as: <code>toString(ByteBuffer.wrap(bytes), bytesPerLine, maxLines)</code>. */ static String toString(byte[] bytes, int bytesPerLine, int maxLines) { return toString(ByteBuffer.wrap(bytes), bytesPerLine, maxLines); } /** Same as: <code>toString(buffer, 16, 16)</code>. */ static String toString(ByteBuffer buffer) { return toString(buffer, 16, 16); } static String toString(ByteBuffer buffer, int bytesPerLine, int maxLines) { return toString(new StringBuilder(), buffer, bytesPerLine, maxLines); } static String toString(StringBuilder builder, ByteBuffer buffer) { return toString(builder, buffer, 16, 16); } static String toString(StringBuilder builder, ByteBuffer buffer, int bytesPerLine, int maxLines) { final boolean INCLUDE_SEGMENT_NUMBERS = true; final boolean INCLUDE_VIEW_HEX = true; final boolean INCLUDE_VIEW_ASCII = true; final int BLOCK_LENGTH = 4; final char BLOCK_SEPARATOR = ' '; int i, j, n, k, line; builder.append(buffer).append(" {\n"); line = 0; for (n = 0; n < buffer.remaining(); n += bytesPerLine, line++) { // builder.append(" "); if (line >= maxLines) { int omitted = buffer.remaining() - n; builder.append("...("); builder.append(omitted); builder.append(" byte"); builder.append(omitted != 1 ? "s" : ""); builder.append(" omitted)\n"); break; } if (INCLUDE_SEGMENT_NUMBERS) { String segment = Integer.toHexString(n).toUpperCase(); for (j = 0, k = 4 - segment.length(); j < k; j++) { builder.append('0'); } builder.append(segment).append(" | "); } if (INCLUDE_VIEW_HEX) { for (i = n; i < n + bytesPerLine && i < buffer.remaining(); i++) { String s = Integer.toHexString(buffer.get(i) & 255).toUpperCase(); if (s.length() == 1) { builder.append('0'); } builder.append(s).append(' '); if (i % bytesPerLine % BLOCK_LENGTH == BLOCK_LENGTH - 1 && i < n + bytesPerLine - 1) { builder.append(BLOCK_SEPARATOR); } } while (i < n + bytesPerLine) { builder.append(" "); if (i % bytesPerLine % BLOCK_LENGTH == BLOCK_LENGTH - 1 && i < n + bytesPerLine - 1) { builder.append(BLOCK_SEPARATOR); } i++; } builder.append('|').append(' '); } if (INCLUDE_VIEW_ASCII) { for (i = n; i < n + bytesPerLine && i < buffer.remaining(); i++) { int v = buffer.get(i) & 255; if (v > 127 || Character.isISOControl((char) v)) { builder.append('.'); } else { builder.append((char) v); } if (i % bytesPerLine % BLOCK_LENGTH == BLOCK_LENGTH - 1 && i < n + bytesPerLine - 1) { builder.append(BLOCK_SEPARATOR); } } while (i < n + bytesPerLine) { builder.append(' '); if (i % bytesPerLine % BLOCK_LENGTH == BLOCK_LENGTH - 1 && i < n + bytesPerLine - 1) { builder.append(BLOCK_SEPARATOR); } i++; } } builder.append('\n'); } builder.append("}"); return builder.toString(); } }
package org.mini2Dx.ui.element; import java.util.LinkedList; import java.util.Queue; import org.mini2Dx.core.graphics.TextureRegion; import org.mini2Dx.core.serialization.annotation.ConstructorArg; import org.mini2Dx.core.serialization.annotation.Field; import org.mini2Dx.ui.render.ImageRenderNode; import org.mini2Dx.ui.render.ParentRenderNode; import com.badlogic.gdx.Gdx; import com.badlogic.gdx.assets.AssetManager; import com.badlogic.gdx.graphics.Texture; import com.badlogic.gdx.graphics.g2d.TextureAtlas; import com.badlogic.gdx.graphics.g2d.TextureAtlas.AtlasRegion; /** * Wraps a {@link Texture} or {@link TextureRegion} as a {@link UiElement} */ public class Image extends UiElement { private static final String LOGGING_TAG = Image.class.getSimpleName(); protected ImageRenderNode renderNode; private TextureRegion textureRegion; @Field private String texturePath; @Field(optional = true) private String atlas; @Field(optional = true) private boolean responsive = false; @Field(optional=true) private