code
stringlengths
3
1.05M
repo_name
stringlengths
5
104
path
stringlengths
4
251
language
stringclasses
1 value
license
stringclasses
15 values
size
int64
3
1.05M
# System imports import os from os.path import join import pytest from PyGitUp.git_wrapper import GitError from PyGitUp.tests import basepath test_name = 'git-not-in-path' repo_path = join(basepath, test_name + os.sep) def setup(): os.makedirs(repo_path, 0o700) def test_not_a_git_repo(): """ Run 'git up' with git no being in PATH """ os.chdir(repo_path) environ = os.environ.copy() os.environ['PATH'] = '' try: with pytest.raises(GitError, match="The git executable could not be " "found"): from PyGitUp.gitup import GitUp GitUp(testing=True) finally: os.environ.update(environ)
msiemens/PyGitUp
PyGitUp/tests/test_git_not_in_path.py
Python
mit
701
""" This script allows you to delete articles in bulk from a query or from a csv. If you provide a csv, you may also provide a second column containing the delete action, which may be one of: * delete - actually delete the article * remove_doi - keep the article, but remove its DOI * remove_fulltext - keep the article, but remove its Fulltext URLs """ from portality import models import json, csv from portality.core import app from portality import constants def remove_doi(article_id): article = models.Article.pull(article_id) try: # first ensure that it has a fulltext fts = article.bibjson().get_urls(urltype=constants.LINK_TYPE_FULLTEXT) if len(fts) > 0: article.bibjson().remove_identifiers(idtype=constants.IDENT_TYPE_DOI) article.save() else: print("WARN: could not remove DOI from {0} as it has no fulltext URL".format(article_id)) except AttributeError as e: print("ERROR: could not remove DOI from {0}: {1}".format(article_id, str(e))) def remove_fulltext(article_id): article = models.Article.pull(article_id) try: # first ensure it has a DOI dois = article.bibjson().get_identifiers(idtype=constants.IDENT_TYPE_DOI) if len(dois) > 0: article.bibjson().remove_urls(urltype=constants.LINK_TYPE_FULLTEXT) article.save() else: print("WARN: could not remove Fulltext from {0} as it has no DOI".format(article_id)) except AttributeError as e: print("ERROR: could not remove fulltext from {0}: {1}".format(article_id, str(e))) if __name__ == "__main__": if app.config.get("SCRIPTS_READ_ONLY_MODE", False): print("System is in READ-ONLY mode, script cannot run") exit(1) import argparse parser = argparse.ArgumentParser() parser.add_argument("-u", "--username", help="username of user whose articles to remove.") parser.add_argument("-g", "--ghost", help="specify if you want the articles being deleted not to be snapshot", action="store_true") parser.add_argument("-q", "--query", help="file page of json document containing delete-by query") parser.add_argument("-ip", "--ignore-paging", help="ignore the from: and size: parameters in a query object", action="store_true") parser.add_argument("-c", "--csv", help="csv containing article ids to remove") args = parser.parse_args() if not args.username and not args.query and not args.csv: print("Please specify a username with the -u option, or a query file with the -q option, or a csv with the -c option") exit(1) exclusives = 0 if args.username: exclusives += 1 if args.query: exclusives += 1 if args.csv: exclusives += 1 if exclusives > 1: print("You may only specify a username, a query or a csv alone, not combinations.") exit(1) snapshot = not args.ghost if args.username is not None: models.Article.delete_selected(owner=args.username, snapshot=snapshot) print("Articles deleted") elif args.query is not None: f = open(args.query) query = json.loads(f.read()) if args.ignore_paging: try: del query['from'] del query['size'] except KeyError: pass if 'sort' in query: print('You can\'t have "sort" in the query, it breaks ES delete by query. Removing your sort.') del query['sort'] res = models.Article.query(q=query) total = res.get("hits", {}).get("total", {}).get('value', 0) # NOTE: if you have paging, like from: and size: in a query, the # hits['total'] will show you all results that match the query, # not just the articles that will actually be deleted (which # will be just the page of results specified by from: and size:). go_on = input("This will delete " + str(total) + " articles. Are you sure? [Y/N]:") if go_on.lower() == "y": models.Article.delete_selected(query=query, snapshot=snapshot) print("Articles deleted") else: print("Aborted") elif args.csv is not None: with open(args.csv) as f: reader = csv.reader(f) for row in reader: article_id = row[0] action = "delete" if len(row) > 1: action = row[1] if action == "delete": models.Article.remove_by_id(article_id) elif action == "remove_doi": remove_doi(article_id) elif action == "remove_fulltext": remove_fulltext(article_id)
DOAJ/doaj
portality/scripts/articlerm.py
Python
apache-2.0
4,752
#!/usr/bin/python #Targets: create screen, load image to surface, move surface on the screen until any key is pressed import pygame import time pygame.init() screen_size=(640,480) disp=pygame.display.set_mode(screen_size) face=pygame.image.load('1.png').convert() default_font=pygame.font.get_default_font() font=pygame.font.SysFont(default_font,32) msg=font.render("Press SPACE to exit",True,(250,230,210,127)) noface=face.__copy__() noface.fill((0,0,0,0)) disp.fill((0,0,0,0)) x=0 y=0 alpha=0 while(True): begin=time.time() #remove previous face disp.blit(noface,(x,y)) #calc new position and alpha x=(x+(screen_size[0]/100))%screen_size[0] y=(y+(screen_size[1]/100))%screen_size[1] alpha=(alpha+1)%256 face.set_alpha(alpha) disp.blit(face,(x,y)) #message here disp.blit(msg,(0,0)) pygame.display.update() pygame.event.pump() if pygame.key.get_pressed()[pygame.K_SPACE]: break time.sleep(max(0.001,time.time()-begin+0.02))
amarao/fun_came
learn/pygame_learn/pygame_1st.py
Python
gpl-3.0
1,000
from datetime import datetime import mock import pytz import time import urllib2 import zeit.cms.checkout.interfaces import zeit.cms.testing import zope.app.locking.lockinfo class TimeFreezeLockInfo(zope.app.locking.lockinfo.LockInfo): def __init__(self, *args, **kw): super(TimeFreezeLockInfo, self).__init__(*args, **kw) self.created = time.mktime( datetime(2019, 4, 15, 18, 20, tzinfo=pytz.UTC).timetuple()) class LockAPI(zeit.cms.testing.ZeitCmsBrowserTestCase): def setUp(self): super(LockAPI, self).setUp() # API is available without authentication self.browser = zeit.cms.testing.Browser() def test_status_200_for_unlocked(self): b = self.browser b.open('http://localhost/@@lock_status' '?uniqueId=http://xml.zeit.de/testcontent') self.assertEqual('200 Ok', b.headers['Status']) self.assert_json({'locked': False, 'owner': None, 'until': None}) def test_status_409_for_locked(self): with mock.patch('zope.app.locking.adapter.LockInfo', new=TimeFreezeLockInfo): zeit.cms.checkout.interfaces.ICheckoutManager( self.repository['testcontent']).checkout() b = self.browser with self.assertRaises(urllib2.HTTPError) as info: b.open('http://localhost/@@lock_status' '?uniqueId=http://xml.zeit.de/testcontent') self.assertEqual(409, info.exception.status) self.assert_json({'locked': True, 'owner': 'zope.user', 'until': '2019-04-15T18:20:00+00:00'}) def test_resolves_uuid(self): b = self.browser # mock connector search() always returns # http://xml.zeit.de/online/2007/01/Somalia b.open('http://localhost/@@lock_status?uuid=dummy') self.assertEqual('200 Ok', b.headers['Status']) def test_status_404_for_nonexistent(self): b = self.browser with self.assertRaises(urllib2.HTTPError) as info: b.open('http://localhost/@@lock_status' '?uniqueId=http://xml.zeit.de/nonexistent') self.assertEqual(404, info.exception.status) with self.assertRaises(urllib2.HTTPError) as info: with mock.patch('zeit.connector.mock.Connector.search') as search: search.return_value = None b.open('http://localhost/@@lock_status?uuid=dummy') self.assertEqual(404, info.exception.status)
ZeitOnline/zeit.cms
src/zeit/cms/locking/browser/tests/test_lock.py
Python
bsd-3-clause
2,514
import hildon import gtk import pge_window import cPickle import pge_window import os class Prefs(): def __init__(self): self.prefs_dict = {} def load(self): try: f = open(os.path.expanduser("~")+"/.pygtkeditor",'r') self.prefs_dict = cPickle.load(f) if not self.prefs_dict.has_key('auto_rotate'): self.prefs_dict['auto_rotate']=True if not self.prefs_dict.has_key('show_lines'): self.prefs_dict['show_lines']=False if not self.prefs_dict.has_key('indent'): self.prefs_dict['indent']=' ' if not self.prefs_dict.has_key('auto_clean_line_end'): self.prefs_dict['auto_clean_line_end']=False if not self.prefs_dict.has_key('theme'): self.prefs_dict['theme']='default' except: self.default() def default(self): self.prefs_dict['hildon_text_completion']=True self.prefs_dict['default_language']='python' self.prefs_dict['font_name']='Monospace' self.prefs_dict['font_size']='12' self.prefs_dict['auto_rotate']=True self.prefs_dict['show_lines']=False self.prefs_dict['indent']=' ' self.prefs_dict['auto_clean_line_end']=False def store(self): f = open(os.path.expanduser("~")+"/.pygtkeditor",'w') prefs = cPickle.dump(self.prefs_dict,f) def edit(self,parent_window): dialog = gtk.Dialog('PyGTKEditor - Settings',parent_window,gtk.DIALOG_DESTROY_WITH_PARENT,(gtk.STOCK_OK,gtk.RESPONSE_ACCEPT)) #hildon_text_completion w_hildon_text_completion = hildon.CheckButton(gtk.HILDON_SIZE_AUTO) w_hildon_text_completion.set_label('Hildon Text Completion') if self.prefs_dict.has_key('hildon_text_completion'): w_hildon_text_completion.set_active((self.prefs_dict['hildon_text_completion']==True)) #show lines numbers w_show_lines = hildon.CheckButton(gtk.HILDON_SIZE_AUTO) w_show_lines.set_label('Show lines numbers') if self.prefs_dict.has_key('show_lines'): w_show_lines.set_active((self.prefs_dict['show_lines']==True)) #auto clean line end w_auto_clean_line_end = hildon.CheckButton(gtk.HILDON_SIZE_AUTO) w_auto_clean_line_end.set_label('Auto clean line end (on save)') if self.prefs_dict.has_key('auto_clean_line_end'): w_auto_clean_line_end.set_active((self.prefs_dict['auto_clean_line_end']==True)) #auto_rotate w_auto_rotate = hildon.CheckButton(gtk.HILDON_SIZE_AUTO) w_auto_rotate.set_label('Auto Portrait Mode') if self.prefs_dict.has_key('auto_rotate'): w_auto_rotate.set_active((self.prefs_dict['auto_rotate']==True)) #default_language w_default_language = hildon.PickerButton(gtk.HILDON_SIZE_AUTO, hildon.BUTTON_ARRANGEMENT_VERTICAL) w_default_language.set_title("Default Language") w_default_language_selector = hildon.TouchSelectorEntry(text=True) languages = ['None'] print self.prefs_dict['default_language'] for ext,language in pge_window.LANGUAGES: languages.append(language) for language in languages: w_default_language_selector.append_text(language) w_default_language.set_selector(w_default_language_selector) if self.prefs_dict.has_key('default_language'): w_default_language.set_active(languages.index(self.prefs_dict['default_language'])) #Font Button w_font = hildon.PickerButton(gtk.HILDON_SIZE_AUTO, hildon.BUTTON_ARRANGEMENT_VERTICAL) w_font.set_title("Font") w_font_selector = hildon.TouchSelectorEntry(text=True) c = parent_window.create_pango_context() families = c.list_families() font_names = [] for f in families: font_names.append(f.get_name()) for f in font_names: w_font_selector.append_text(f) w_font.set_selector(w_font_selector) if self.prefs_dict.has_key('font_name'): w_font.set_active(font_names.index(self.prefs_dict['font_name'])) w_font.set_value(self.prefs_dict['font_name']) #Font Size Button w_font_size = hildon.PickerButton(gtk.HILDON_SIZE_AUTO, hildon.BUTTON_ARRANGEMENT_VERTICAL) w_font_size.set_title("Size") w_font_size_selector = hildon.TouchSelectorEntry(text=True) font_sizes = [] for f in range(7,49): font_sizes.append(str(f)) for f in font_sizes: w_font_size_selector.append_text(f) w_font_size.set_selector(w_font_size_selector) if self.prefs_dict.has_key('font_size'): w_font_size.set_active(font_sizes.index(self.prefs_dict['font_size'])) w_font_size.set_value(self.prefs_dict['font_size']) #Indent Button w_indent = hildon.PickerButton(gtk.HILDON_SIZE_AUTO, hildon.BUTTON_ARRANGEMENT_VERTICAL) w_indent.set_title("Indent Style") w_indent_selector = hildon.TouchSelectorEntry(text=True) indent_style = ['2 spaces','4 spaces','Tabulation'] indent_value = [' ',' ','\t'] for i in range(3): w_indent_selector.append_text(indent_style[i]) w_indent.set_selector(w_indent_selector) if self.prefs_dict.has_key('indent'): print self.prefs_dict['indent'] w_indent.set_active(indent_value.index(self.prefs_dict['indent'])) w_indent.set_value(indent_style[indent_value.index(self.prefs_dict['indent'])]) else: w_indent.set_active(0) w_indent.set_value(indent_style[0]) #Theme Button w_theme = hildon.PickerButton(gtk.HILDON_SIZE_AUTO, hildon.BUTTON_ARRANGEMENT_VERTICAL) w_theme.set_title("Syntax Hilight Theme") w_theme_selector = hildon.TouchSelectorEntry(text=True) theme_list = ['default','dark',] for i in theme_list : w_theme_selector.append_text(i) w_theme.set_selector(w_theme_selector) if self.prefs_dict.has_key('theme'): w_theme.set_active(theme_list.index(self.prefs_dict['theme'])) w_theme.set_value(self.prefs_dict['theme']) else: w_theme.set_active(0) w_theme.set_value(theme_list[0]) p2 = hildon.PannableArea() p = gtk.VBox() # dialog.vbox.add(w_hildon_text_completion) # dialog.vbox.add(w_show_lines) # dialog.vbox.add(w_auto_rotate) # dialog.vbox.add(w_default_language) # hbox = gtk.HBox() # hbox.add(w_font) # hbox.add(w_font_size) # dialog.vbox.add(hbox) # dialog.vbox.add(w_indent) # dialog.vbox.add(w_auto_clean_line_end) p.add(w_hildon_text_completion) p.add(w_show_lines) p.add(w_auto_rotate) p.add(w_default_language) hbox = gtk.HBox() hbox.add(w_font) hbox.add(w_font_size) p.add(hbox) p.add(w_indent) p.add(w_auto_clean_line_end) p.add(w_theme) p2.set_size_request(-1,300) p2.add_with_viewport(p) dialog.vbox.add(p2) # p1 = hildon.PannableArea() #p1.set_size_request(600,400) # p1.add(vbox) # dialog.get_child().get_child().add(p1) # dialog.vbox.add(p1) dialog.show_all() if(dialog.run()==gtk.RESPONSE_ACCEPT): self.prefs_dict['hildon_text_completion']=w_hildon_text_completion.get_active() self.prefs_dict['auto_rotate']=w_auto_rotate.get_active() self.prefs_dict['show_lines']=w_show_lines.get_active() self.prefs_dict['default_language']= w_default_language_selector.get_current_text() self.prefs_dict['font_name']= w_font_selector.get_current_text() self.prefs_dict['font_size']= w_font_size_selector.get_current_text() self.prefs_dict['indent']= indent_value[w_indent_selector.get_active(0)] self.prefs_dict['auto_clean_line_end']=w_auto_clean_line_end.get_active() self.prefs_dict['theme']= w_theme_selector.get_current_text() self.store() parent_window._parent.apply_prefs() dialog.destroy() if __name__ == "__main__": prefs = Prefs() prefs.load() prefs.edit(hildon.Window())
khertan/PyGTKEditor
pge_preferences.py
Python
gpl-3.0
7,831
# pylint: skip-file # flake8: noqa class Repoquery(RepoqueryCLI): ''' Class to wrap the repoquery ''' # pylint: disable=too-many-arguments,too-many-instance-attributes def __init__(self, name, query_type, show_duplicates, match_version, ignore_excluders, verbose): ''' Constructor for YumList ''' super(Repoquery, self).__init__(None) self.name = name self.query_type = query_type self.show_duplicates = show_duplicates self.match_version = match_version self.ignore_excluders = ignore_excluders self.verbose = verbose if self.match_version: self.show_duplicates = True self.query_format = "%{version}|%{release}|%{arch}|%{repo}|%{version}-%{release}" self.tmp_file = None def build_cmd(self): ''' build the repoquery cmd options ''' repo_cmd = [] repo_cmd.append("--pkgnarrow=" + self.query_type) repo_cmd.append("--queryformat=" + self.query_format) if self.show_duplicates: repo_cmd.append('--show-duplicates') if self.ignore_excluders: repo_cmd.append('--config=' + self.tmp_file.name) repo_cmd.append(self.name) return repo_cmd @staticmethod def process_versions(query_output): ''' format the package data into something that can be presented ''' version_dict = defaultdict(dict) for version in query_output.decode().split('\n'): pkg_info = version.split("|") pkg_version = {} pkg_version['version'] = pkg_info[0] pkg_version['release'] = pkg_info[1] pkg_version['arch'] = pkg_info[2] pkg_version['repo'] = pkg_info[3] pkg_version['version_release'] = pkg_info[4] version_dict[pkg_info[4]] = pkg_version return version_dict def format_versions(self, formatted_versions): ''' Gather and present the versions of each package ''' versions_dict = {} versions_dict['available_versions_full'] = list(formatted_versions.keys()) # set the match version, if called if self.match_version: versions_dict['matched_versions_full'] = [] versions_dict['requested_match_version'] = self.match_version versions_dict['matched_versions'] = [] # get the "full version (version - release) versions_dict['available_versions_full'].sort(key=LooseVersion) versions_dict['latest_full'] = versions_dict['available_versions_full'][-1] # get the "short version (version) versions_dict['available_versions'] = [] for version in versions_dict['available_versions_full']: versions_dict['available_versions'].append(formatted_versions[version]['version']) if self.match_version: if version.startswith(self.match_version): versions_dict['matched_versions_full'].append(version) versions_dict['matched_versions'].append(formatted_versions[version]['version']) versions_dict['available_versions'].sort(key=LooseVersion) versions_dict['latest'] = versions_dict['available_versions'][-1] # finish up the matched version if self.match_version: if versions_dict['matched_versions_full']: versions_dict['matched_version_found'] = True versions_dict['matched_versions'].sort(key=LooseVersion) versions_dict['matched_version_latest'] = versions_dict['matched_versions'][-1] versions_dict['matched_version_full_latest'] = versions_dict['matched_versions_full'][-1] else: versions_dict['matched_version_found'] = False versions_dict['matched_versions'] = [] versions_dict['matched_version_latest'] = "" versions_dict['matched_version_full_latest'] = "" return versions_dict def repoquery(self): '''perform a repoquery ''' if self.ignore_excluders: # Duplicate yum.conf and reset exclude= line to an empty string # to clear a list of all excluded packages self.tmp_file = tempfile.NamedTemporaryFile() with open("/etc/yum.conf", "r") as file_handler: yum_conf_lines = file_handler.readlines() yum_conf_lines = [l for l in yum_conf_lines if not l.startswith("exclude=")] with open(self.tmp_file.name, "w") as file_handler: file_handler.writelines(yum_conf_lines) file_handler.flush() repoquery_cmd = self.build_cmd() rval = self._repoquery_cmd(repoquery_cmd, True, 'raw') # check to see if there are actual results rval['package_name'] = self.name if rval['results']: processed_versions = Repoquery.process_versions(rval['results'].strip()) formatted_versions = self.format_versions(processed_versions) rval['package_found'] = True rval['versions'] = formatted_versions if self.verbose: rval['raw_versions'] = processed_versions else: del rval['results'] # No packages found else: rval['package_found'] = False if self.ignore_excluders: self.tmp_file.close() return rval @staticmethod def run_ansible(params, check_mode): '''run the ansible idempotent code''' repoquery = Repoquery( params['name'], params['query_type'], params['show_duplicates'], params['match_version'], params['ignore_excluders'], params['verbose'], ) state = params['state'] if state == 'list': results = repoquery.repoquery() if results['returncode'] != 0: return {'failed': True, 'msg': results} return {'changed': False, 'results': results, 'state': 'list', 'check_mode': check_mode} return {'failed': True, 'changed': False, 'msg': 'Unknown state passed. %s' % state, 'state': 'unknown'}
ewolinetz/openshift-ansible
roles/lib_utils/src/class/repoquery.py
Python
apache-2.0
6,322
# Copyright (c) 2015, Frappe Technologies Pvt. Ltd. and Contributors # MIT License. See license.txt from __future__ import unicode_literals import frappe import json from frappe.utils import cstr from frappe import _ from frappe.model.document import Document class CustomField(Document): def autoname(self): self.set_fieldname() self.name = self.dt + "-" + self.fieldname def set_fieldname(self): if not self.fieldname: if not self.label: frappe.throw(_("Label is mandatory")) # remove special characters from fieldname self.fieldname = filter(lambda x: x.isdigit() or x.isalpha() or '_', cstr(self.label).lower().replace(' ','_')) # fieldnames should be lowercase self.fieldname = self.fieldname.lower() def validate(self): meta = frappe.get_meta(self.dt) fieldnames = [df.fieldname for df in meta.get("fields")] if self.insert_after and self.insert_after in fieldnames: self.idx = fieldnames.index(self.insert_after) + 1 if not self.idx: self.idx = len(fieldnames) + 1 self._old_fieldtype = self.db_get('fieldtype') if not self.fieldname: frappe.throw(_("Fieldname not set for Custom Field")) def on_update(self): frappe.clear_cache(doctype=self.dt) if not self.flags.ignore_validate: # validate field from frappe.core.doctype.doctype.doctype import validate_fields_for_doctype validate_fields_for_doctype(self.dt) # update the schema if not frappe.db.get_value('DocType', self.dt, 'issingle'): if (self.fieldname not in frappe.db.get_table_columns(self.dt) or getattr(self, "_old_fieldtype", None) != self.fieldtype): from frappe.model.db_schema import updatedb updatedb(self.dt) def on_trash(self): # delete property setter entries frappe.db.sql("""\ DELETE FROM `tabProperty Setter` WHERE doc_type = %s AND field_name = %s""", (self.dt, self.fieldname)) frappe.clear_cache(doctype=self.dt) def validate_insert_after(self, meta): if not meta.get_field(self.insert_after): frappe.throw(_("Insert After field '{0}' mentioned in Custom Field '{1}', with label '{2}', does not exist") .format(self.insert_after, self.name, self.label), frappe.DoesNotExistError) if self.fieldname == self.insert_after: frappe.throw(_("Insert After cannot be set as {0}").format(meta.get_label(self.insert_after))) @frappe.whitelist() def get_fields_label(doctype=None): return [{"value": df.fieldname or "", "label": _(df.label or "")} for df in frappe.get_meta(doctype).get("fields")] def create_custom_field_if_values_exist(doctype, df): df = frappe._dict(df) if df.fieldname in frappe.db.get_table_columns(doctype) and \ frappe.db.sql("""select count(*) from `tab{doctype}` where ifnull({fieldname},'')!=''""".format(doctype=doctype, fieldname=df.fieldname))[0][0]: create_custom_field(doctype, df) def create_custom_field(doctype, df): df = frappe._dict(df) if not frappe.db.get_value("Custom Field", {"dt": doctype, "fieldname": df.fieldname}): frappe.get_doc({ "doctype":"Custom Field", "dt": doctype, "permlevel": df.permlevel or 0, "label": df.label, "fieldname": df.fieldname or df.label.lower().replace(' ', '_'), "fieldtype": df.fieldtype, "options": df.options, "insert_after": df.insert_after, "print_hide": df.print_hide, "hidden": df.hidden or 0 }).insert() @frappe.whitelist() def add_custom_field(doctype, df): df = json.loads(df) return create_custom_field(doctype, df)
rohitwaghchaure/frappe
frappe/custom/doctype/custom_field/custom_field.py
Python
mit
3,459
tabby_cat = "\tI'm tabbed in." persian_cat = "I'm split\non a line." backslash_cat = "I'm \\ a \\ cat." fat_cat = ''' I'll do a list: \t* Cat food \t* Fishes \t* Catnip\n\t* Grass''' print tabby_cat + "\n" + persian_cat print backslash_cat print fat_cat
srinivasanmit/all-in-all
1/ex10.py
Python
gpl-3.0
255
# Copyright (c) 2014 Rackspace, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or # implied. # See the License for the specific language governing permissions and # limitations under the License. import logging import urlparse from tempest_lib.common.utils import data_utils from tempest_lib import decorators from tempest.api.messaging import base from tempest import config from tempest import test LOG = logging.getLogger(__name__) CONF = config.CONF class TestClaims(base.BaseMessagingTest): @classmethod def resource_setup(cls): super(TestClaims, cls).resource_setup() cls.queue_name = data_utils.rand_name('Queues-Test') # Create Queue cls.create_queue(cls.queue_name) def _post_and_claim_messages(self, queue_name, repeat=1): # Post Messages message_body = self.generate_message_body(repeat=repeat) self.client.post_messages(queue_name=self.queue_name, rbody=message_body) # Post Claim claim_ttl = data_utils.rand_int_id(start=60, end=CONF.messaging.max_claim_ttl) claim_grace = data_utils.\ rand_int_id(start=60, end=CONF.messaging.max_claim_grace) claim_body = {"ttl": claim_ttl, "grace": claim_grace} resp, body = self.client.post_claims(queue_name=self.queue_name, rbody=claim_body) return resp, body @test.attr(type='smoke') @test.idempotent_id('936cb1ca-b7af-44dd-a752-805e8c98156f') def test_post_claim(self): _, body = self._post_and_claim_messages(queue_name=self.queue_name) claimed_message_uri = body[0]['href'] # Skipping this step till bug-1331517 is fixed # Get posted claim # self.client.query_claim(claimed_message_uri) # Delete Claimed message self.client.delete_messages(claimed_message_uri) @decorators.skip_because(bug="1331517") @test.attr(type='smoke') @test.idempotent_id('84e491f4-68c6-451f-9846-b8f868eb27c5') def test_query_claim(self): # Post a Claim resp, body = self._post_and_claim_messages(queue_name=self.queue_name) # Query Claim claim_uri = resp['location'] self.client.query_claim(claim_uri) # Delete Claimed message claimed_message_uri = body[0]['href'] self.delete_messages(claimed_message_uri) @decorators.skip_because(bug="1328111") @test.attr(type='smoke') @test.idempotent_id('420ef0c5-9bd6-4b82-b06d-d9da330fefd3') def test_update_claim(self): # Post a Claim resp, body = self._post_and_claim_messages(queue_name=self.queue_name) claim_uri = resp['location'] claimed_message_uri = body[0]['href'] # Update Claim claim_ttl = data_utils.rand_int_id(start=60, end=CONF.messaging.max_claim_ttl) update_rbody = {"ttl": claim_ttl} self.client.update_claim(claim_uri, rbody=update_rbody) # Verify claim ttl >= updated ttl value _, body = self.client.query_claim(claim_uri) updated_claim_ttl = body["ttl"] self.assertTrue(updated_claim_ttl >= claim_ttl) # Delete Claimed message self.client.delete_messages(claimed_message_uri) @test.attr(type='smoke') @test.idempotent_id('fd4c7921-cb3f-4ed8-9ac8-e8f1e74c44aa') def test_release_claim(self): # Post a Claim resp, body = self._post_and_claim_messages(queue_name=self.queue_name) claim_uri = resp['location'] # Release Claim self.client.release_claim(claim_uri) # Delete Claimed message # This will implicitly verify that the claim is deleted. message_uri = urlparse.urlparse(claim_uri).path self.client.delete_messages(message_uri) @classmethod def resource_cleanup(cls): cls.delete_queue(cls.queue_name) super(TestClaims, cls).resource_cleanup()
fengbeihong/tempest_automate_ironic
tempest/api/messaging/test_claims.py
Python
apache-2.0
4,431
# Copyright 2017 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== r"""Convert PASCAL-like xml dataset to TFRecord for object_detection. Example usage: python object_detection/dataset_tools/create_pascal_tf_record.py \ --data_dir=/home/user/VOCdevkit \ --year=VOC2012 \ --output_path=/home/user/pascal.record """ from __future__ import absolute_import from __future__ import division from __future__ import print_function import hashlib import io import logging import os import glob from lxml import etree import PIL.Image import tensorflow as tf from object_detection.utils import dataset_util from object_detection.utils import label_map_util flags = tf.app.flags flags.DEFINE_string('annotations_dir', 'annotations', 'path to annotations xml directory.') flags.DEFINE_string('label_map_path', 'data/pascal_label_map.pbtxt', 'Path to label map proto') flags.DEFINE_boolean('ignore_difficult_instances', False, 'Whether to ignore difficult instances') flags.DEFINE_string('output_path', 'out.tfrecord', 'Path to output TFRecord') FLAGS = flags.FLAGS def dict_to_tf_example(data, label_map_dict, ignore_difficult_instances=False): """Convert XML derived dict to tf.Example proto. Notice that this function normalizes the bounding box coordinates provided by the raw data. Args: data: dict holding PASCAL XML fields for a single image (obtained by running dataset_util.recursive_parse_xml_to_dict) label_map_dict: A map from string label names to integers ids. ignore_difficult_instances: Whether to skip difficult instances in the dataset (default: False). Returns: example: The converted tf.Example. Raises: ValueError: if the image pointed to by data['filename'] is not a valid JPEG """ full_path = data['path'] with tf.gfile.GFile(full_path, 'rb') as fid: encoded_jpg = fid.read() encoded_jpg_io = io.BytesIO(encoded_jpg) image = PIL.Image.open(encoded_jpg_io) if image.format != 'JPEG' and image.format != 'PNG': print('image format:', image.format) raise ValueError('Image format not JPEG or PNG') key = hashlib.sha256(encoded_jpg).hexdigest() width = int(data['size']['width']) height = int(data['size']['height']) xmin = [] ymin = [] xmax = [] ymax = [] classes = [] classes_text = [] truncated = [] poses = [] difficult_obj = [] if 'object' in data: for obj in data['object']: difficult = bool(int(obj['difficult'])) if ignore_difficult_instances and difficult: continue difficult_obj.append(int(difficult)) area = (float(obj['bndbox']['xmax']) - float(obj['bndbox']['xmin'])) * (float(obj['bndbox']['ymax']) - float(obj['bndbox']['ymin'])) if area < (width*height) / (16*16): print('bndbox too small, skipping..', full_path) continue xmin.append(float(obj['bndbox']['xmin']) / width) ymin.append(float(obj['bndbox']['ymin']) / height) xmax.append(float(obj['bndbox']['xmax']) / width) ymax.append(float(obj['bndbox']['ymax']) / height) classes_text.append(obj['name'].encode('utf8')) classes.append(label_map_dict[obj['name']]) truncated.append(int(obj['truncated'])) poses.append(obj['pose'].encode('utf8')) example = tf.train.Example(features=tf.train.Features(feature={ 'image/height': dataset_util.int64_feature(height), 'image/width': dataset_util.int64_feature(width), 'image/filename': dataset_util.bytes_feature( data['filename'].encode('utf8')), 'image/source_id': dataset_util.bytes_feature( data['filename'].encode('utf8')), 'image/key/sha256': dataset_util.bytes_feature(key.encode('utf8')), 'image/encoded': dataset_util.bytes_feature(encoded_jpg), 'image/format': dataset_util.bytes_feature('jpeg'.encode('utf8')), 'image/object/bbox/xmin': dataset_util.float_list_feature(xmin), 'image/object/bbox/xmax': dataset_util.float_list_feature(xmax), 'image/object/bbox/ymin': dataset_util.float_list_feature(ymin), 'image/object/bbox/ymax': dataset_util.float_list_feature(ymax), 'image/object/class/text': dataset_util.bytes_list_feature(classes_text), 'image/object/class/label': dataset_util.int64_list_feature(classes), 'image/object/difficult': dataset_util.int64_list_feature(difficult_obj), 'image/object/truncated': dataset_util.int64_list_feature(truncated), 'image/object/view': dataset_util.bytes_list_feature(poses), })) return example def main(_): writer = tf.python_io.TFRecordWriter(FLAGS.output_path) label_map_dict = label_map_util.get_label_map_dict(FLAGS.label_map_path) xmls = glob.glob(FLAGS.annotations_dir + '/*xml') for idx, xml_file in enumerate(xmls): if idx % 100 == 0: logging.info('On image %d of %d', idx, len(xmls)) with tf.gfile.GFile(xml_file, 'r') as fid: xml_str = fid.read() xml = etree.fromstring(xml_str) data = dataset_util.recursive_parse_xml_to_dict(xml)['annotation'] tf_example = dict_to_tf_example(data, label_map_dict, FLAGS.ignore_difficult_instances) writer.write(tf_example.SerializeToString()) writer.close() if __name__ == '__main__': tf.app.run()
grehujt/SmallPythonProjects
object_detection/create_my_pascal_tf_record.py
Python
mit
5,864
#! /usr/bin/env python """Mimification and unmimification of mail messages. Decode quoted-printable parts of a mail message or encode using quoted-printable. Usage: mimify(input, output) unmimify(input, output, decode_base64 = 0) to encode and decode respectively. Input and output may be the name of a file or an open file object. Only a readline() method is used on the input file, only a write() method is used on the output file. When using file names, the input and output file names may be the same. Interactive usage: mimify.py -e [infile [outfile]] mimify.py -d [infile [outfile]] to encode and decode respectively. Infile defaults to standard input and outfile to standard output. """ # Configure MAXLEN = 200 # if lines longer than this, encode as quoted-printable CHARSET = 'ISO-8859-1' # default charset for non-US-ASCII mail QUOTE = '> ' # string replies are quoted with # End configure import re import warnings warnings.warn("the mimify module is deprecated; use the email package instead", DeprecationWarning, 2) __all__ = ["mimify","unmimify","mime_encode_header","mime_decode_header"] qp = re.compile('^content-transfer-encoding:\\s*quoted-printable', re.I) base64_re = re.compile('^content-transfer-encoding:\\s*base64', re.I) mp = re.compile('^content-type:.*multipart/.*boundary="?([^;"\n]*)', re.I|re.S) chrset = re.compile('^(content-type:.*charset=")(us-ascii|iso-8859-[0-9]+)(".*)', re.I|re.S) he = re.compile('^-*\n') mime_code = re.compile('=([0-9a-f][0-9a-f])', re.I) mime_head = re.compile('=\\?iso-8859-1\\?q\\?([^? \t\n]+)\\?=', re.I) repl = re.compile('^subject:\\s+re: ', re.I) class File: """A simple fake file object that knows about limited read-ahead and boundaries. The only supported method is readline().""" def __init__(self, file, boundary): self.file = file self.boundary = boundary self.peek = None def readline(self): if self.peek is not None: return '' line = self.file.readline() if not line: return line if self.boundary: if line == self.boundary + '\n': self.peek = line return '' if line == self.boundary + '--\n': self.peek = line return '' return line class HeaderFile: def __init__(self, file): self.file = file self.peek = None def readline(self): if self.peek is not None: line = self.peek self.peek = None else: line = self.file.readline() if not line: return line if he.match(line): return line while 1: self.peek = self.file.readline() if len(self.peek) == 0 or \ (self.peek[0] != ' ' and self.peek[0] != '\t'): return line line = line + self.peek self.peek = None def mime_decode(line): """Decode a single line of quoted-printable text to 8bit.""" newline = '' pos = 0 while 1: res = mime_code.search(line, pos) if res is None: break newline = newline + line[pos:res.start(0)] + \ chr(int(res.group(1), 16)) pos = res.end(0) return newline + line[pos:] def mime_decode_header(line): """Decode a header line to 8bit.""" newline = '' pos = 0 while 1: res = mime_head.search(line, pos) if res is None: break match = res.group(1) # convert underscores to spaces (before =XX conversion!) match = ' '.join(match.split('_')) newline = newline + line[pos:res.start(0)] + mime_decode(match) pos = res.end(0) return newline + line[pos:] def unmimify_part(ifile, ofile, decode_base64 = 0): """Convert a quoted-printable part of a MIME mail message to 8bit.""" multipart = None quoted_printable = 0 is_base64 = 0 is_repl = 0 if ifile.boundary and ifile.boundary[:2] == QUOTE: prefix = QUOTE else: prefix = '' # read header hfile = HeaderFile(ifile) while 1: line = hfile.readline() if not line: return if prefix and line[:len(prefix)] == prefix: line = line[len(prefix):] pref = prefix else: pref = '' line = mime_decode_header(line) if qp.match(line): quoted_printable = 1 continue # skip this header if decode_base64 and base64_re.match(line): is_base64 = 1 continue ofile.write(pref + line) if not prefix and repl.match(line): # we're dealing with a reply message is_repl = 1 mp_res = mp.match(line) if mp_res: multipart = '--' + mp_res.group(1) if he.match(line): break if is_repl and (quoted_printable or multipart): is_repl = 0 # read body while 1: line = ifile.readline() if not line: return line = re.sub(mime_head, '\\1', line) if prefix and line[:len(prefix)] == prefix: line = line[len(prefix):] pref = prefix else: pref = '' ## if is_repl and len(line) >= 4 and line[:4] == QUOTE+'--' and line[-3:] != '--\n': ## multipart = line[:-1] while multipart: if line == multipart + '--\n': ofile.write(pref + line) multipart = None line = None break if line == multipart + '\n': ofile.write(pref + line) nifile = File(ifile, multipart) unmimify_part(nifile, ofile, decode_base64) line = nifile.peek if not line: # premature end of file break continue # not a boundary between parts break if line and quoted_printable: while line[-2:] == '=\n': line = line[:-2] newline = ifile.readline() if newline[:len(QUOTE)] == QUOTE: newline = newline[len(QUOTE):] line = line + newline line = mime_decode(line) if line and is_base64 and not pref: import base64 line = base64.decodestring(line) if line: ofile.write(pref + line) def unmimify(infile, outfile, decode_base64 = 0): """Convert quoted-printable parts of a MIME mail message to 8bit.""" if type(infile) == type(''): ifile = open(infile) if type(outfile) == type('') and infile == outfile: import os d, f = os.path.split(infile) os.rename(infile, os.path.join(d, ',' + f)) else: ifile = infile if type(outfile) == type(''): ofile = open(outfile, 'w') else: ofile = outfile nifile = File(ifile, None) unmimify_part(nifile, ofile, decode_base64) ofile.flush() mime_char = re.compile('[=\177-\377]') # quote these chars in body mime_header_char = re.compile('[=?\177-\377]') # quote these in header def mime_encode(line, header): """Code a single line as quoted-printable. If header is set, quote some extra characters.""" if header: reg = mime_header_char else: reg = mime_char newline = '' pos = 0 if len(line) >= 5 and line[:5] == 'From ': # quote 'From ' at the start of a line for stupid mailers newline = ('=%02x' % ord('F')).upper() pos = 1 while 1: res = reg.search(line, pos) if res is None: break newline = newline + line[pos:res.start(0)] + \ ('=%02x' % ord(res.group(0))).upper() pos = res.end(0) line = newline + line[pos:] newline = '' while len(line) >= 75: i = 73 while line[i] == '=' or line[i-1] == '=': i = i - 1 i = i + 1 newline = newline + line[:i] + '=\n' line = line[i:] return newline + line mime_header = re.compile('([ \t(]|^)([-a-zA-Z0-9_+]*[\177-\377][-a-zA-Z0-9_+\177-\377]*)(?