boolean flipX = false; @Field(optional=true) private boolean flipY = false; /** * Constructor. Generates a unique ID for this {@link Image} */ public Image() { super(null); } /** * Constructor * * @param id * The unique ID for this {@link Image} */ public Image(@ConstructorArg(clazz = String.class, name = "id") String id) { super(id); } /** * Constructor * * @param id * The unique ID for this {@link Image} * @param texturePath * The path for the {@link Texture} to be loaded by the * {@link AssetManager} */ public Image(String id, String texturePath) { super(id); setTexturePath(texturePath); } /** * Constructor. Generates a unique ID for this {@link Image} * * @param texture * The {@link Texture} to use */ public Image(Texture texture) { this(null, texture); } /** * Constructor. Generates a unique ID for this {@link Image} * * @param textureRegion * The {@link TextureRegion} to use */ public Image(TextureRegion textureRegion) { this(null, textureRegion); } /** * Constructor * * @param id * The unique ID for this {@link Image} * @param texture * The {@link Texture} to use */ public Image(String id, Texture texture) { super(id); this.textureRegion = new TextureRegion(texture); } /** * Constructor * * @param id * The unique ID for this {@link Image} * @param textureRegion * The {@link TextureRegion} to use */ public Image(String id, TextureRegion textureRegion) { super(id); this.textureRegion = textureRegion; } @Override public void attach(ParentRenderNode<?, ?> parentRenderNode) { if (renderNode != null) { return; } renderNode = new ImageRenderNode(parentRenderNode, this); parentRenderNode.addChild(renderNode); } @Override public void detach(ParentRenderNode<?, ?> parentRenderNode) { if (renderNode == null) { return; } parentRenderNode.removeChild(renderNode); renderNode = null; } /** * Returns the current {@link TextureRegion} for this {@link Image} * * @param assetManager * The game's {@link AssetManager} * @return Null if no {@link TextureRegion} has been set */ public TextureRegion getTextureRegion(AssetManager assetManager) { if (atlas != null) { if (texturePath != null) { TextureAtlas textureAtlas = assetManager.get(atlas, TextureAtlas.class); if(textureAtlas == null) { Gdx.app.error(LOGGING_TAG, "Could not find texture atlas " + atlas); return null; } AtlasRegion atlasRegion = textureAtlas.findRegion(texturePath); if(atlasRegion == null) { Gdx.app.error(LOGGING_TAG, "Could not find " + texturePath + " in texture atlas " + atlas); return null; } textureRegion = new TextureRegion(); texturePath = null; } } else if (texturePath != null) { textureRegion = new TextureRegion(assetManager.get(texturePath, Texture.class)); texturePath = null; } return textureRegion; } /** * Sets the current {@link TextureRegion} used by this {@link Image} * * @param textureRegion * The {@link TextureRegion} to use */ public void setTextureRegion(TextureRegion textureRegion) { this.textureRegion = textureRegion; if (renderNode == null) { return; } renderNode.setDirty(true); } /** * Sets the current {@link Texture} used by this {@link Image} * * @param texture * The {@link Texture} to use */ public void setTexture(Texture texture) { if (texture == null) { setTextureRegion(null); } else { setTextureRegion(new TextureRegion(texture)); } } /** * Returns the current texture path * * @return Null if no path is used */ public String getTexturePath() { return texturePath; } /** * Sets the current texture path. This will set the current * {@link TextureRegion} by loading it via the {@link AssetManager} * * @param texturePath * The path to the texture */ public void setTexturePath(String texturePath) { this.texturePath = texturePath; if (renderNode == null) { return; } renderNode.setDirty(true); } /** * Returns the atlas (if any) to look up the texture in * @return Null by default */ public String getAtlas() { return atlas; } /** * Sets the atlas to look up the texture in * @param atlas Null if the texture should not be looked up via an atlas */ public void setAtlas(String atlas) { this.atlas = atlas; if (renderNode == null) { return; } renderNode.setDirty(true); } /** * Returns if this {@link Image} should scale to the size of its parent * * @return False by default */ public boolean isResponsive() { return responsive; } /** * Sets if this {@link Image} should scale to the size of its parent * @param responsive */ public void setResponsive(boolean responsive) { this.responsive = responsive; if (renderNode == null) { return; } renderNode.setDirty(true); } @Override public void setVisibility(Visibility visibility) { if (visibility == null) { return; } if (this.visibility == visibility) { return; } this.visibility = visibility; if (renderNode == null) { return; } renderNode.setDirty(true); } @Override public void defer(Runnable runnable) { deferredQueue.offer(runnable); } @Override public void syncWithRenderNode() { while (!effects.isEmpty()) { renderNode.applyEffect(effects.poll()); } while (!deferredQueue.isEmpty()) { deferredQueue.poll().run(); } } @Override public void setStyleId(String styleId) { if (styleId == null) { return; } if (this.styleId.equals(styleId)) { return; } this.styleId = styleId; if (renderNode == null) { return; } renderNode.setDirty(true); } @Override public void setZIndex(int zIndex) { this.zIndex = zIndex; if (renderNode == null) { return; } renderNode.setDirty(true); } /** * Returns if the texture should be flipped horizontally during rendering * @return */ public boolean isFlipX() { return flipX; } /** * Sets if the texture should be flipped horizontally during rendering * @param flipX True if the texture should be flipped */ public void setFlipX(boolean flipX) { this.flipX = flipX; } /** * Returns if the texture should be flipped vertically during rendering * @return */ public boolean isFlipY() { return flipY; } /** * Sets if the texture should be flipped vertically during rendering * @param flipY True if the texture should be flipped */ public void setFlipY(boolean flipY) { this.flipY = flipY; } }
package org.yamcs; import java.util.ArrayList; import java.util.HashMap; import java.util.HashSet; import java.util.List; import java.util.Map; import java.util.Set; import org.yamcs.api.EventProducer; import org.yamcs.api.EventProducerFactory; import org.yamcs.protobuf.Pvalue.MonitoringResult; import org.yamcs.protobuf.Yamcs.NamedObjectId; import org.yamcs.utils.StringConvertors; import org.yamcs.xtce.AlarmReportType; import org.yamcs.xtce.AlarmType; import org.yamcs.xtce.Parameter; import org.yamcs.xtce.ParameterType; import org.yamcs.xtce.XtceDb; import org.yamcs.xtceproc.XtceDbFactory; import com.google.common.util.concurrent.AbstractService; /** * Generates realtime alarm events automatically, by subscribing to all relevant * parameters. * <p> * <b>Must be declared after {@link YarchChannel}</b> */ public class AlarmReporter extends AbstractService implements ParameterConsumer { private EventProducer eventProducer; private Map<Parameter, ActiveAlarm> activeAlarms=new HashMap<Parameter, ActiveAlarm>(); // Last value of each param (for detecting changes in value) private Map<Parameter, ParameterValue> lastValuePerParameter=new HashMap<Parameter, ParameterValue>(); final String yamcsInstance; final String channelName; public AlarmReporter(String yamcsInstance) { this(yamcsInstance, "realtime"); } public AlarmReporter(String