=[ \t)]|\n)') def mime_encode_header(line): """Code a single header line as quoted-printable.""" newline = '' pos = 0 while 1: res = mime_header.search(line, pos) if res is None: break newline = '%s%s%s=?%s?Q?%s?=' % \ (newline, line[pos:res.start(0)], res.group(1), CHARSET, mime_encode(res.group(2), 1)) pos = res.end(0) return newline + line[pos:] mv = re.compile('^mime-version:', re.I) cte = re.compile('^content-transfer-encoding:', re.I) iso_char = re.compile('[\177-\377]') def mimify_part(ifile, ofile, is_mime): """Convert an 8bit part of a MIME mail message to quoted-printable.""" has_cte = is_qp = is_base64 = 0 multipart = None must_quote_body = must_quote_header = has_iso_chars = 0 header = [] header_end = '' message = [] message_end = '' # read header hfile = HeaderFile(ifile) while 1: line = hfile.readline() if not line: break if not must_quote_header and iso_char.search(line): must_quote_header = 1 if mv.match(line): is_mime = 1 if cte.match(line): has_cte = 1 if qp.match(line): is_qp = 1 elif base64_re.match(line): is_base64 = 1 mp_res = mp.match(line) if mp_res: multipart = '--' + mp_res.group(1) if he.match(line): header_end = line break header.append(line) # read body while 1: line = ifile.readline() if not line: break if multipart: if line == multipart + '--\n': message_end = line break if line == multipart + '\n': message_end = line break if is_base64: message.append(line) continue if is_qp: while line[-2:] == '=\n': line = line[:-2] newline = ifile.readline() if newline[:len(QUOTE)] == QUOTE: newline = newline[len(QUOTE):] line = line + newline line = mime_decode(line) message.append(line) if not has_iso_chars: if iso_char.search(line): has_iso_chars = must_quote_body = 1 if not must_quote_body: if len(line) > MAXLEN: must_quote_body = 1 # convert and output header and body for line in header: if must_quote_header: line = mime_encode_header(line) chrset_res = chrset.match(line) if chrset_res: if has_iso_chars: # change us-ascii into iso-8859-1 if chrset_res.group(2).lower() == 'us-ascii': line = '%s%s%s' % (chrset_res.group(1), CHARSET, chrset_res.group(3)) else: # change iso-8859-* into us-ascii line = '%sus-ascii%s' % chrset_res.group(1, 3) if has_cte and cte.match(line): line = 'Content-Transfer-Encoding: ' if is_base64: line = line + 'base64\n' elif must_quote_body: line = line + 'quoted-printable\n' else: line = line + '7bit\n' ofile.write(line) if (must_quote_header or must_quote_body) and not is_mime: ofile.write('Mime-Version: 1.0\n') ofile.write('Content-Type: text/plain; ') if has_iso_chars: ofile.write('charset="%s"\n' % CHARSET) else: ofile.write('charset="us-ascii"\n') if must_quote_body and not has_cte: ofile.write('Content-Transfer-Encoding: quoted-printable\n') ofile.write(header_end) for line in message: if must_quote_body: line = mime_encode(line, 0) ofile.write(line) ofile.write(message_end) line = message_end while multipart: if line == multipart + '--\n': # read bit after the end of the last part while 1: line = ifile.readline() if not line: return if must_quote_body: line = mime_encode(line, 0) ofile.write(line) if line == multipart + '\n': nifile = File(ifile, multipart) mimify_part(nifile, ofile, 1) line = nifile.peek if not line: # premature end of file break ofile.write(line) continue # unexpectedly no multipart separator--copy rest of file while 1: line = ifile.readline() if not line: return if must_quote_body: line = mime_encode(line, 0) ofile.write(line) def mimify(infile, outfile): """Convert 8bit parts of a MIME mail message to quoted-printable.""" if type(infile) == type(''): ifile = open(infile) if type(outfile) == type('') and infile == outfile: import os d, f = os.path.split(infile) os.rename(infile, os.path.join(d, ',' + f)) else: ifile = infile if type(outfile) == type(''): ofile = open(outfile, 'w') else: ofile = outfile nifile = File(ifile, None) mimify_part(nifile, ofile, 0) ofile.flush() import sys if __name__ == '__main__' or (len(sys.argv) > 0 and sys.argv[0] == 'mimify'): import getopt usage = 'Usage: mimify [-l len] -[ed] [infile [outfile]]' decode_base64 = 0 opts, args = getopt.getopt(sys.argv[1:], 'l:edb') if len(args) not in (0, 1, 2): print usage sys.exit(1) if (('-e', '') in opts) == (('-d', '') in opts) or \ ((('-b', '') in opts) and (('-d', '') not in opts)): print usage sys.exit(1) for o, a in opts: if o == '-e': encode = mimify elif o == '-d': encode = unmimify elif o == '-l': try: MAXLEN = int(a) except (ValueError, OverflowError): print usage sys.exit(1) elif o == '-b': decode_base64 = 1 if len(args) == 0: encode_args = (sys.stdin, sys.stdout) elif len(args) == 1: encode_args = (args[0], sys.stdout) else: encode_args = (args[0], args[1]) if decode_base64: encode_args = encode_args + (decode_base64,) encode(*encode_args)
huran2014/huran.github.io
wot_gateway/usr/lib/python2.7/mimify.py
Python
gpl-2.0
15,021
# Copyright (c) 2016-2021 Adobe Inc. All rights reserved. # # Permission is hereby granted, free of charge, to any person obtaining a copy # of this software and associated documentation files (the "Software"), to deal # in the Software without restriction, including without limitation the rights # to use, copy, modify, merge, publish, distribute, sublicense, and/or sell # copies of the Software, and to permit persons to whom the Software is # furnished to do so, subject to the following conditions: # # The above copyright notice and this permission notice shall be included in all # copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE # AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE # SOFTWARE. __version__ = "2.19"
adobe-apiplatform/umapi-client.py
umapi_client/version.py
Python
mit
1,138
#!/usr/bin/python # # Created on Aug 25, 2016 # @author: Gaurav Rastogi ([email protected]) # Eric Anderson ([email protected]) # module_check: supported # Avi Version: 17.1.1 # # # This file is part of Ansible # # Ansible is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Ansible is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Ansible. If not, see <http://www.gnu.org/licenses/>. # ANSIBLE_METADATA = {'metadata_version': '1.1', 'status': ['preview'], 'supported_by': 'community'} DOCUMENTATION = ''' --- module: avi_gslbhealthmonitor author: Gaurav Rastogi ([email protected]) short_description: Module for setup of GslbHealthMonitor Avi RESTful Object description: - This module is used to configure GslbHealthMonitor object - more examples at U(https://github.com/avinetworks/devops) requirements: [ avisdk ] version_added: "2.4" options: state: description: - The state that should be applied on the entity. default: present choices: ["absent","present"] description: description: - User defined description for the object. dns_monitor: description: - Healthmonitordns settings for gslbhealthmonitor. external_monitor: description: - Healthmonitorexternal settings for gslbhealthmonitor. failed_checks: description: - Number of continuous failed health checks before the server is marked down. - Allowed values are 1-50. - Default value when not specified in API or module is interpreted by Avi Controller as 2. http_monitor: description: - Healthmonitorhttp settings for gslbhealthmonitor. https_monitor: description: - Healthmonitorhttp settings for gslbhealthmonitor. monitor_port: description: - Use this port instead of the port defined for the server in the pool. - If the monitor succeeds to this port, the load balanced traffic will still be sent to the port of the server defined within the pool. - Allowed values are 1-65535. - Special values are 0 - 'use server port'. name: description: - A user friendly name for this health monitor. required: true receive_timeout: description: - A valid response from the server is expected within the receive timeout window. - This timeout must be less than the send interval. - If server status is regularly flapping up and down, consider increasing this value. - Allowed values are 1-300. - Default value when not specified in API or module is interpreted by Avi Controller as 4. send_interval: description: - Frequency, in seconds, that monitors are sent to a server. - Allowed values are 1-3600. - Default value when not specified in API or module is interpreted by Avi Controller as 5. successful_checks: description: - Number of continuous successful health checks before server is marked up. - Allowed values are 1-50. - Default value when not specified in API or module is interpreted by Avi Controller as 2. tcp_monitor: description: - Healthmonitortcp settings for gslbhealthmonitor. tenant_ref: description: - It is a reference to an object of type tenant. type: description: - Type of the health monitor. - Enum options - HEALTH_MONITOR_PING, HEALTH_MONITOR_TCP, HEALTH_MONITOR_HTTP, HEALTH_MONITOR_HTTPS, HEALTH_MONITOR_EXTERNAL, HEALTH_MONITOR_UDP, - HEALTH_MONITOR_DNS, HEALTH_MONITOR_GSLB. required: true udp_monitor: description: - Healthmonitorudp settings for gslbhealthmonitor. url: description: - Avi controller URL of the object. uuid: description: - Uuid of the health monitor. extends_documentation_fragment: - avi ''' EXAMPLES = """ - name: Example to create GslbHealthMonitor object avi_gslbhealthmonitor: controller: 10.10.25.42 username: admin password: something state: present name: sample_gslbhealthmonitor """ RETURN = ''' obj: description: GslbHealthMonitor (api/gslbhealthmonitor) object returned: success, changed type: dict ''' from ansible.module_utils.basic import AnsibleModule try: from ansible.module_utils.network.avi.avi import ( avi_common_argument_spec, HAS_AVI, avi_ansible_api) except ImportError: HAS_AVI = False def main(): argument_specs = dict( state=dict(default='present', choices=['absent', 'present']), description=dict(type='str',), dns_monitor=dict(type='dict',), external_monitor=dict(type='dict',), failed_checks=dict(type='int',), http_monitor=dict(type='dict',), https_monitor=dict(type='dict',), monitor_port=dict(type='int',), name=dict(type='str', required=True), receive_timeout=dict(type='int',), send_interval=dict(type='int',), successful_checks=dict(type='int',), tcp_monitor=dict(type='dict',), tenant_ref=dict(type='str',), type=dict(type='str', required=True), udp_monitor=dict(type='dict',), url=dict(type='str',), uuid=dict(type='str',), ) argument_specs.update(avi_common_argument_spec()) module = AnsibleModule( argument_spec=argument_specs, supports_check_mode=True) if not HAS_AVI: return module.fail_json(msg=( 'Avi python API SDK (avisdk>=17.1) is not installed. ' 'For more details visit https://github.com/avinetworks/sdk.')) return avi_ansible_api(module, 'gslbhealthmonitor', set([])) if __name__ == '__main__': main()
alexlo03/ansible
lib/ansible/modules/network/avi/avi_gslbhealthmonitor.py
Python
gpl-3.0
6,453
# =============================================================================== # Copyright 2016 Jake Ross # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # =============================================================================== # ============= enthought library imports ======================= from __future__ import absolute_import import json from pyface.message_dialog import warning from traits.api import HasTraits, Str, Int, Button from traitsui.api import View, UItem, Item, HGroup, VGroup, TextEditor # ============= standard library imports ======================== # ============= local library imports ========================== from pychron.hardware.core.communicators.ethernet_communicator import ( EthernetCommunicator, ) class FirmwareClient(HasTraits): command = Str # (enter_set=True, auto_set=False) responses = Str send_button = Button("Send") host = Str port = Int test_button = Button("Test") _cnt = 0 def __init__(self, *args, **kw): super(FirmwareClient, self).__init__(*args, **kw) c = EthernetCommunicator( host=self.host, port=self.port, use_end=True, kind="TCP" ) self._comm = c def test_connection(self): if not self._comm.open(): warning(None, "Could not connect to {}:{}".format(self.host, self.port)) else: return True def _send(self, cmd): resp = self._comm.ask(cmd) resp = "{} ==> {}".format(cmd, resp) self.responses = "{}\n{}".format(self.responses, resp) # handlers def _test_button_fired(self): # if self._cnt % 2 == 0: # self._send('Open FF') # action = 'open' # else: # self._send('Close FF') # action = 'close' # # time.sleep(0.5) # self._send('GetIndicatorState FF,{}'.format(action)) # self._cnt += 1 # d = json.dumps({'command': 'GetPosition', 'drive': 'feeder', 'position': 1, 'units': 'turns'}) # pos = self.command if self._cnt % 2 == 0 else 0 pos = float(self.command) d = json.dumps( { "command": "MoveAbsolute", "drive": "funnel", "position": pos, "units": "turns", } ) self._send(d) self._cnt += 1 # v, a, d = self.command.split(',') # d = {'command': 'StartJitter', 'drive': 'feeder', 'turns': 0.125, 'p1': 0.1, 'p2': 0.25, # 'velocity': int(v), 'acceleration': int(a), 'deceleration': int(d)} # d = json.dumps(d) # self._send(d) # time.sleep(5) # # d = {'command': 'StopJitter', 'drive': 'feeder'} # d = json.dumps(d) # self._send(d) # mf = MessageFrame() # mf.nmessage_len = 8 # mf.message_len = True # imgstr = self._comm.ask('GetImageArray', message_frame=mf, timeout=5) # print len(imgstr) # c = NMGRLCamera() # print c.get_image_data() # resp = self._comm.ask('GetImageArray') # print resp # print self._send('GetImageArray') # for i in range(5): # if i % 2 == 0: # self._send('Open A') # else: # self._send('Close A') # time.sleep(1) def _send_button_fired(self): self._send(self.command) # def _command_changed(self): # self._send(self.command) def traits_view(self): v = View( VGroup( HGroup(Item("command"), UItem("send_button"), UItem("test_button")), UItem("responses", style="custom", editor=TextEditor(read_only=True)), ), title="Furnace Firmware Client", resizable=True, ) return v if __name__ == "__main__": c = FirmwareClient(host="192.168.2.2", port=4567) if c.test_connection(): c.configure_traits() # ============= EOF =============================================
USGSDenverPychron/pychron
pychron/furnace/firmware/client.py
Python
apache-2.0
4,555
import sys from threading import Lock import time import types from . import values # retain this import style for testability from .context_managers import ExceptionCounter, InprogressTracker, Timer from .metrics_core import ( Metric, METRIC_LABEL_NAME_RE, METRIC_NAME_RE, RESERVED_METRIC_LABEL_NAME_RE, ) from .registry import REGISTRY from .utils import floatToGoString, INF if sys.version_info > (3,): unicode = str create_bound_method = types.MethodType else: def create_bound_method(func, obj): return types.MethodType(func, obj, obj.__class__) def _build_full_name(metric_type, name, namespace, subsystem, unit): full_name = '' if namespace: full_name += namespace + '_' if subsystem: full_name += subsystem + '_' full_name += name if unit and not full_name.endswith("_" + unit): full_name += "_" + unit if unit and metric_type in ('info', 'stateset'): raise ValueError('Metric name is of a type that cannot have a unit: ' + full_name) if metric_type == 'counter' and full_name.endswith('_total'): full_name = full_name[:-6] # Munge to OpenMetrics. return full_name def _validate_labelnames(cls, labelnames): labelnames = tuple(labelnames) for l in labelnames: if not METRIC_LABEL_NAME_RE.match(l): raise ValueError('Invalid label metric name: ' + l) if RESERVED_METRIC_LABEL_NAME_RE.match(l): raise ValueError('Reserved label metric name: ' + l) if l in cls._reserved_labelnames: raise ValueError('Reserved label metric name: ' + l) return labelnames class MetricWrapperBase(object): _type = None _reserved_labelnames = () def _is_observable(self): # Whether this metric is observable, i.e. # * a metric without label names and values, or # * the child of a labelled metric. return not self._labelnames or (self._labelnames and self._labelvalues) def _is_parent(self): return self._labelnames and not self._labelvalues def _get_metric(self): return Metric(self._name, self._documentation, self._type, self._unit) def describe(self): return [self._get_metric()] def collect(self): metric = self._get_metric() for suffix, labels, value in self._samples(): metric.add_sample(self._name + suffix, labels, value) return [metric] def __init__(self, name, documentation, labelnames=(), namespace='', subsystem='', unit='', registry=REGISTRY, labelvalues=None, ): self._name = _build_full_name(self._type, name, namespace, subsystem, unit) self._labelnames = _validate_labelnames(self, labelnames) self._labelvalues = tuple(labelvalues or ()) self._kwargs = {} self._documentation = documentation self._unit = unit if not METRIC_NAME_RE.match(self._name): raise ValueError('Invalid metric name: ' + self._name) if self._is_parent(): # Prepare the fields needed for child metrics. self._lock = Lock() self._metrics = {} if self._is_observable(): self._metric_init() if not self._labelvalues: # Register the multi-wrapper parent metric, or if a label-less metric, the whole shebang. if registry: registry.register(self) def labels(self, *labelvalues, **labelkwargs): """Return the child for the given labelset. All metrics can have labels, allowing grouping of related time series. Taking a counter as an example: from prometheus_client import Counter c = Counter('my_requests_total', 'HTTP Failures', ['method', 'endpoint']) c.labels('get', '/').inc() c.labels('post', '/submit').inc() Labels can also be provided as keyword arguments: from prometheus_client import Counter c = Counter('my_requests_total', 'HTTP Failures', ['method', 'endpoint']) c.labels(method='get', endpoint='/').inc() c.labels(method='post', endpoint='/submit').inc() See the best practices on [naming](http://prometheus.io/docs/practices/naming/) and [labels](http://prometheus.io/docs/practices/instrumentation/#use-labels). """ if not self._labelnames: raise ValueError('No label names were set when constructing %s' % self) if self._labelvalues: raise ValueError('%s already has labels set (%s); can not chain calls to .labels()' % ( self, dict(zip(self._labelnames, self._labelvalues)) )) if labelvalues and labelkwargs: raise ValueError("Can't pass both *args and **kwargs") if labelkwargs: if sorted(labelkwargs) != sorted(self._labelnames): raise ValueError('Incorrect label names') labelvalues = tuple(unicode(labelkwargs[l]) for l in self._labelnames) else: if len(labelvalues) != len(self._labelnames): raise ValueError('Incorrect label count') labelvalues = tuple(unicode(l) for l in labelvalues) with self._lock: if labelvalues not in self._metrics: self._metrics[labelvalues] = self.__class__( self._name, documentation=self._documentation, labelnames=self._labelnames, unit=self._unit, labelvalues=labelvalues, **self._kwargs ) return self._metrics[labelvalues] def remove(self, *labelvalues): if not self._labelnames: raise ValueError('No label names were set when constructing %s' % self) """Remove the given labelset from the metric.""" if len(labelvalues) != len(self._labelnames): raise ValueError('Incorrect label count (expected %d, got %s)' % (len(self._labelnames), labelvalues)) labelvalues = tuple(unicode(l) for l in labelvalues) with self._lock: del self._metrics[labelvalues] def _samples(self): if self._is_parent(): return self._multi_samples() else: return self._child_samples() def _multi_samples(self): with self._lock: metrics = self._metrics.copy() for labels, metric in metrics.items(): series_labels = list(zip(self._labelnames, labels)) for suffix, sample_labels, value in metric._samples(): yield (suffix, dict(series_labels + list(sample_labels.items())), value) def _child_samples(self): # pragma: no cover raise NotImplementedError('_child_samples() must be implemented by %r' % self) def _metric_init(self): # pragma: no cover """ Initialize the metric object as a child, i.e. when it has labels (if any) set. This is factored as a separate function to allow for deferred initialization. """ raise NotImplementedError('_metric_init() must be implemented by %r' % self) class Counter(MetricWrapperBase): """A Counter tracks counts of events or running totals. Example use cases for Counters: - Number of requests processed - Number of items that were inserted into a queue - Total amount of data that a system has processed Counters can only go up (and be reset when the process restarts). If your use case can go down, you should use a Gauge instead. An example for a Counter: from prometheus_client import Counter c = Counter('my_failures_total', 'Description of counter') c.inc() # Increment by 1 c.inc(1.6) # Increment by given value There are utilities to count exceptions raised: @c.count_exceptions() def f(): pass with c.count_exceptions(): pass # Count only one type of exception with c.count_exceptions(ValueError): pass """ _type = 'counter' def _metric_init(self): self._value = values.ValueClass(self._type, self._name, self._name + '_total', self._labelnames, self._labelvalues) self._created = time.time() def inc(self, amount=1): """Increment counter by the given amount.""" if amount < 0: raise ValueError('Counters can only be incremented by non-negative amounts.') self._value.inc(amount) def count_exceptions(self, exception=Exception): """Count exceptions in a block of code or function. Can be used as a function decorator or context manager. Increments the counter when an exception of the given type is raised up out of the code. """ return ExceptionCounter(self, exception) def _child_samples(self): return ( ('_total', {}, self._value.get()), ('_created', {}, self._created), ) class Gauge(MetricWrapperBase): """Gauge metric, to report instantaneous values. Examples of Gauges include: - Inprogress requests - Number of items in a queue - Free memory - Total memory - Temperature Gauges can go both up and down. from prometheus_client import Gauge g = Gauge('my_inprogress_requests', 'Description of gauge') g.inc() # Increment by 1 g.dec(10) # Decrement by given value g.set(4.2) # Set to a given value There are utilities for common use cases: g.set_to_current_time() # Set to current unixtime # Increment when entered, decrement when exited. @g.track_inprogress() def f(): pass with g.track_inprogress(): pass A Gauge can also take its value from a callback: d = Gauge('data_objects', 'Number of objects') my_dict = {} d.set_function(lambda: len(my_dict)) """ _type = 'gauge' _MULTIPROC_MODES = frozenset(('min', 'max', 'livesum', 'liveall', 'all')) def __init__(self, name, documentation, labelnames=(), namespace='', subsystem='', unit='', registry=REGISTRY, labelvalues=None, multiprocess_mode='all', ): self._multiprocess_mode = multiprocess_mode if multiprocess_mode not in self._MULTIPROC_MODES: raise ValueError('Invalid multiprocess mode: ' + multiprocess_mode) super(Gauge, self).__init__( name=name, documentation=documentation, labelnames=labelnames, namespace=namespace, subsystem=subsystem, unit=unit, registry=registry, labelvalues=labelvalues, ) self._kwargs['multiprocess_mode'] = self._multiprocess_mode def _metric_init(self): self._value = values.ValueClass( self._type, self._name, self._name, self._labelnames, self._labelvalues, multiprocess_mode=self._multiprocess_mode ) def inc(self, amount=1): """Increment gauge by the given amount.""" self._value.inc(amount) def dec(self, amount=1): """Decrement gauge by the given amount.""" self._value.inc(-amount) def set(self, value): """Set gauge to the given value.""" self._value.set(float(value)) def set_to_current_time(self): """Set gauge to the current unixtime.""" self.set(time.time()) def track_inprogress(self): """Track inprogress blocks of code or functions. Can be used as a function decorator or context manager. Increments the gauge when the code is entered, and decrements when it is exited. """ return InprogressTracker(self) def time(self): """Time a block of code or function, and set the duration in seconds. Can be used as a function decorator or context manager. """ return Timer(self.set) def set_function(self, f): """Call the provided function to return the Gauge value. The function must return a float, and may be called from multiple threads. All other methods of the Gauge become NOOPs. """ def samples(self): return (('', {}, float(f())),) self._child_samples = create_bound_method(samples, self) def _child_samples(self): return (('', {}, self._value.get()),) class Summary(MetricWrapperBase): """A Summary tracks the size and number of events. Example use cases for Summaries: - Response latency - Request size Example for a Summary: from prometheus_client import Summary s = Summary('request_size_bytes', 'Request size (bytes)') s.observe(512) # Observe 512 (bytes) Example for a Summary using time: from prometheus_client import Summary REQUEST_TIME = Summary('response_latency_seconds', 'Response latency (seconds)') @REQUEST_TIME.time() def create_response(request): '''A dummy function''' time.sleep(1) Example for using the same Summary object as a context manager: with REQUEST_TIME.time(): pass # Logic to be timed """ _type = 'summary' _reserved_labelnames = ['quantile'] def _metric_init(self): self._count = values.ValueClass(self._type, self._name, self._name + '_count', self._labelnames, self._labelvalues) self._sum = values.ValueClass(self._type, self._name, self._name + '_sum', self._labelnames, self._labelvalues) self._created = time.time() def observe(self, amount): """Observe the given amount.""" self._count.inc(1) self._sum.inc(amount) def time(self): """Time a block of code or function, and observe the duration in seconds. Can be used as a function decorator or context manager. """ return Timer(self.observe) def _child_samples(self): return ( ('_count', {}, self._count.get()), ('_sum', {}, self._sum.get()), ('_created', {}, self._created)) class Histogram(MetricWrapperBase): """A Histogram tracks the size and number of events in buckets. You can use Histograms for aggregatable calculation of quantiles. Example use cases: - Response latency - Request size Example for a Histogram: from prometheus_client import Histogram h = Histogram('request_size_bytes', 'Request size (bytes)') h.observe(512) # Observe 512 (bytes) Example for a Histogram using time: from prometheus_client import Histogram REQUEST_TIME = Histogram('response_latency_seconds', 'Response latency (seconds)') @REQUEST_TIME.time() def create_response(request): '''A dummy function''' time.sleep(1) Example of using the same Histogram object as a context manager: with REQUEST_TIME.time(): pass # Logic to be timed The default buckets are intended to cover a typical web/rpc request from milliseconds to seconds. They can be overridden by passing `buckets` keyword argument to `Histogram`. """ _type = 'histogram' _reserved_labelnames = ['le'] DEFAULT_BUCKETS = (.005, .01, .025, .05, .075, .1, .25, .5, .75, 1.0, 2.5, 5.0, 7.5, 10.0, INF) def __init__(self, name, documentation, labelnames=(), namespace='', subsystem='', unit='', registry=REGISTRY, labelvalues=None, buckets=DEFAULT_BUCKETS, ): self._prepare_buckets(buckets) super(Histogram, self).__init__( name=name, documentation=documentation, labelnames=labelnames, namespace=namespace, subsystem=subsystem, unit=unit, registry=registry, labelvalues=labelvalues, ) self._kwargs['buckets'] = buckets def _prepare_buckets(self, buckets): buckets = [float(b) for b in buckets] if buckets != sorted(buckets): # This is probably an error on the part of the user, # so raise rather than sorting for them. raise ValueError('Buckets not in sorted order') if buckets and buckets[-1] != INF: buckets.append(INF) if len(buckets) < 2: raise ValueError('Must have at least two buckets') self._upper_bounds = buckets def _metric_init(self): self._buckets = [] self._created = time.time() bucket_labelnames = self._labelnames + ('le',) self._sum = values.ValueClass(self._type, self._name, self._name + '_sum', self._labelnames, self._labelvalues) for b in self._upper_bounds: self._buckets.append(values.ValueClass( self._type, self._name, self._name + '_bucket', bucket_labelnames, self._labelvalues + (floatToGoString(b),)) ) def observe(self, amount): """Observe the given amount.""" self._sum.inc(amount) for i, bound in enumerate(self._upper_bounds): if amount <= bound: self._buckets[i].inc(1) break def time(self): """Time a block of code or function, and observe the duration in seconds. Can be used as a function decorator or context manager. """ return Timer(self.observe) def _child_samples(self): samples = [] acc = 0 for i, bound in enumerate(self._upper_bounds): acc += self._buckets[i].get() samples.append(('_bucket', {'le': floatToGoString(bound)}, acc)) samples.append(('_count', {}, acc)) samples.append(('_sum', {}, self._sum.get())) samples.append(('_created', {}, self._created)) return tuple(samples) class Info(MetricWrapperBase): """Info metric, key-value pairs. Examples of Info include: - Build information - Version information - Potential target metadata Example usage: from prometheus_client import Info i = Info('my_build', 'Description of info') i.info({'version': '1.2.3', 'buildhost': 'foo@bar'}) Info metrics do not work in multiprocess mode. """ _type = 'info' def _metric_init(self): self._labelname_set = set(self._labelnames) self._lock = Lock() self._value = {} def info(self, val): """Set info metric.""" if self._labelname_set.intersection(val.keys()): raise ValueError('Overlapping labels for Info metric, metric: %s child: %s' % ( self._labelnames, val)) with self._lock: self._value = dict(val) def _child_samples(self): with self._lock: return (('_info', self._value, 1.0,),) class Enum(MetricWrapperBase): """Enum metric, which of a set of states is true. Example usage: from prometheus_client import Enum e = Enum('task_state', 'Description of enum', states=['starting', 'running', 'stopped']) e.state('running') The first listed state will be the default. Enum metrics do not work in multiprocess mode. """ _type = 'stateset' def __init__(self, name, documentation, labelnames=(), namespace='', subsystem='', unit='', registry=REGISTRY, labelvalues=None, states=None, ): super(Enum, self).__init__( name=name, documentation=documentation, labelnames=labelnames, namespace=namespace, subsystem=subsystem, unit=unit, registry=registry, labelvalues=labelvalues, ) if name in labelnames: raise ValueError('Overlapping labels for Enum metric: %s' % (name,)) if not states: raise ValueError('No states provided for Enum metric: %s' % (name,)) self._kwargs['states'] = self._states = states def _metric_init(self): self._value = 0 self._lock = Lock() def state(self, state): """Set enum metric state.""" with self._lock: self._value = self._states.index(state) def _child_samples(self): with self._lock: return [ ('', {self._name: s}, 1 if i == self._value else 0,) for i, s in enumerate(self._states) ]
kawamon/hue
desktop/core/ext-py/prometheus_client-0.7.1/prometheus_client/metrics.py
Python
apache-2.0
21,319
#!/usr/bin/env python # -*- coding: utf-8 -*- __author__ = 'valerio cosentino' import mysql.connector class DbUtil(): """ This class provides database utilities """ def get_connection(self, config): """ gets DB connection :type config: dict :param config: the DB configuration file """ return mysql.connector.connect(**config) def close_connection(self, cnx): """ closes DB connection :type cnx: Object :param cnx: DB connection to close """ cnx.close() def lowercase(self, _str): """ conver str to lowercase :type _str: str :param _str: str to convert """ if _str: _str = _str.lower() return _str def select_project_id(self, cnx, project_name, logger): """ gets project id :type cnx: Object :param cnx: DB connection :type project_name: str :param project_name: name of the project :type logger: Object :param logger: logger """ found = None cursor = cnx.cursor() query = "SELECT p.id " \ "FROM project p " \ "WHERE p.name = %s" arguments = [project_name] cursor.execute(query, arguments) row = cursor.fetchone() if row: found = row[0] else: logger.error("the project " + str(project_name) + " does not exist") cursor.close() return found def insert_project(self, cnx, db_name, project_name): """ inserts a project in the DB :type cnx: Object :param cnx: DB connection :type db_name: str :param db_name: the name of an existing DB :type project_name: str :param project_name: the name of the project to create """ self.set_database(cnx, db_name) cursor = cnx.cursor() query = "INSERT IGNORE INTO project " \ "VALUES (%s, %s)" arguments = [None, project_name] cursor.execute(query, arguments) cnx.commit() cursor.close() def insert_repo(self, cnx, project_id, repo_name, logger): """ inserts repository :type cnx: Object :param cnx: DB connection :type project_id: int :param project_id: id of the project :type repo_name: str :param repo_name: name of the repository :type logger: Object :param logger: logger """ cursor = cnx.cursor() query = "INSERT IGNORE INTO repository " \ "VALUES (%s, %s, %s)" arguments = [None, project_id, repo_name] cursor.execute(query, arguments) cnx.commit() cursor.close() def insert_issue_tracker(self, cnx, repo_id, issue_tracker_name, issue_type, logger): """ inserts issue tracker :type cnx: Object :param cnx: DB connection :type repo_id: int :param repo_id: id of the repository :type issue_tracker_name: str :param issue_tracker_name: name of the issue tracker :type issue_type: str :param issue_type: type of the issue tracker :type logger: Object :param logger: logger """ cursor = cnx.cursor() query = "INSERT IGNORE INTO issue_tracker " \ "VALUES (%s, %s, %s, %s)" arguments = [None, repo_id, issue_tracker_name, issue_type] cursor.execute(query, arguments) cnx.commit() query = "SELECT id " \ "FROM issue_tracker " \ "WHERE name = %s" arguments = [issue_tracker_name] cursor.execute(query, arguments) row = cursor.fetchone() if row: found = row[0] else: logger.warning("no issue with name " + str(issue_tracker_name)) cursor.close() return found def select_label_id(self, cnx, name, logger): """ selects the label id by its name :type cnx: Object :param cnx: DB connection :type name: str :param name: the name of the label :type logger: Object :param logger: logger """ cursor = cnx.cursor() query = "SELECT id FROM label WHERE name = %s" arguments = [name] cursor.execute(query, arguments) row = cursor.fetchone() found = None if row: found = row[0] else: logger.warning("no label with name " + str(name)) cursor.close() return found def insert_label(self, cnx, name, logger): """ inserts a label :type cnx: Object :param cnx: DB connection :type name: str :param name: the name of the label :type logger: Object :param logger: logger """ cursor = cnx.cursor() query = "INSERT IGNORE INTO label " \ "VALUES (%s, %s)" arguments = [None, name] cursor.execute(query, arguments) cnx.commit() cursor.close() def select_repo_id(self, cnx, repo_name, logger): """ selects repository id :type cnx: Object :param cnx: DB connection :type repo_name: str :param repo_name: name of the repository :type logger: Object :param logger: logger """ found = None cursor = cnx.cursor() query = "SELECT id " \ "FROM repository " \ "WHERE name = %s" arguments = [repo_name] cursor.execute(query, arguments) row = cursor.fetchone() if row: found = row[0] else: logger.error("the repository " + repo_name + " does not exist") cursor.close() return found def select_instant_messaging_id(self, cnx, im_name, logger): """ selects instant messaging id :type cnx: Object :param cnx: DB connection :type im_name: str :param im_name: name of the instant messaging :type logger: Object :param logger: logger """ found = None cursor = cnx.cursor() query = "SELECT id " \ "FROM instant_messaging " \ "WHERE name = %s" arguments = [im_name] cursor.execute(query, arguments) row = cursor.fetchone() if row: found = row[0] else: logger.error("the instant messaging " + im_name + " does not exist") cursor.close() return found def insert_user(self, cnx, name, email, logger): """ inserts user :type cnx: Object :param cnx: DB connection :type name: str :param name: name of the user :type email: str :param email: email of the user :type logger: Object :param logger: logger """ cursor = cnx.cursor() query = "INSERT IGNORE INTO user " \ "VALUES (%s, %s, %s)" arguments = [None, name, email] cursor.execute(query, arguments) cnx.commit() cursor.close() def select_user_id_by_email(self, cnx, email, logger): """ selects user id by email :type cnx: Object :param cnx: DB connection :type email: str :param email: email of the user :type logger: Object :param logger: logger """ found = None if email: cursor = cnx.cursor() query = "SELECT id " \ "FROM user " \ "WHERE email = %s" arguments = [email] cursor.execute(query, arguments) row = cursor.fetchone() if row: found = row[0] else: logger.debug("there is not user with this email " + email) cursor.close() return found def select_user_id_by_name(self, cnx, name, logger): """ selects user id by name :type cnx: Object :param cnx: DB connection :type name: str :param name: name of the user :type logger: Object :param logger: logger """ found = None if name: found = None cursor = cnx.cursor() query = "SELECT id " \ "FROM user " \ "WHERE name = %s" arguments = [name] cursor.execute(query, arguments) row = cursor.fetchone() if row: found = row[0] else: logger.debug("there is not user with this name " + name) cursor.close() return found def select_forum_id(self, cnx, forum_name, logger): """ selects forum id :type cnx: Object :param cnx: DB connection :type forum_name: str :param forum_name: name of the forum :type logger: Object :param logger: logger """ found = None cursor = cnx.cursor() query = "SELECT id " \ "FROM forum " \ "WHERE name = %s" arguments = [forum_name] cursor.execute(query, arguments) row = cursor.fetchone() if row: found = row[0] else: logger.error("the forum " + forum_name + " does not exist") cursor.close() return found def select_issue_tracker_id(self, cnx, issue_tracker_name, logger): """ selects issue tracker id :type cnx: Object :param cnx: DB connection :type issue_tracker_name: str :param issue_tracker_name: name of the issue tracker :type logger: Object :param logger: logger """ found = None cursor = cnx.cursor() query = "SELECT id " \ "FROM issue_tracker " \ "WHERE name = %s" arguments = [issue_tracker_name] cursor.execute(query, arguments) row = cursor.fetchone() if row: found = row[0] else: logger.error("the issue tracker " + issue_tracker_name + " does not exist") cursor.close() return found def get_issue_dependency_type_id(self, cnx, name): """ selects issue dependency type id :type cnx: Object :param cnx: DB connection :type name: str :param name: dependency type name """ found = None cursor = cnx.cursor() query = "SELECT id FROM issue_dependency_type WHERE name = %s" arguments = [name] cursor.execute(query, arguments) row = cursor.fetchone() cursor.close() if row: found = row[0] return found def get_message_type_id(self, cnx, name): """ selects message type id :type cnx: Object :param cnx: DB connection :type name: str :param name: message type name """ found = None cursor = cnx.cursor() query = "SELECT id FROM message_type WHERE name = %s" arguments = [name] cursor.execute(query, arguments) row = cursor.fetchone() if row: found = row[0] cursor.close() return found def set_database(self, cnx, db_name): """ set database :type cnx: Object :param cnx: DB connection :type db_name: str :param db_name: name of the database """ cursor = cnx.cursor() use_database = "USE " + db_name cursor.execute(use_database) cursor.close() def set_settings(self, cnx): """ set database settings :type cnx: Object :param cnx: DB connection """ cursor = cnx.cursor() cursor.execute("set global innodb_file_format = BARRACUDA") cursor.execute("set global innodb_file_format_max = BARRACUDA") cursor.execute("set global innodb_large_prefix = ON") cursor.execute("set global character_set_server = utf8") cursor.execute("set global max_connections = 500") cursor.close() def restart_connection(self, config, logger): """ restart DB connection :type config: dict :param config: the DB configuration file :type logger: Object :param logger: logger """ logger.info("restarting connection...") return mysql.connector.connect(**config)