yamcsInstance, String channelName) { this.yamcsInstance = yamcsInstance; this.channelName = channelName; eventProducer=EventProducerFactory.getEventProducer(yamcsInstance); eventProducer.setSource("AlarmChecker"); } @Override public void doStart() { Channel channel = Channel.getInstance(yamcsInstance, channelName); if(channel==null) { ConfigurationException e = new ConfigurationException("Cannot find a channel '"+channelName+"' in instance '"+yamcsInstance+"'"); notifyFailed(e); return; } ParameterRequestManager prm = channel.getParameterRequestManager(); prm.getAlarmChecker().enableReporting(this); // Auto-subscribe to parameters with alarms Set<Parameter> requiredParameters=new HashSet<Parameter>(); try { XtceDb xtcedb=XtceDbFactory.getInstance(yamcsInstance); for (Parameter parameter:xtcedb.getParameters()) { ParameterType ptype=parameter.getParameterType(); if(ptype!=null && ptype.hasAlarm()) { requiredParameters.add(parameter); Set<Parameter> dependentParameters = ptype.getDependentParameters(); if(dependentParameters!=null) { requiredParameters.addAll(dependentParameters); } } } } catch(ConfigurationException e) { throw new RuntimeException(e); } if(!requiredParameters.isEmpty()) { List<NamedObjectId> paramNames=new ArrayList<NamedObjectId>(); // Now that we have uniques.. for(Parameter p:requiredParameters) { paramNames.add(NamedObjectId.newBuilder().setName(p.getQualifiedName()).build()); } try { prm.addRequest(paramNames, this); } catch(InvalidIdentification e) { throw new RuntimeException("Could not register dependencies for alarms", e); } } notifyStarted(); } @Override public void doStop() { notifyStopped(); } @Override public void updateItems(int subscriptionId, ArrayList<ParameterValueWithId> items) { // Nothing. The real business of sending events, happens while checking the alarms // because that's where we have easy access to the XTCE definition of the active // alarm. The PRM is only used to signal the parameter subscriptions. } /** * Sends an event if an alarm condition for the active context has been * triggered <tt>minViolations</tt> times. This configuration does not * affect events for parameters that go back to normal, or that change * severity levels while the alarm is already active. */ public void reportNumericParameterEvent(ParameterValue pv, AlarmType alarmType, int minViolations) { boolean sendUpdateEvent=false; if(alarmType.getAlarmReportType()==AlarmReportType.ON_VALUE_CHANGE) { ParameterValue oldPv=lastValuePerParameter.get(pv.def); if(oldPv!=null && hasChanged(oldPv, pv)) { sendUpdateEvent=true; } lastValuePerParameter.put(pv.def, pv); } if(pv.getMonitoringResult()==MonitoringResult.IN_LIMITS) { if(activeAlarms.containsKey(pv.getParameter())) { eventProducer.sendInfo("NORMAL", "Parameter "+pv.getParameter().getQualifiedName()+" is back to normal"); activeAlarms.remove(pv.getParameter()); } } else { // out of limits MonitoringResult previousMonitoringResult=null; ActiveAlarm activeAlarm=activeAlarms.get(pv.getParameter()); if(activeAlarm==null || activeAlarm.alarmType!=alarmType) { activeAlarm=new ActiveAlarm(alarmType, pv.getMonitoringResult()); } else { previousMonitoringResult=activeAlarm.monitoringResult; activeAlarm.monitoringResult=pv.getMonitoringResult(); activeAlarm.violations++; } if(activeAlarm.violations==minViolations || (activeAlarm.violations>minViolations && previousMonitoringResult!=activeAlarm.monitoringResult)) { sendUpdateEvent=true; } activeAlarms.put(pv.getParameter(), activeAlarm); } if(sendUpdateEvent) { sendValueChangeEvent(pv); } } public void reportEnumeratedParameterEvent(ParameterValue pv, AlarmType alarmType, int minViolations) { boolean sendUpdateEvent=false; if(alarmType.getAlarmReportType()==AlarmReportType.ON_VALUE_CHANGE) { ParameterValue oldPv=lastValuePerParameter.get(pv.def); if(oldPv!