SOM-Research/Gitana
util/db_util.py
Python
mit
12,774
############################################################################## # Copyright (c) 2013-2017, Lawrence Livermore National Security, LLC. # Produced at the Lawrence Livermore National Laboratory. # # This file is part of Spack. # Created by Todd Gamblin, [email protected], All rights reserved. # LLNL-CODE-647188 # # For details, see https://github.com/llnl/spack # Please also see the NOTICE and LICENSE files for our notice and the LGPL. # # This program is free software; you can redistribute it and/or modify # it under the terms of the GNU Lesser General Public License (as # published by the Free Software Foundation) version 2.1, February 1999. # # This program is distributed in the hope that it will be useful, but # WITHOUT ANY WARRANTY; without even the IMPLIED WARRANTY OF # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the terms and # conditions of the GNU Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public # License along with this program; if not, write to the Free Software # Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA ############################################################################## from spack import * class Glm(CMakePackage): """OpenGL Mathematics (GLM) is a header only C++ mathematics library for graphics software based on the OpenGL Shading Language (GLSL) specification """ homepage = "https://github.com/g-truc/glm" url = "https://github.com/g-truc/glm/archive/0.9.7.1.tar.gz" version('0.9.7.1', '61af6639cdf652d1cdd7117190afced8') depends_on('[email protected]:', type='build')
wscullin/spack
var/spack/repos/builtin/packages/glm/package.py
Python
lgpl-2.1
1,663
try: from setuptools import setup except ImportError: from distutils.core import setup with open('README_PYPI.rst') as file: long_description = file.read() setup(name='poirot', version='1.0.1', author='Emanuel Feld', author_email='[email protected]', description="Search a Git repository's full revision history (commit messages and diffs) for text patterns.", long_description=long_description, url='https://github.com/emanuelfeld/poirot', license='https://raw.githubusercontent.com/emanuelfeld/poirot/master/LICENSE.md', packages=['poirot'], install_requires=[ 'tqdm>=3.4.0', 'Jinja2>=2.8', 'regex>=2015.11.22', 'requests>=2.9.1' ], test_suite='nose.collector', tests_require=['nose-progressive'], classifiers=[ 'Environment :: Console', 'Intended Audience :: Developers', 'Development Status :: 3 - Alpha', 'License :: OSI Approved :: MIT License', 'Programming Language :: Python', 'Programming Language :: Python :: 2.7', 'Programming Language :: Python :: 3.3', 'Programming Language :: Python :: 3.4', 'Programming Language :: Python :: 3.5' ], include_package_data=True, entry_points={ 'console_scripts': [ 'poirot=poirot.poirot:main', ] }, zip_safe=False)
emanuelfeld/poirot
setup.py
Python
mit
1,442
from django.db import models from django.contrib.auth import models as auth import datetime from application import settings from django.db.models.signals import post_save from django.dispatch import receiver typeChoices = ( ('task', 'Task'), ('userStory', 'User Story'), ) statusChoices = ( ('toDo', 'To do'), ('inProgress', 'in progress'), ('done', 'Done'), ) categoryChoices = ( ('frontend', 'Frontend'), ('backend', 'Backend'), ('design', 'Design'), ) purposeChoices = ( ('bugfix', 'Bugfix'), ('feature', 'Feature'), ) class WorkGroup(models.Model): name = models.CharField( max_length=200, unique = True, ) def __unicode__(self): return u'%s' % (self.name) class TaskCard(models.Model): creator = models.ForeignKey( settings.AUTH_USER_MODEL, related_name='createdTasks', on_delete=models.PROTECT, ) processor = models.ForeignKey( settings.AUTH_USER_MODEL, related_name='processingTasks', blank=True, null=True, ) createTime = models.DateTimeField( auto_now_add=True, ) startTime = models.DateField( null=True, blank=True, ) #endTime = models.DateTimeField() #sprint = models.ForeignKey(Sprint) title = models.CharField( max_length=200, ) taskType = models.CharField( max_length=15, choices=typeChoices, default='task', ) taskPurpose = models.CharField( max_length=15, choices=purposeChoices, blank=True, null=True, ) taskCategory = models.CharField( max_length=15, choices=categoryChoices, blank=True, null=True, ) description = models.TextField() status = models.CharField( max_length=15, choices=statusChoices, blank=True, null=True, ) group = models.ForeignKey( WorkGroup, null=True, blank=True, ) def __unicode__(self): return self.title def save(self, *args, **kwargs): if self.startTime is None and self.processor is not None: self.startTime = datetime.date.today() self.status = 'in progress' if self.status is None: self.status = statusChoices[0][1] if self.group is None: self.group = self.creator.taskCardUser.workGroup super(TaskCard, self).save(*args, **kwargs) def commentsDescending(self, *args, **kwargs): return self.comments.order_by('-published',) class TaskCardUser(models.Model): user = models.OneToOneField( settings.AUTH_USER_MODEL, related_name='taskCardUser' ) workGroup = models.ForeignKey( WorkGroup, related_name='taskCardUser' ) def __unicode__(self): return u'%s' % (self.user) #@receiver(post_save, sender=settings.AUTH_USER_MODEL) def connectTaskCardUser(sender, instance, created, **kwargs): if created: TaskCardUser.objects.create(user=instance, workGroup=WorkGroup.objects.get(id=1)) post_save.connect(connectTaskCardUser, sender=settings.AUTH_USER_MODEL) class Comment(models.Model): taskCard = models.ForeignKey( TaskCard, related_name = 'comments', ) author = models.ForeignKey( settings.AUTH_USER_MODEL ) published = models.DateTimeField( null=True, blank=True, ) text = models.CharField( max_length=255, ) def save(self, *args, **kwargs): self.published = datetime.datetime.now() super(Comment, self).save(*args, **kwargs) class Meta: unique_together = ('taskCard', 'published') #class Sprint(models.Model): # startTime = models.DateTimeField() # endTime = models.DateTimeField()
Die-Turtles/application
taskCards/models.py
Python
gpl-2.0
3,381
# Copyright (c) 2009 Google Inc. All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are # met: # # * Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # * Redistributions in binary form must reproduce the above # copyright notice, this list of conditions and the following disclaimer # in the documentation and/or other materials provided with the # distribution. # * Neither the name of Google Inc. nor the names of its # contributors may be used to endorse or promote products derived from # this software without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS # "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT # LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR # A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT # OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, # SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT # LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, # DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY # THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT # (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE # OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. import sys import unittest from optparse import make_option from webkitpy.common.system.outputcapture import OutputCapture from webkitpy.tool.multicommandtool import MultiCommandTool, Command, TryAgain class TrivialCommand(Command): name = "trivial" show_in_main_help = True def __init__(self, **kwargs): Command.__init__(self, "help text", **kwargs) def execute(self, options, args, tool): pass class UncommonCommand(TrivialCommand): name = "uncommon" show_in_main_help = False class LikesToRetry(Command): name = "likes-to-retry" show_in_main_help = True def __init__(self, **kwargs): Command.__init__(self, "help text", **kwargs) self.execute_count = 0 def execute(self, options, args, tool): self.execute_count += 1 if self.execute_count < 2: raise TryAgain() class CommandTest(unittest.TestCase): def test_name_with_arguments(self): command_with_args = TrivialCommand(argument_names="ARG1 ARG2") self.assertEqual(command_with_args.name_with_arguments(), "trivial ARG1 ARG2") command_with_args = TrivialCommand(options=[make_option("--my_option")]) self.assertEqual(command_with_args.name_with_arguments(), "trivial [options]") def test_parse_required_arguments(self): self.assertEqual(Command._parse_required_arguments("ARG1 ARG2"), ["ARG1", "ARG2"]) self.assertEqual(Command._parse_required_arguments("[ARG1] [ARG2]"), []) self.assertEqual(Command._parse_required_arguments("[ARG1] ARG2"), ["ARG2"]) # Note: We might make our arg parsing smarter in the future and allow this type of arguments string. self.assertRaises(Exception, Command._parse_required_arguments, "[ARG1 ARG2]") def test_required_arguments(self): two_required_arguments = TrivialCommand(argument_names="ARG1 ARG2 [ARG3]") expected_missing_args_error = "2 arguments required, 1 argument provided. Provided: 'foo' Required: ARG1 ARG2\nSee 'trivial-tool help trivial' for usage.\n" exit_code = OutputCapture().assert_outputs(self, two_required_arguments.check_arguments_and_execute, [None, ["foo"], TrivialTool()], expected_stderr=expected_missing_args_error) self.assertEqual(exit_code, 1) class TrivialTool(MultiCommandTool): def __init__(self, commands=None): MultiCommandTool.__init__(self, name="trivial-tool", commands=commands) def path(self): return __file__ def should_execute_command(self, command): return (True, None) class MultiCommandToolTest(unittest.TestCase): def _assert_split(self, args, expected_split): self.assertEqual(MultiCommandTool._split_command_name_from_args(args), expected_split) def test_split_args(self): # MultiCommandToolTest._split_command_name_from_args returns: (command, args) full_args = ["--global-option", "command", "--option", "arg"] full_args_expected = ("command", ["--global-option", "--option", "arg"]) self._assert_split(full_args, full_args_expected) full_args = [] full_args_expected = (None, []) self._assert_split(full_args, full_args_expected) full_args = ["command", "arg"] full_args_expected = ("command", ["arg"]) self._assert_split(full_args, full_args_expected) def test_command_by_name(self): # This also tests Command auto-discovery. tool = TrivialTool() self.assertEqual(tool.command_by_name("trivial").name, "trivial") self.assertEqual(tool.command_by_name("bar"), None) def _assert_tool_main_outputs(self, tool, main_args, expected_stdout, expected_stderr = "", expected_exit_code=0): exit_code = OutputCapture().assert_outputs(self, tool.main, [main_args], expected_stdout=expected_stdout, expected_stderr=expected_stderr) self.assertEqual(exit_code, expected_exit_code) def test_retry(self): likes_to_retry = LikesToRetry() tool = TrivialTool(commands=[likes_to_retry]) tool.main(["tool", "likes-to-retry"]) self.assertEqual(likes_to_retry.execute_count, 2) def test_global_help(self): tool = TrivialTool(commands=[TrivialCommand(), UncommonCommand()]) expected_common_commands_help = """Usage: trivial-tool [options] COMMAND [ARGS] Options: -h, --help show this help message and exit Common trivial-tool commands: trivial help text See 'trivial-tool help --all-commands' to list all commands. See 'trivial-tool help COMMAND' for more information on a specific command. """ self._assert_tool_main_outputs(tool, ["tool"], expected_common_commands_help) self._assert_tool_main_outputs(tool, ["tool", "help"], expected_common_commands_help) expected_all_commands_help = """Usage: trivial-tool [options] COMMAND [ARGS] Options: -h, --help show this help message and exit All trivial-tool commands: help Display information about this program or its subcommands trivial help text uncommon help text See 'trivial-tool help --all-commands' to list all commands. See 'trivial-tool help COMMAND' for more information on a specific command. """ self._assert_tool_main_outputs(tool, ["tool", "help", "--all-commands"], expected_all_commands_help) # Test that arguments can be passed before commands as well self._assert_tool_main_outputs(tool, ["tool", "--all-commands", "help"], expected_all_commands_help) def test_command_help(self): command_with_options = TrivialCommand(options=[make_option("--my_option")], long_help="LONG HELP") tool = TrivialTool(commands=[command_with_options]) expected_subcommand_help = "trivial [options] help text\n\nLONG HELP\n\nOptions:\n --my_option=MY_OPTION\n\n" self._assert_tool_main_outputs(tool, ["tool", "help", "trivial"], expected_subcommand_help) if __name__ == "__main__": unittest.main()
mogoweb/webkit_for_android5.1
webkit/Tools/Scripts/webkitpy/tool/multicommandtool_unittest.py
Python
apache-2.0
7,516
import json from collections import OrderedDict, namedtuple from contextlib import contextmanager from celery import states from celery.exceptions import Ignore from django.utils.functional import cached_property from django.utils.translation import ugettext_lazy as _ from memoized import memoized from corehq.apps.case_importer.const import LookupErrors from corehq.apps.case_importer.exceptions import ( ImporterRawError, ImporterExcelError, ImporterExcelFileEncrypted, ImporterFileNotFound, ImporterRefError, ) from corehq.form_processor.exceptions import CaseNotFound from corehq.form_processor.models import CommCareCase from corehq.util.workbook_reading import ( SpreadsheetFileEncrypted, SpreadsheetFileInvalidError, SpreadsheetFileNotFound, Workbook, open_any_workbook, ) from soil.progress import update_task_state # Don't allow users to change the case type by accident using a custom field. But do allow users to change # owner_id, external_id, etc. (See also custom_data_fields.models.RESERVED_WORDS) RESERVED_FIELDS = ('type', 'closed', 'parent_ref') EXTERNAL_ID = 'external_id' class ImporterConfig(namedtuple('ImporterConfig', [ 'couch_user_id', 'excel_fields', 'case_fields', 'custom_fields', 'search_column', 'case_type', 'search_field', 'create_new_cases', ])): """ Class for storing config values from the POST in a format that can be pickled and passed to celery tasks. """ def __new__(cls, *args, **kwargs): args, kwargs = cls.__detect_schema_change(args, kwargs) return super(cls, ImporterConfig).__new__(cls, *args, **kwargs) @staticmethod def __detect_schema_change(args, kwargs): # before we removed key_column, value_column, named_columns # from positions 5-7 if len(args) == 11 and not kwargs: return args[:5] + args[8:], {} else: return args, kwargs def to_dict(self): return self._asdict() def to_json(self): return json.dumps(self.to_dict()) @classmethod def from_dict(cls, json_dict): return cls(**json_dict) @classmethod def from_json(cls, json_rep): return cls.from_dict(json.loads(json_rep)) @classmethod def from_request(cls, request): return cls( couch_user_id=request.couch_user._id, excel_fields=request.POST.getlist('excel_field[]'), case_fields=request.POST.getlist('case_field[]'), custom_fields=request.POST.getlist('custom_field[]'), search_column=request.POST['search_column'], case_type=request.POST['case_type'], search_field=request.POST['search_field'], create_new_cases=request.POST['create_new_cases'] == 'True', ) class WorksheetWrapper(object): def __init__(self, worksheet): self._worksheet = worksheet @classmethod def from_workbook(cls, workbook): if not isinstance(workbook, Workbook): raise AssertionError( "WorksheetWrapper.from_workbook called without Workbook object") elif not workbook.worksheets: raise SpreadsheetFileInvalidError( _("It seems as though your spreadsheet contains no sheets. Please resave it and try again.")) else: return cls(workbook.worksheets[0]) @cached_property def _headers_by_index(self): try: header_row = next(self.iter_rows()) except StopIteration: header_row = [] return OrderedDict( (i, header) for i, header in enumerate(header_row) if header # remove None columns the library sometimes returns ) def get_header_columns(self): return list(self._headers_by_index.values()) @property def max_row(self): return self._worksheet.max_row def iter_rows(self): for row in self._worksheet.iter_rows(): yield [cell.value for cell in row] def iter_row_dicts(self): for row in self.iter_rows(): yield { self._headers_by_index[i]: value for i, value in enumerate(row) if i in self._headers_by_index } def lookup_case(search_field, search_id, domain, case_type): """ Attempt to find the case by the provided search_field and search_id. Returns a tuple with case (if found) and an error code (if there was an error in lookup). """ if search_field == 'case_id': try: case = CommCareCase.objects.get_case(search_id, domain) if case.type == case_type: return (case, None) except CaseNotFound: pass elif search_field == EXTERNAL_ID: try: case = CommCareCase.objects.get_case_by_external_id( domain, search_id, case_type=case_type, raise_multiple=True) except CommCareCase.MultipleObjectsReturned: return (None, LookupErrors.MultipleResults) if case is not None: return (case, None) return (None, LookupErrors.NotFound) def open_spreadsheet_download_ref(filename): """ open a spreadsheet download ref just to test there are no errors opening it """ with get_spreadsheet(filename): pass @contextmanager def get_spreadsheet(filename): try: with open_any_workbook(filename) as workbook: yield WorksheetWrapper.from_workbook(workbook) except SpreadsheetFileEncrypted as e: raise ImporterExcelFileEncrypted(str(e)) except SpreadsheetFileNotFound as e: raise ImporterFileNotFound(str(e)) except SpreadsheetFileInvalidError as e: raise ImporterExcelError(str(e)) def get_importer_error_message(e): if isinstance(e, ImporterRefError): # I'm not totally sure this is the right error, but it's what was being # used before. (I think people were just calling _spreadsheet_expired # or otherwise blaming expired sessions whenever anything unexpected # happened though...) return _('Sorry, your session has expired. Please start over and try again.') elif isinstance(e, ImporterFileNotFound): return _('The session containing the file you uploaded has expired. ' 'Please upload a new one.') elif isinstance(e, ImporterExcelFileEncrypted): return _('The file you want to import is password protected. ' 'Please choose a file that is not password protected.') elif isinstance(e, ImporterExcelError): return _("The file uploaded has the following error: {}").format(str(e)) elif isinstance(e, ImporterRawError): return str(e) else: return _("Error: {}").format(str(e)) def exit_celery_with_error_message(task, error_message): """ Call this function and return the value from within a celery task to abort with an error message that gets passed on in a way that case importer will pick up and display. Currently it doesn't return anything and does all its magic by manually setting task metadata and raising Ignore, but the internals could change to do this through a return value instead. """ update_task_state(task, states.FAILURE, get_interned_exception(error_message)) raise Ignore() @memoized def get_interned_exception(message): """ In tests, it's important that the error message is exactly the same object. """ return Exception(message)
dimagi/commcare-hq
corehq/apps/case_importer/util.py
Python
bsd-3-clause
7,577
# Copyright 2017 Carlos Dauden <[email protected]> # Copyright 2017 Thorsten Vocks <[email protected]> # License AGPL-3.0 or later (http://www.gnu.org/licenses/agpl). from odoo.tests.common import SavepointCase from odoo.exceptions import ValidationError class TestProductCatalogPrint(SavepointCase): @classmethod def setUpClass(cls): super(TestProductCatalogPrint, cls).setUpClass() cls.pricelist = cls.env.ref("product.list0") cls.product = cls.env["product.product"].create( {"name": "Product for test", "default_code": "TESTPROD01"} ) cls.partner = cls.env["res.partner"].create( { "name": "Partner for test", "property_product_pricelist": cls.pricelist.id, } ) cls.wiz_obj = cls.env["product.catalog.print"] def test_defaults(self): wiz = self.wiz_obj.new() res = wiz.with_context( active_model="product.pricelist", active_id=self.pricelist.id ).default_get([]) self.assertEqual(res["pricelist_id"], self.pricelist.id) res = wiz.with_context( active_model="res.partner", active_id=self.partner.id ).default_get([]) self.assertEqual( res["pricelist_id"], self.partner.property_product_pricelist.id ) res = wiz.with_context( active_model="product.template", active_ids=self.product.product_tmpl_id.ids, ).default_get([]) self.assertEqual( res["product_tmpl_ids"][0][2], self.product.product_tmpl_id.ids ) res = wiz.with_context( active_model="product.product", active_ids=self.product.ids ).default_get([]) self.assertEqual(res["product_ids"][0][2], self.product.ids) self.assertTrue(res["show_variants"]) with self.assertRaises(ValidationError): wiz.print_report() wiz.show_sale_price = True res = wiz.print_report() self.assertIn("report_name", res)
openbig/saleorderdetails
product_catalog_print/tests/test_product_catalog_print.py
Python
agpl-3.0
2,074
#!/usr/bin/env python from distutils.core import setup setup(name='wrabbit', version='0.1', description='warren rabbitmq wrapper', author='Jeremiah Campbell', author_email='[email protected]', url='https://github.com/warrenprotocol/wrabbit', download_url='https://github.com/warrenprotocol/wrabbit/tarball/0.1', license='MIT', packages=['wrabbit',], classifiers=[ 'Programming Language :: Python :: 2.7', 'License :: OSI Approved :: MIT License', 'Development Status :: 4 - Beta' ], )
meantheory/wrabbit
setup.py
Python
mit
572
"""Implements a Deep Belief Network.""" from dbm import * class DBN(DBM): def __init__(self, net, t_op=None, e_op=None): rbm, upward_net, downward_net, junction_layers = DBN.SplitDBN(net) self.rbm = DBM(rbm, t_op, e_op) self.upward_net = NeuralNet(upward_net, t_op, e_op) self.downward_net = NeuralNet(downward_net, t_op, e_op) self.junction_layers = junction_layers self.net = self.rbm.net self.t_op = self.rbm.t_op self.e_op = self.rbm.e_op self.verbose = self.rbm.verbose self.batchsize = self.t_op.batchsize def CopyModelToCPU(self): self.rbm.CopyModelToCPU() def DeepCopy(self): return CopyModel(self.rbm.net) def Show(self): """Visualize the state of the layers and edges in the network.""" self.rbm.Show() self.upward_net.Show() self.downward_net.Show() def PrintNetwork(self): print 'RBM:' self.rbm.PrintNetwork() print 'Up:' self.upward_net.PrintNetwork() print 'Down:' self.downward_net.PrintNetwork() def ExchangeGlobalInfo(self): for layer in self.rbm.layer: layer.GetGlobalInfo(self) for edge in self.rbm.edge: edge.GetGlobalInfo(self) @staticmethod def SplitDBN(net): #net = ReadModel(dbn_file) rbm = deepnet_pb2.Model() rbm.CopyFrom(net) rbm.name = '%s_rbm' % net.name rbm.model_type = deepnet_pb2.Model.DBM directed_edges = [] undirected_edges = [] layer1 = set() # Layers that are touched by directed edges. layer2 = set() # Layers that are touched by undirected edges. for e in net.edge: if e.directed: directed_edges.append(e) layer1.add(e.node1) layer1.add(e.node2) else: undirected_edges.append(e) layer2.add(e.node1) layer2.add(e.node2) junction_layers = list(layer1.intersection(layer2)) # CONTRUCT RBM. del rbm.edge[:] for e in undirected_edges: rbm.edge.extend([e]) del rbm.layer[:] for node in list(layer2): l = next(l for l in net.layer if l.name == node) layer = rbm.layer.add() layer.CopyFrom(l) if node in junction_layers: layer.is_input = True del layer.param[:] for p in l.param: if p.name == 'bias': continue elif p.name == 'bias_generative': p_copy = layer.param.add() p_copy.CopyFrom(p) p_copy.name = 'bias' else: layer.param.extend([p]) # CONSTRUCT DOWNNARD NET. down_net = deepnet_pb2.Model() down_net.CopyFrom(net) down_net.name = '%s_downward_net' % net.name down_net.model_type = deepnet_pb2.Model.FEED_FORWARD_NET del down_net.edge[:] for e in directed_edges: down_net.edge.extend([e]) del down_net.layer[:] for node in list(layer1): l = next(l for l in net.layer if l.name == node) layer_down = down_net.layer.add() layer_down.CopyFrom(l) if l.is_input: layer_down.is_input = False if node in junction_layers: layer_down.is_input = True del layer_down.param[:] for p in l.param: if p.name == 'bias': continue elif p.name == 'bias_generative': p_copy = layer_down.param.add() p_copy.CopyFrom(p) p_copy.name = 'bias' else: layer_down.param.extend([p]) # CONSTRUCT UPWARD NET. up_net = deepnet_pb2.Model() up_net.CopyFrom(net) up_net.name = '%s_upward_net' % net.name up_net.model_type = deepnet_pb2.Model.FEED_FORWARD_NET del up_net.edge[:] for e in directed_edges: e_up = DBN.ReverseEdge(e) up_net.edge.extend([e_up]) del up_net.layer[:] for node in list(layer1): l = next(l for l in net.layer if l.name == node) layer_up = up_net.layer.add() layer_up.CopyFrom(l) del layer_up.param[:] for p in l.param: if p.name == 'bias_generative': continue else: layer_up.param.extend([p]) return rbm, up_net, down_net, junction_layers @staticmethod def ReverseEdge(e): rev_e = deepnet_pb2.Edge() rev_e.CopyFrom(e) rev_e.node1 = e.node2 rev_e.node2 = e.node1 rev_e.up_factor = e.down_factor rev_e.down_factor = e.up_factor for p in rev_e.param: if p.name == 'weight': if p.initialization == deepnet_pb2.Parameter.PRETRAINED: p.transpose_pretrained = not p.transpose_pretrained elif p.mat: mat = ParameterAsNumpy(p).T p.mat = NumpyAsParameter(mat) del p.dimensions for dim in mat.shape: p.dimensions.add(dim) return rev_e def LoadModelOnGPU(self, *args, **kwargs): self.rbm.LoadModelOnGPU(*args, **kwargs) self.upward_net.LoadModelOnGPU(*args, **kwargs) self.downward_net.LoadModelOnGPU(*args, **kwargs) self.TieUpNets() def TieUpNets(self): # Tie up nets. for layer_name in self.junction_layers: rbm_layer = next(l for l in self.rbm.layer if l.name == layer_name) up_layer = next(l for l in self.upward_net.layer if l.name == layer_name) down_layer = next(l for l in self.downward_net.layer if l.name == layer_name) rbm_layer.data = up_layer.state down_layer.data = rbm_layer.state def ResetBatchsize(self, batchsize): self.batchsize = batchsize self.rbm.ResetBatchsize(batchsize) self.upward_net.ResetBatchsize(batchsize) self.downward_net.ResetBatchsize(batchsize) self.TieUpNets() def SetUpData(self, *args, **kwargs): self.upward_net.SetUpData(*args, **kwargs) self.train_data_handler = self.upward_net.train_data_handler self.validation_data_handler = self.upward_net.validation_data_handler self.test_data_handler = self.upward_net.test_data_handler def GetBatch(self, handler=None): if handler: data_list = handler.Get() if data_list[0].shape[1] != self.batchsize: self.ResetBatchsize(data_list[0].shape[1]) for i, layer in enumerate(self.upward_net.datalayer): layer.SetData(data_list[i]) for layer in self.upward_net.tied_datalayer: layer.SetData(layer.tied_to.data) def TrainOneBatch(self, step): self.upward_net.ForwardPropagate(train=True, step=step) return self.rbm.TrainOneBatch(step) def PositivePhase(self, train=False, evaluate=False, step=0): self.upward_net.ForwardPropagate(train=train, step=step) return self.rbm.PositivePhase(train=train, evaluate=evaluate, step=step) #self.downward_net.ForwardPropagate(train=train, step=step) def NegativePhase(self, *args, **kwargs): return self.rbm.NegativePhase(*args, **kwargs) def Inference(self, steps, layernames, unclamped_layers, output_dir, memory='1G', dataset='test', method='gibbs'): layers_to_infer = [self.GetLayerByName(l, down=True) for l in layernames] layers_to_unclamp = [self.GetLayerByName(l) for l in unclamped_layers] numdim_list = [layer.state.shape[0] for layer in layers_to_infer] upward_net_unclamped_inputs = [] for l in layers_to_unclamp: l.is_input = False l.is_initialized = True if l in self.rbm.layer: self.rbm.pos_phase_order.append(l) else: upward_net_unclamped_inputs.append(l) if dataset == 'train': datagetter = self.GetTrainBatch if self.train_data_handler is None: return numbatches = self.train_data_handler.num_batches size = numbatches * self.train_data_handler.batchsize elif dataset == 'validation': datagetter = self.GetValidationBatch if self.validation_data_handler is None: return numbatches = self.validation_data_handler.num_batches size = numbatches * self.validation_data_handler.batchsize elif dataset == 'test': datagetter = self.GetTestBatch if self.test_data_handler is None: return numbatches = self.test_data_handler.num_batches size = numbatches * self.test_data_handler.batchsize dw = DataWriter(layernames, output_dir, memory, numdim_list, size) gibbs = method == 'gibbs' mf = method == 'mf' for batch in range(numbatches): sys.stdout.write('\r%d' % (batch+1)) sys.stdout.flush() datagetter() for l in upward_net_unclamped_inputs: l.data.assign(0) self.upward_net.ForwardPropagate() for node in self.rbm.node_list: if node.is_input or node.is_initialized: node.GetData() if gibbs: node.sample.assign(node.state) else: node.ResetState(rand=False) for i in range(steps): for node in self.rbm.pos_phase_order: self.ComputeUp(node, use_samples=gibbs) if gibbs: node.Sample() self.downward_net.ForwardPropagate() output = [l.state.asarray().T for l in layers_to_infer] dw.Submit(output) sys.stdout.write('\n') size = dw.Commit() return size[0] def GetLayerByName(self, layername, down=False): layer = self.rbm.GetLayerByName(layername) if layer is None: if down: layer = self.downward_net.GetLayerByName(layername) else: layer = self.upward_net.GetLayerByName(layername) return layer
abdulqayyum/deepnet
deepnet/dbn.py
Python
bsd-3-clause
9,260
"""Users and groups. """ __docformat__ = 'restructuredtext en' from .utils import * from .enums import * class User(Cached): """Represents a Skype user. """ _ValidateHandle = str def __repr__(self): return Cached.__repr__(self, 'Handle') def _Property(self, PropName, Set=None, Cache=True): return self._Owner._Property('USER', self.Handle, PropName, Set, Cache) def SaveAvatarToFile(self, Filename, AvatarId=1): """Saves user avatar to a file. :Parameters: Filename : str Destination path. AvatarId : int Avatar Id. """ s = 'USER %s AVATAR %s %s' % (self.Handle, AvatarId, path2unicode(Filename)) self._Owner._DoCommand('GET %s' % s, s) def SetBuddyStatusPendingAuthorization(self, Text=''): """Sets the BuddyStaus property to `enums.budPendingAuthorization` additionally specifying the authorization text. :Parameters: Text : unicode The authorization text. :see: `BuddyStatus` """ self._Property('BUDDYSTATUS', '%d %s' % (budPendingAuthorization, tounicode(Text)), Cache=False) def _GetAbout(self): return self._Property('ABOUT') About = property(_GetAbout, doc="""About text of the user. :type: unicode """) def _GetAliases(self): return split(self._Property('ALIASES')) Aliases = property(_GetAliases, doc="""Aliases of the user. :type: list of str """) def _GetBirthday(self): value = self._Property('BIRTHDAY') if len(value) == 8: from datetime import date from time import strptime return date(*strptime(value, '%Y%m%d')[:3]) Birthday = property(_GetBirthday, doc="""Birthday of the user. None if not set. :type: datetime.date or None """) def _GetBuddyStatus(self): return int(self._Property('BUDDYSTATUS')) def _SetBuddyStatus(self, Value): self._Property('BUDDYSTATUS', int(Value), Cache=False) BuddyStatus = property(_GetBuddyStatus, _SetBuddyStatus, doc="""Buddy status of the user. :type: `enums`.bud* """) def _GetCanLeaveVoicemail(self): return (self._Property('CAN_LEAVE_VM') == 'TRUE') CanLeaveVoicemail = property(_GetCanLeaveVoicemail, doc="""Tells if it is possible to send voicemail to the user. :type: bool """) def _GetCity(self): return self._Property('CITY') City = property(_GetCity, doc="""City of the user. :type: unicode """) def _GetCountry(self): value = self._Property('COUNTRY') if value: if self._Owner.Protocol >= 4: value = chop(value)[-1] return value Country = property(_GetCountry, doc="""Country of the user. :type: unicode """) def _GetCountryCode(self): if self._Owner.Protocol < 4: return '' value = self._Property('COUNTRY') if value: value = chop(value)[0] return str(value) CountryCode = property(_GetCountryCode, doc="""ISO country code of the user. :type: str """) def _GetDisplayName(self): return self._Property('DISPLAYNAME') def _SetDisplayName(self, Value): self._Property('DISPLAYNAME', Value) DisplayName = property(_GetDisplayName, _SetDisplayName, doc="""Display name of the user. :type: unicode """) def _GetHandle(self): return self._Handle Handle = property(_GetHandle, doc="""Skypename of the user. :type: str """) def _GetFullName(self): return self._Property('FULLNAME') FullName = property(_GetFullName, doc="""Full name of the user. :type: unicode """) def _GetHasCallEquipment(self): return self._Property('HASCALLEQUIPMENT') == 'TRUE' HasCallEquipment = property(_GetHasCallEquipment, doc="""Tells if the user has call equipment. :type: bool """) def _GetHomepage(self): return self._Property('HOMEPAGE') Homepage = property(_GetHomepage, doc="""Homepage URL of the user. :type: unicode """) def _GetIsAuthorized(self): return (self._Property('ISAUTHORIZED') == 'TRUE') def _SetIsAuthorized(self, Value): self._Property('ISAUTHORIZED', cndexp(Value, 'TRUE', 'FALSE')) IsAuthorized = property(_GetIsAuthorized, _SetIsAuthorized, doc="""Tells if the user is authorized to contact us. :type: bool """) def _GetIsBlocked(self): return (self._Property('ISBLOCKED') == 'TRUE') def _SetIsBlocked(self, Value): self._Property('ISBLOCKED', cndexp(Value, 'TRUE', 'FALSE')) IsBlocked = property(_GetIsBlocked, _SetIsBlocked, doc="""Tells whether this user is blocked or not. :type: bool """) def _GetIsCallForwardActive(self): return (self._Property('IS_CF_ACTIVE') == 'TRUE') IsCallForwardActive = property(_GetIsCallForwardActive, doc="""Tells whether the user has Call Forwarding activated or not. :type: bool """) def _GetIsSkypeOutContact(self): return (self.OnlineStatus == olsSkypeOut) IsSkypeOutContact = property(_GetIsSkypeOutContact, doc="""Tells whether a user is a SkypeOut contact. :type: bool """) def _GetIsVideoCapable(self): return (self._Property('IS_VIDEO_CAPABLE') == 'TRUE') IsVideoCapable = property(_GetIsVideoCapable, doc="""Tells if the user has video capability. :type: bool """) def _GetIsVoicemailCapable(self): return (self._Property('IS_VOICEMAIL_CAPABLE') == 'TRUE') IsVoicemailCapable = property(_GetIsVoicemailCapable, doc="""Tells if the user has voicemail capability. :type: bool """) def _GetLanguage(self): value = self._Property('LANGUAGE') if value: if self._Owner.Protocol >= 4: value = chop(value)[-1] return value Language = property(_GetLanguage, doc="""The language of the user. :type: unicode """) def _GetLanguageCode(self): if self._Owner.Protocol < 4: return '' value = self._Property('LANGUAGE') if value: value = chop(value)[0] return str(value) LanguageCode = property(_GetLanguageCode, doc="""The ISO language code of the user. :type: str """) def _GetLastOnline(self): return float(self._Property('LASTONLINETIMESTAMP')) LastOnline = property(_GetLastOnline, doc="""The time when a user was last online as a timestamp. :type: float :see: `LastOnlineDatetime` """) def _GetLastOnlineDatetime(self): from datetime import datetime return datetime.fromtimestamp(self.LastOnline) LastOnlineDatetime = property(_GetLastOnlineDatetime, doc="""The time when a user was last online as a datetime. :type: datetime.datetime :see: `LastOnline` """) def _GetMoodText(self): return self._Property('MOOD_TEXT') MoodText = property(_GetMoodText, doc="""Mood text of the user. :type: unicode """) def _GetNumberOfAuthBuddies(self): return int(self._Property('NROF_AUTHED_BUDDIES')) NumberOfAuthBuddies = property(_GetNumberOfAuthBuddies, doc="""Number of authenticated buddies in user's contact list. :type: int """) def _GetOnlineStatus(self): return str(self._Property('ONLINESTATUS')) OnlineStatus = property(_GetOnlineStatus, doc="""Online status of the user. :type: `enums`.ols* """) def _GetPhoneHome(self): return self._Property('PHONE_HOME') PhoneHome = property(_GetPhoneHome, doc="""Home telephone number of the user. :type: unicode """) def _GetPhoneMobile(self): return self._Property('PHONE_MOBILE') PhoneMobile = property(_GetPhoneMobile, doc="""Mobile telephone number of the user. :type: unicode """) def _GetPhoneOffice(self): return self._Property('PHONE_OFFICE') PhoneOffice = property(_GetPhoneOffice, doc="""Office telephone number of the user. :type: unicode """) def _GetProvince(self): return self._Property('PROVINCE') Province = property(_GetProvince, doc="""Province of the user. :type: unicode """) def _GetReceivedAuthRequest(self): return self._Property('RECEIVEDAUTHREQUEST') ReceivedAuthRequest = property(_GetReceivedAuthRequest, doc="""Text message for authorization request. Available only when user asks for authorization. :type: unicode """) def _GetRichMoodText(self): return self._Property('RICH_MOOD_TEXT') RichMoodText = property(_GetRichMoodText, doc="""Advanced version of `MoodText`. :type: unicode :see: https://developer.skype.com/Docs/ApiDoc/SET_PROFILE_RICH_MOOD_TEXT """) def _GetSex(self): return str(self._Property('SEX')) Sex = property(_GetSex, doc="""Sex of the user. :type: `enums`.usex* """) def _GetSpeedDial(self): return self._Property('SPEEDDIAL') def _SetSpeedDial(self, Value): self._Property('SPEEDDIAL', Value) SpeedDial = property(_GetSpeedDial, _SetSpeedDial, doc="""Speed-dial code assigned to the user. :type: unicode """) def _GetTimezone(self): return int(self._Property('TIMEZONE')) Timezone = property(_GetTimezone, doc="""Timezone of the user in minutes from GMT. :type: int """) class UserCollection(CachedCollection): _CachedType = User class Group(Cached): """Represents a group of Skype users. """ _ValidateHandle = int def __repr__(self): return Cached.