=null && hasChanged(oldPv, pv)) { sendUpdateEvent=true; } lastValuePerParameter.put(pv.def, pv); } if(pv.getMonitoringResult()==MonitoringResult.IN_LIMITS) { if(activeAlarms.containsKey(pv.getParameter())) { eventProducer.sendInfo("NORMAL", "Parameter "+pv.getParameter().getQualifiedName()+" is back to a normal state ("+pv.getEngValue().getStringValue()+")"); activeAlarms.remove(pv.getParameter()); } } else { // out of limits MonitoringResult previousMonitoringResult=null; ActiveAlarm activeAlarm=activeAlarms.get(pv.getParameter()); if(activeAlarm==null || activeAlarm.alarmType!=alarmType) { activeAlarm=new ActiveAlarm(alarmType, pv.getMonitoringResult()); } else { previousMonitoringResult=activeAlarm.monitoringResult; activeAlarm.monitoringResult=pv.getMonitoringResult(); activeAlarm.violations++; } if(activeAlarm.violations==minViolations || (activeAlarm.violations>minViolations&& previousMonitoringResult!=activeAlarm.monitoringResult)) { sendUpdateEvent=true; } activeAlarms.put(pv.getParameter(), activeAlarm); } if(sendUpdateEvent) { sendStateChangeEvent(pv); } } private void sendValueChangeEvent(ParameterValue pv) { switch(pv.getMonitoringResult()) { case WATCH_LOW: case WARNING_LOW: eventProducer.sendWarning(pv.getMonitoringResult().toString(), "Parameter "+pv.getParameter().getQualifiedName()+" is too low"); break; case WATCH_HIGH: case WARNING_HIGH: eventProducer.sendWarning(pv.getMonitoringResult().toString(), "Parameter "+pv.getParameter().getQualifiedName()+" is too high"); break; case DISTRESS_LOW: case CRITICAL_LOW: case SEVERE_LOW: eventProducer.sendError(pv.getMonitoringResult().toString(), "Parameter "+pv.getParameter().getQualifiedName()+" is too low"); break; case DISTRESS_HIGH: case CRITICAL_HIGH: case SEVERE_HIGH: eventProducer.sendError(pv.getMonitoringResult().toString(), "Parameter "+pv.getParameter().getQualifiedName()+" is too high"); break; case IN_LIMITS: eventProducer.sendInfo(pv.getMonitoringResult().toString(), "Parameter "+pv.getParameter().getQualifiedName()+" has changed to value "+StringConvertors.toString(pv.getEngValue(), false)); break; default: throw new IllegalStateException("Unexpected monitoring result: "+pv.getMonitoringResult()); } } private void sendStateChangeEvent(ParameterValue pv) { switch(pv.getMonitoringResult()) { case WATCH: case WARNING: eventProducer.sendWarning(pv.getMonitoringResult().toString(), "Parameter "+pv.getParameter().getQualifiedName()+" transitioned to state "+pv.getEngValue().getStringValue()); break; case DISTRESS: case CRITICAL: case SEVERE: eventProducer.sendError(pv.getMonitoringResult().toString(), "Parameter "+pv.getParameter().getQualifiedName()+" transitioned to state "+pv.getEngValue().getStringValue()); break; case IN_LIMITS: eventProducer.sendInfo(pv.getMonitoringResult().toString(), "Parameter "+pv.getParameter().getQualifiedName()+" transitioned to state "+pv.getEngValue().getStringValue()); break; default: throw new IllegalStateException("Unexpected monitoring result: "+pv.getMonitoringResult()); } } private boolean hasChanged(ParameterValue pvOld, ParameterValue pvNew) { // Crude string value comparison. return !StringConvertors.toString(pvOld.getEngValue(), false) .equals(StringConvertors.toString(pvNew.getEngValue(), false)); } private static class ActiveAlarm { MonitoringResult monitoringResult; AlarmType alarmType; int violations=1; ParameterValue lastValue; ActiveAlarm(AlarmType alarmType, MonitoringResult monitoringResult) { this.alarmType=alarmType; this.monitoringResult=monitoringResult; } } }