__repr__(self, 'Id') def _Alter(self, AlterName, Args=None): return self._Owner._Alter('GROUP', self.Id, AlterName, Args) def _Property(self, PropName, Value=None, Cache=True): return self._Owner._Property('GROUP', self.Id, PropName, Value, Cache) def Accept(self): """Accepts an invitation to join a shared contact group. """ self._Alter('ACCEPT') def AddUser(self, Username): """Adds new a user to the group. :Parameters: Username : str Skypename of the new user. """ self._Alter('ADDUSER', Username) def Decline(self): """Declines an invitation to join a shared contact group. """ self._Alter('DECLINE') def RemoveUser(self, Username): """Removes a user from the group. :Parameters: Username : str Skypename of the user. """ self._Alter('REMOVEUSER', Username) def Share(self, MessageText=''): """Shares a contact group. :Parameters: MessageText : unicode Message text for group members. """ self._Alter('SHARE', MessageText) def _GetCustomGroupId(self): return str(self._Property('CUSTOM_GROUP_ID')) CustomGroupId = property(_GetCustomGroupId, doc="""Persistent group ID. The custom group ID is a persistent value that does not change. :type: str """) def _GetDisplayName(self): return self._Property('DISPLAYNAME') def _SetDisplayName(self, Value): self._Property('DISPLAYNAME', Value) DisplayName = property(_GetDisplayName, _SetDisplayName, doc="""Display name of the group. :type: unicode """) def _GetId(self): return self._Handle Id = property(_GetId, doc="""Group Id. :type: int """) def _GetIsExpanded(self): return self._Property('EXPANDED') == 'TRUE' IsExpanded = property(_GetIsExpanded, doc="""Tells if the group is expanded in the client. :type: bool """) def _GetIsVisible(self): return self._Property('VISIBLE') == 'TRUE' IsVisible = property(_GetIsVisible, doc="""Tells if the group is visible in the client. :type: bool """) def _GetOnlineUsers(self): return UserCollection(self._Owner, (x.Handle for x in self.Users if x.OnlineStatus == olsOnline)) OnlineUsers = property(_GetOnlineUsers, doc="""Users of the group that are online :type: `UserCollection` """) def _GetType(self): return str(self._Property('TYPE')) Type = property(_GetType, doc="""Group type. :type: `enums`.grp* """) def _GetUsers(self): return UserCollection(self._Owner, split(self._Property('USERS', Cache=False), ', ')) Users = property(_GetUsers, doc="""Users in this group. :type: `UserCollection` """) class GroupCollection(CachedCollection): _CachedType = Group
FloatingGhost/skype4py
Skype4Py/user.py
Python
bsd-3-clause
12,859
# Copyright 2018 Capital One Services, LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from datetime import datetime, timedelta import time from c7n.config import Bag from c7n.output import metrics_outputs from c7n_gcp.output import StackDriverMetrics from gcp_common import BaseTest class MetricsOutputTest(BaseTest): def test_metrics_selector(self): self.assertEqual( metrics_outputs.get('gcp'), StackDriverMetrics) def test_metrics_output(self): project_id = 'cloud-custodian' factory = self.replay_flight_data('output-metrics', project_id=project_id) ctx = Bag(session_factory=factory, policy=Bag(name='custodian-works', resource_type='gcp.function')) conf = Bag() metrics = StackDriverMetrics(ctx, conf) metrics.put_metric('ResourceCount', 43, 'Count', Scope='Policy') metrics.flush() if self.recording: time.sleep(42) session = factory() client = session.client('monitoring', 'v3', 'projects.timeSeries') results = client.execute_command( 'list', { 'name': 'projects/{}'.format(project_id), 'filter': 'metric.type="custom.googleapis.com/custodian/policy/resourcecount"', 'pageSize': 3, 'interval_startTime': ( datetime.utcnow() - timedelta(minutes=5)).isoformat('T') + 'Z', 'interval_endTime': datetime.utcnow().isoformat('T') + 'Z' }) self.assertEqual( results['timeSeries'], [{u'metric': { u'labels': { u'policy': u'custodian-works', u'project_id': u'cloud-custodian'}, u'type': u'custom.googleapis.com/custodian/policy/resourcecount'}, u'metricKind': u'GAUGE', u'points': [{ u'interval': { u'endTime': u'2018-08-12T22:30:53.524505Z', u'startTime': u'2018-08-12T22:30:53.524505Z'}, u'value': {u'int64Value': u'43'}}], u'resource': { u'labels': {u'project_id': u'cloud-custodian'}, u'type': u'global'}, u'valueType': u'INT64'}]) def test_metrics_output_set_write_project_id(self): project_id = 'cloud-custodian-sub' write_project_id = 'cloud-custodian' factory = self.replay_flight_data('output-metrics', project_id=project_id) ctx = Bag(session_factory=factory, policy=Bag(name='custodian-works', resource_type='gcp.function')) conf = Bag(project_id=write_project_id) metrics = StackDriverMetrics(ctx, conf) metrics.put_metric('ResourceCount', 43, 'Count', Scope='Policy') metrics.flush()
Sutto/cloud-custodian
tools/c7n_gcp/tests/test_output_gcp.py
Python
apache-2.0
3,349
""" ============================================= Effect of varying threshold for self-training ============================================= This example illustrates the effect of a varying threshold on self-training. The `breast_cancer` dataset is loaded, and labels are deleted such that only 50 out of 569 samples have labels. A `SelfTrainingClassifier` is fitted on this dataset, with varying thresholds. The upper graph shows the amount of labeled samples that the classifier has available by the end of fit, and the accuracy of the classifier. The lower graph shows the last iteration in which a sample was labeled. All values are cross validated with 3 folds. At low thresholds (in [0.4, 0.5]), the classifier learns from samples that were labeled with a low confidence. These low-confidence samples are likely have incorrect predicted labels, and as a result, fitting on these incorrect labels produces a poor accuracy. Note that the classifier labels almost all of the samples, and only takes one iteration. For very high thresholds (in [0.9, 1)) we observe that the classifier does not augment its dataset (the amount of self-labeled samples is 0). As a result, the accuracy achieved with a threshold of 0.9999 is the same as a normal supervised classifier would achieve. The optimal accuracy lies in between both of these extremes at a threshold of around 0.7. """ print(__doc__) # Authors: Oliver Rausch <[email protected]> # License: BSD import numpy as np import matplotlib.pyplot as plt from sklearn import datasets from sklearn.svm import SVC from sklearn.model_selection import StratifiedKFold from sklearn.semi_supervised import SelfTrainingClassifier from sklearn.metrics import accuracy_score from sklearn.utils import shuffle n_splits = 3 X, y = datasets.load_breast_cancer(return_X_y=True) X, y = shuffle(X, y, random_state=42) y_true = y.copy() y[50:] = -1 total_samples = y.shape[0] base_classifier = SVC(probability=True, gamma=0.001, random_state=42) x_values = np.arange(0.4, 1.05, 0.05) x_values = np.append(x_values, 0.99999) scores = np.empty((x_values.shape[0], n_splits)) amount_labeled = np.empty((x_values.shape[0], n_splits)) amount_iterations = np.empty((x_values.shape[0], n_splits)) for (i, threshold) in enumerate(x_values): self_training_clf = SelfTrainingClassifier(base_classifier, threshold=threshold) # We need manual cross validation so that we don't treat -1 as a separate # class when computing accuracy skfolds = StratifiedKFold(n_splits=n_splits) for fold, (train_index, test_index) in enumerate(skfolds.split(X, y)): X_train = X[train_index] y_train = y[train_index] X_test = X[test_index] y_test = y[test_index] y_test_true = y_true[test_index] self_training_clf.fit(X_train, y_train) # The amount of labeled samples that at the end of fitting amount_labeled[i, fold] = total_samples - np.unique( self_training_clf.labeled_iter_, return_counts=True)[1][0] # The last iteration the classifier labeled a sample in amount_iterations[i, fold] = np.max(self_training_clf.labeled_iter_) y_pred = self_training_clf.predict(X_test) scores[i, fold] = accuracy_score(y_test_true, y_pred) ax1 = plt.subplot(211) ax1.errorbar(x_values, scores.mean(axis=1), yerr=scores.std(axis=1), capsize=2, color='b') ax1.set_ylabel('Accuracy', color='b') ax1.tick_params('y', colors='b') ax2 = ax1.twinx() ax2.errorbar(x_values, amount_labeled.mean(axis=1), yerr=amount_labeled.std(axis=1), capsize=2, color='g') ax2.set_ylim(bottom=0) ax2.set_ylabel('Amount of labeled samples', color='g') ax2.tick_params('y', colors='g') ax3 = plt.subplot(212, sharex=ax1) ax3.errorbar(x_values, amount_iterations.mean(axis=1), yerr=amount_iterations.std(axis=1), capsize=2, color='b') ax3.set_ylim(bottom=0) ax3.set_ylabel('Amount of iterations') ax3.set_xlabel('Threshold') plt.show()
glemaitre/scikit-learn
examples/semi_supervised/plot_self_training_varying_threshold.py
Python
bsd-3-clause
4,072
# -*- encoding: utf-8 -*- import pytest from django.core.files.uploadedfile import SimpleUploadedFile from django.core.urlresolvers import reverse from block.models import ( BlockError, Document, Link, Url, ) from block.tests.factories import ( DocumentFactory, LinkCategory, LinkCategoryFactory, LinkFactory, PageFactory, UrlFactory, ) from login.tests.factories import ( TEST_PASSWORD, UserFactory, ) @pytest.mark.django_db def test_category_create(client): user = UserFactory(is_staff=True) assert client.login(username=user.username, password=TEST_PASSWORD) is True url = reverse('block.link.category.create') data = { 'name': 'Tennis', } response = client.post(url, data) # check assert 302 == response.status_code expect = reverse('block.link.category.list') assert expect in response['Location'] categories = LinkCategory.objects.all() assert 1 == categories.count() assert 'Tennis' == categories[0].name @pytest.mark.django_db def test_category_delete(client): user = UserFactory(is_staff=True) assert client.login(username=user.username, password=TEST_PASSWORD) is True category = LinkCategoryFactory() assert category.deleted is False # test url = reverse('block.link.category.delete', args=[category.pk]) response = client.post(url) # check assert 302 == response.status_code expect = reverse('block.link.category.list') assert expect in response['Location'] category.refresh_from_db() assert category.deleted is True @pytest.mark.django_db def test_category_delete_exception(client): """Should not delete a category which is in use.""" user = UserFactory(is_staff=True) assert client.login(username=user.username, password=TEST_PASSWORD) is True category = LinkCategoryFactory() LinkFactory(category=category) assert category.deleted is False # test url = reverse('block.link.category.delete', args=[category.pk]) with pytest.raises(BlockError) as e: client.post(url) assert 'Cannot delete a link category which is in use' in str(e.value) @pytest.mark.django_db def test_category_update(client): user = UserFactory(is_staff=True) assert client.login(username=user.username, password=TEST_PASSWORD) is True category = LinkCategoryFactory() url = reverse('block.link.category.update', args=[category.pk]) data = { 'name': 'Cricket', } response = client.post(url, data) # check assert 302 == response.status_code expect = reverse('block.link.category.list') assert expect in response['Location'] category.refresh_from_db() assert 'Cricket' == category.name @pytest.mark.django_db def test_link_delete(client): user = UserFactory(is_staff=True) assert client.login( username=user.username, password=TEST_PASSWORD ) is True link_1 = LinkFactory() link_2 = LinkFactory() link_3 = LinkFactory() url = reverse('block.link.delete', args=[link_2.pk]) data = {} response = client.post(url, data) # check assert 302 == response.status_code expect = reverse('block.link.list') assert expect in response['Location'] result = [link.pk for link in Link.objects.links()] assert [link_1.pk, link_3.pk] == result @pytest.mark.django_db def test_link_external_update(client): user = UserFactory(is_staff=True) assert client.login(username=user.username, password=TEST_PASSWORD) is True link = LinkFactory(link_type='u', url_external="https://google.com") url = reverse('block.link.external.update', args=[link.pk]) data = { 'title': 'Football', 'url_external': 'http://www.bbc.co.uk/sport/football' } response = client.post(url, data) # check assert 302 == response.status_code expect = reverse('block.link.list') assert expect in response['Location'] link.refresh_from_db() assert 'Football' == link.title assert 'http://www.bbc.co.uk/sport/football' == link.url @pytest.mark.django_db def test_link_internal_update(client): user = UserFactory(is_staff=True) assert client.login(username=user.username, password=TEST_PASSWORD) is True link = LinkFactory(link_type='r', url_internal=UrlFactory()) url = reverse('block.link.internal.update', args=[link.pk]) page = PageFactory(slug='football', slug_menu='') new_url = UrlFactory(url_type=Url.PAGE, page=page) data = { 'title': 'Football', 'url_internal': new_url.pk } response = client.post(url, data) # check assert 302 == response.status_code expect = reverse('block.link.list') assert expect in response['Location'] link.refresh_from_db() assert 'Football' == link.title assert '/football/' == link.url def test_file(): """create a file ready to upload.""" return SimpleUploadedFile.from_dict( dict(filename='test.txt', content=bytes('abc', 'UTF-8')) ) @pytest.mark.django_db def test_link_document_create(client): category = LinkCategoryFactory() DocumentFactory() # image = ImageFactory() user = UserFactory(is_staff=True) assert client.login(username=user.username, password=TEST_PASSWORD) is True url = reverse('block.link.document.create') # create a document ready to upload data = { 'category': category.pk, 'document': test_file(), 'title': 'Cricket', } response = client.post(url, data) # check expect = reverse('block.link.list') assert 302 == response.status_code assert expect in response['Location'] link = Link.objects.get(title='Cricket') assert 'Cricket' == link.title assert category == link.category assert link.document.deleted is False # check a document has been added to the database assert 2 == Document.objects.count() @pytest.mark.django_db def test_link_document_update(client): category = LinkCategoryFactory() DocumentFactory() link = LinkFactory(link_type=Link.DOCUMENT, document=DocumentFactory()) user = UserFactory(is_staff=True) assert client.login(username=user.username, password=TEST_PASSWORD) is True url = reverse('block.link.document.update', args=[link.pk]) # create a document ready to upload data = { 'category': category.pk, 'document': test_file(), 'title': 'Cricket', } response = client.post(url, data) # check expect = reverse('block.link.list') assert 302 == response.status_code assert expect in response['Location'] link = Link.objects.get(title='Cricket') assert 'Cricket' == link.title assert category == link.category assert 'test.txt' == link.file_name assert link.document.deleted is False # test for partial name only assert "/media/link/document/test" in link.url # check a document has been added to the database assert 2 == Document.objects.count() @pytest.mark.django_db def test_link_redirect(client): ext_url = "http://example.com" link = LinkFactory(link_type=Link.URL_EXTERNAL, url_external=ext_url) user = UserFactory() assert client.login(username=user.username, password=TEST_PASSWORD) url = reverse('block.link.follow', args=[link.link_type, link.pk]) response = client.get(url) # check assert 302 == response.status_code assert ext_url in response['Location'] @pytest.mark.django_db def test_link_redirect_invalid(client): ext_url = "http://example.com" link = LinkFactory(link_type=Link.URL_EXTERNAL, url_external=ext_url) user = UserFactory() assert client.login(username=user.username, password=TEST_PASSWORD) # type should be 'u' in this case so 'd' will raise a 404 url = reverse('block.link.follow', args=['d', link.pk]) response = client.get(url) # check assert 404 == response.status_code
pkimber/block
block/tests/test_view_link_library.py
Python
apache-2.0
7,936
import os.path import os from PyQt4.QtCore import * from PyQt4.QtGui import * from utils import log, info, warning, error from qgis.gui import QgsMessageBar class DialogProvider(QObject): """ A class to handle opening user form and creating all the required bindings @note: There is a little too much work in this class. Needs a bit of a clean up. """ accepted = pyqtSignal() rejected = pyqtSignal() def __init__(self, canvas, iface): QObject.__init__(self) self.canvas = canvas self.iface = iface def openDialog(self, feature, layer, mandatory_fields=True): """ Opens a form for the given feature @refactor: This really needs to be cleaned up. """ self.dialog = self.iface.getFeatureForm(layer, feature) self.layer = layer self.dialog.accepted.connect(self.accepted) self.dialog.rejected.connect(self.rejected) self.dialog.setModal(True) fullscreen = self.dialog.property('fullscreen') if fullscreen: self.dialog.setWindowState(Qt.WindowFullScreen) if self.dialog.exec_(): for value in feature.attributes(): info("New value {}".format(value)) if feature.id() > 0: self.layer.updateFeature(feature) else: self.layer.addFeature(feature) saved = self.layer.commitChanges() if not saved: self.iface.messageBar().pushMessage("Error", "Error in saving changes. Contact administrator ", QgsMessageBar.CRITICAL) for e in self.layer.commitErrors(): error(e) else: self.iface.messageBar().pushMessage("Saved","Changes saved", QgsMessageBar.INFO, 2) self.canvas.refresh() else: self.layer.rollBack() self.layer.startEditing() def selectingFromMap(self, message): """ Put QMap in the select feature from map mode Hides the dialog and shows the user a message """ self.dialog.hide() label = QLabel() label.setText(message) label.setStyleSheet('font: 75 30pt "MS Shell Dlg 2";color: rgb(231, 175, 62);') self.item = self.canvas.scene().addWidget(label) self.disableToolbars() def featureSelected(self): """ Called once a feature has been selected. Shows the dialog back to the user. """ self.canvas.scene().removeItem(self.item) self.dialog.show() self.enableToolbars() def moveImages(self): """ Not currently working """ # After we commit we have to move the drawing into the correct path. # TODO Use a custom field for the id name # Images are saved under data/{layername}/images/{id}_{fieldname} raise NotImplementedError for image in self.binder.images.itervalues(): curdir = os.path.dirname(__file__) id = self.feature.attributeMap()[self.layer.fieldNameIndex("UniqueID")].toString().toUpper() log(id) name = image.replace("drawingFor_", id + "_" ) imagename = os.path.join(curdir, "data", str(self.layer.name()), "images", \ os.path.basename(name)) path = os.path.dirname(imagename) if not os.path.exists(path): os.makedirs(path) log(image) log(imagename) try: os.rename(image, imagename) except WindowsError, err: os.remove(imagename) os.rename(image, imagename) def disableToolbars(self): """ Disable the toolbars in the main interface. @refactor: Should be moved into qmap.py """ toolbars = self.iface.mainWindow().findChildren(QToolBar) for toolbar in toolbars: toolbar.setEnabled(False) def enableToolbars(self): """ Enable the toolbars in the main interface. @refactor: Should be moved into qmap.py """ toolbars = self.iface.mainWindow().findChildren(QToolBar) for toolbar in toolbars: toolbar.setEnabled(True)
NathanW2/qmap
src/qmap/dialog_provider.py
Python
gpl-2.0
4,539
""" SpaceHub Copyright (C) 2013 Ryan Brown <[email protected]>, Sam Lucidi <[email protected]>, Ross Delinger <[email protected]>, Greg Jurman <[email protected]> This program is free software: you can redistribute it and/or modify it under the terms of the GNU Affero General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU Affero General Public License for more details. You should have received a copy of the GNU Affero General Public License along with this program. If not, see <http://www.gnu.org/licenses/>. """ from webob import Response, exc import json class _401(exc.HTTPError): def __init__(self, msg='Unauthorized'): body = {'status': 401, 'message': msg} Response.__init__(self, json.dumps(body)) self.status = 401 self.content_type = 'application/json'
ryansb/spacehub
wsgi/spacehub/spacehub/errors.py
Python
agpl-3.0
1,133
# -*-coding:Utf-8 -* # Copyright (c) 2013 LE GOFF Vincent # All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are met: # # * Redistributions of source code must retain the above copyright notice, this # list of conditions and the following disclaimer. # * Redistributions in binary form must reproduce the above copyright notice, # this list of conditions and the following disclaimer in the documentation # and/or other materials provided with the distribution. # * Neither the name of the copyright holder nor the names of its contributors # may be used to endorse or promote products derived from this software # without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" # AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE # IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE # ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE # LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR # CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT # OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS # INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN # CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) # ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE # POSSIBILITY OF SUCH DAMAGE. """Fichier contenant l'ordre Virer.""" from secondaires.navigation.equipage.signaux import * from ..ordre import * class Virer(Ordre): """Ordre virer. Cet ordre demande au matelot de faire virer le navire sur bâbord ou tribord en fonction du besoin, jusqu'à ce qu'il soit dans une certaine direction. Le matelot ciblé doit tenir le gouvernail. """ cle = "virer" etats_autorises = ("tenir_gouvernail", ) def __init__(self, matelot, navire, direction=0): Ordre.__init__(self, matelot, navire, direction) self.direction = direction def executer(self): """Exécute l'ordre : vire sur bâbord.""" navire = self.navire matelot = self.matelot personnage = matelot.personnage salle = personnage.salle direction = self.direction nav_direction = navire.direction.direction if not hasattr(salle, "gouvernail") or salle.gouvernail is None: return gouvernail = salle.gouvernail if gouvernail.tenu is not personnage: yield SignalInutile("je ne tiens pas ce gouvernail") else: par_babord = (nav_direction - direction) % 360 par_tribord = (direction - nav_direction) % 360 if par_tribord < par_babord: cote = 1 else: cote = -1 # On change d'inclinaison du gouvernail si nécessaire direction_actuelle = round(nav_direction) direction_voulue = round(direction) diff = (direction_voulue - direction_actuelle) % 360 if diff > 180: diff = 360 - diff if diff == 0: gouvernail.centrer(personnage) yield SignalTermine() elif diff < 5: orientation = 1 elif diff < 15: orientation = 3 else: orientation = 5 if gouvernail.orientation != cote * orientation: if cote == -1: gouvernail.virer_babord(personnage, orientation, True) else: gouvernail.virer_tribord(personnage, orientation, True) yield SignalRepete(1)
stormi/tsunami
src/secondaires/navigation/equipage/ordres/virer.py
Python
bsd-3-clause
3,807
from django.test import TestCase class CollectionTests(TestCase): pass
takeplace/django-composite
composite/tests/urls.py
Python
bsd-3-clause
77
# -*- coding: utf-8 -*- # # CoAPy documentation build configuration file, created by # sphinx-quickstart on Sat Jul 17 15:46:19 2010. # # This file is execfile()d with the current directory set to its containing dir. # # Note that not all possible configuration values are present in this # autogenerated file. # # All configuration values have a default; values that are commented out # serve to show the default. import sys, os # If extensions (or modules to document with autodoc) are in another directory, # add these directories to sys.path here. If the directory is relative to the # documentation root, use os.path.abspath to make it absolute, like shown here. #sys.path.append(os.path.abspath('.')) # -- General configuration ----------------------------------------------------- # Add any Sphinx extension module names here, as strings. They can be extensions # coming with Sphinx (named 'sphinx.ext.*') or your custom ones. extensions = ['sphinx.ext.autodoc', 'sphinx.ext.todo', 'sphinx.ext.coverage', 'sphinx.ext.intersphinx'] # Add any paths that contain templates here, relative to this directory. templates_path = ['_templates'] # The suffix of source filenames. source_suffix = '.rst' # The encoding of source files. #source_encoding = 'utf-8' # The master toctree document. master_doc = 'index' # General information about the project. project = u'CoAPy' copyright = u'2010, People Power Co.' # The version info for the project you're documenting, acts as replacement for # |version| and |release|, also used in various other places throughout the # built documents. # # The short X.Y version. version = '0.0' # The full version, including alpha/beta/rc tags. release = '0.0.3-DEV' # The language for content autogenerated by Sphinx. Refer to documentation # for a list of supported languages. #language = None # There are two options for replacing |today|: either, you set today to some # non-false value, then it is used: #today = '' # Else, today_fmt is used as the format for a strftime call. #today_fmt = '%B %d, %Y' # List of documents that shouldn't be included in the build. #unused_docs = [] # List of directories, relative to source directory, that shouldn't be searched # for source files. exclude_trees = [ '_build' ] # The reST default role (used for this markup: `text`) to use for all documents. #default_role = None # If true, '()' will be appended to :func: etc. cross-reference text. #add_function_parentheses = True # If true, the current module name will be prepended to all description # unit titles (such as .. function::). #add_module_names = True # If true, sectionauthor and moduleauthor directives will be shown in the # output. They are ignored by default. #show_authors = False # The name of the Pygments (syntax highlighting) style to use. pygments_style = 'sphinx' # A list of ignored prefixes for module index sorting. #modindex_common_prefix = [] # -- Options for HTML output --------------------------------------------------- # The theme to use for HTML and HTML Help pages. Major themes that come with # Sphinx are currently 'default' and 'sphinxdoc'. html_theme = 'default' # Theme options are theme-specific and customize the look and feel of a theme # further. For a list of options available for each theme, see the # documentation. #html_theme_options = {} # Add any paths that contain custom themes here, relative to this directory. #html_theme_path = [] # The name for this set of Sphinx documents. If None, it defaults to # "<project> v<release> documentation". #html_title = None # A shorter title for the navigation bar. Default is the same as html_title. #html_short_title = None # The name of an image file (relative to this directory) to place at the top # of the sidebar. #html_logo = None # The name of an image file (within the static path) to use as favicon of the # docs. This file should be a Windows icon file (.ico) being 16x16 or 32x32 # pixels large. #html_favicon = None # Add any paths that contain custom static files (such as style sheets) here, # relative to this directory. They are copied after the builtin static files, # so a file named "default.css" will overwrite the builtin "default.css". html_static_path = ['_static'] # If not '', a 'Last updated on:' timestamp is inserted at every page bottom, # using the given strftime format. #html_last_updated_fmt = '%b %d, %Y' # If true, SmartyPants will be used to convert quotes and dashes to # typographically correct entities. #html_use_smartypants = True # Custom sidebar templates, maps document names to template names. #html_sidebars = {} # Additional templates that should be rendered to pages, maps page names to # template names. #html_additional_pages = {} # If false, no module index is generated. #html_use_modindex = True # If false, no index is generated. #html_use_index = True # If true, the index is split into individual pages for each letter. #html_split_index = False # If true, links to the reST sources are added to the pages. #html_show_sourcelink = True # If true, an OpenSearch description file will be output, and all pages will # contain a <link> tag referring to it. The value of this option must be the # base URL from which the finished HTML is served. #html_use_opensearch = '' # If nonempty, this is the file name suffix for HTML files (e.g. ".xhtml"). #html_file_suffix = '' # Output file base name for HTML help builder. htmlhelp_basename = 'CoAPydoc' # -- Options for LaTeX output -------------------------------------------------- # The paper size ('letter' or 'a4'). #latex_paper_size = 'letter' # The font size ('10pt', '11pt' or '12pt'). #latex_font_size = '10pt' # Grouping the document tree into LaTeX files. List of tuples # (source start file, target name, title, author, documentclass [howto/manual]). latex_documents = [ ('index', 'CoAPy.tex', u'CoAPy Documentation', u'Peter A. Bigot', 'manual'), ] # The name of an image file (relative to this directory) to place at the top of # the title page. #latex_logo = None # For "manual" documents, if this is true, then toplevel headings are parts, # not chapters. #latex_use_parts = False # Additional stuff for the LaTeX preamble. #latex_preamble = '' # Documents to append as an appendix to all manuals. #latex_appendices = [] # If false, no module index is generated. #latex_use_modindex = True intersphinx_mapping = {'http://docs.python.org/': None} autoclass_content = 'both'
umeckel/FS_coapy
doc/conf.py
Python
bsd-3-clause
6,468
# Copyright (c) 2010 Franz Allan Valencia See # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. try: import ConfigParser except: import configparser as ConfigParser from robot.api import logger import sqlalchemy class ConnectionManager(object): """ Connection Manager handles the connection & disconnection to the database. """ def __init__(self): """ Initializes _dbconnection to None. """ self._engine = None self._dbconnection = None def connect_to_database(self, url, echo=False, **kwargs): """ Connect to the given database URL with SQLAlchemy. See also: - http://docs.sqlalchemy.org/en/latest/core/engines.html#database-urls - http://docs.sqlalchemy.org/en/rel_1_0/core/engines.html#sqlalchemy.create_engine Example usage: | # Connect to an in-memory SQLite database | | Create Engine | sqlite:///:memory: | """ self._engine = sqlalchemy.create_engine(url, echo=echo, **kwargs) self._dbconnection = self._engine.connect() @property def db_api_module_name(self): try: return self._engine.driver except: return None def disconnect_from_database(self): """ Disconnects from the database. For example: | Disconnect From Database | # disconnects from current connection to the database | """ self._dbconnection.close()
edbrannin/Robotframework-SQLAlchemy-Library
src/SQLAlchemyLibrary/connection_manager.py
Python
apache-2.0
1,995
# -*- coding: utf-8 -*- """ @brief test log(time=10s) """ import unittest import numpy from scipy.linalg.lapack import dgelss as scipy_dgelss # pylint: disable=E0611 from pyquickhelper.pycode import ExtTestCase from cpyquickhelper.numbers.direct_blas_lapack import dgelss # pylint: disable=E0611 from cpyquickhelper.numbers.direct_blas_lapack import cblas_ddot, cblas_sdot # pylint: disable=E0611 from cpyquickhelper.numbers.direct_blas_lapack import ( # pylint: disable=E0611 cblas_daxpy, cblas_saxpy, cblas_daxpy_void, cblas_saxpy_void) class TestDirectBlasLapack(ExtTestCase): def test_dgels0(self): A = numpy.array([[1., 1.], [2., 1.], [3., 1.]]) C = numpy.array([[-1., 2.]]) B = numpy.matmul(A, C.T) ____, x, ___, __, _, info = scipy_dgelss(A, B) self.assertEqual(x.ravel()[:2], C.ravel()) A = A.T.copy() info = dgelss(A, B) self.assertEqual(info, 0) self.assertEqual(B.ravel()[:2], x.ravel()[:2]) def test_dgels01(self): A = numpy.array([[1., 1.], [2., 1.], [3., 1.]]) C = numpy.array([[-1., 2.]]) B = numpy.matmul(A, C.T) C[0, 0] = -0.9 ____, x, ___, __, _, info = scipy_dgelss(A, B) A = A.T.copy() info = dgelss(A, B) self.assertEqual(info, 0) self.assertEqual(B.ravel()[:2], x.ravel()[:2]) def test_dgels1(self): A = numpy.array([[10., 1.], [12., 1.], [13., 1]]) B = numpy.array([[20., 22., 23.]]).T ____, x, ___, __, _, info = scipy_dgelss(A, B) A = A.T.copy() info = dgelss(A, B) self.assertEqual(info, 0) self.assertEqual(B.ravel()[:2], x.ravel()[:2]) def test_ddot(self): A = numpy.array([1., 2., 3.]) B = numpy.array([-1., -2.2, 3.]) dot1 = A @ B dot2 = cblas_ddot(A, B) self.assertAlmostEqual(dot1, dot2, delta=1e-5) def test_sdot(self): A = numpy.array([1., 2., 3.], dtype=numpy.float32) B = numpy.array([-1., -2.2, 3.], dtype=numpy.float32) dot1 = A @ B dot2 = cblas_sdot(A, B) self.assertAlmostEqual(dot1, dot2) def test_daxpy(self): A = numpy.array([1., 2., 3.], dtype=numpy.float64) B = numpy.array([-1., -2.2, 5], dtype=numpy.float64) C = B + A * 5 cblas_daxpy(A, B, 5) self.assertEqualArray(C, B) def test_saxpy(self): A = numpy.array([1., 2., 3.], dtype=numpy.float32) B = numpy.array([-1., -2.2, 5], dtype=numpy.float32) C = B + A * 5 cblas_saxpy(A, B, 5) self.assertEqualArray(C, B) def test_daxpy_void(self): A = numpy.array([1., 2., 3.], dtype=numpy.float64) B = numpy.array([-1., -2.2, 5], dtype=numpy.float64) C = B + A * 5 pA, _ = A.__array_interface__['data'] # pylint: disable=E1101 pB, _ = B.__array_interface__['data'] # pylint: disable=E1101 cblas_daxpy_void(3, pA, pB, 5) self.assertEqualArray(C, B) def test_saxpy_void(self): A = numpy.array([1., 2., 3.], dtype=numpy.float32) B = numpy.array([-1., -2.2, 5], dtype=numpy.float32) C = B + A * 5 pA, _ = A.__array_interface__['data'] # pylint: disable=E1101 pB, _ = B.__array_interface__['data'] # pylint: disable=E1101 cblas_saxpy_void(3, pA, pB, 5) self.assertEqualArray(C, B) if __name__ == "__main__": unittest.main()
sdpython/cpyquickhelper
_unittests/ut_numbers/test_direct_blas_lapack.py
Python
mit
3,451
from slackrtm.channel import Channel import pytest def test_Channel(channel): assert type(channel) == Channel @pytest.mark.xfail def test_Channel_send_message(channel): channel.send_message('hi')
llimllib/slackrtm
tests/test_channel.py
Python
mit
206
from datetime import timedelta, datetime import json import logging from random import random import re import dateutil.parser from django.apps import apps from django.conf import settings from django.contrib.contenttypes.models import ContentType from django.core.management.base import BaseCommand from django.db.models import Q, F from django.db.models.signals import post_delete, post_save from django.utils import timezone from cmj.sigad.models import Documento from cmj.signals import Manutencao from cmj.videos.functions import pull_youtube_metadata_video, pull_youtube,\ vincular_sistema_aos_videos, video_documento_na_galeria from cmj.videos.models import Video, PullYoutube, VideoParte, PullExec import requests as rq def _get_registration_key(model): return '%s_%s' % (model._meta.app_label, model._meta.model_name) class Command(BaseCommand): def handle(self, *args, **options): m = Manutencao() post_delete.disconnect(dispatch_uid='sapl_post_delete_signal') post_save.disconnect(dispatch_uid='sapl_post_save_signal') post_delete.disconnect(dispatch_uid='cmj_post_delete_signal') post_save.disconnect(dispatch_uid='cmj_post_save_signal') self.logger = logging.getLogger(__name__) for v in Video.objects.order_by('-id')[:2]: print(v.id, v) pull_youtube_metadata_video(v) continue for vp in v.videoparte_set.all(): d = vp.content_object if not d: vp.delete() continue if vp.content_type_id == 202: d.delete() vp.delete() if not v.videoparte_set.exists(): v.delete() continue return # Video.objects.all().update(created=F('modified')) # PullYoutube.objects.pull_from_date() PullExec.objects.timedelta_quota_pull() # self.corrigir_erro_causado_em_full_metadata() pull_youtube() vincular_sistema_aos_videos() video_documento_na_galeria() # return # vincular_sistema_aos_videos() # video_documento_na_galeria() # pull_youtube_metadata_video(Video.objects.first()) return m.desativa_auto_now() # self.corrigir_erro_causado_em_full_metadata() # return """upcoming_or_live = Video.objects.filter( json__snippet__liveBroadcastContent__in=('upcoming', 'live')).exists() if upcoming_or_live: delay = timezone.now() + timedelta(seconds=10) task_pull_youtube.apply_async((upcoming_or_live,), eta=delay) return""" if not settings.DEBUG: self.pull_youtube() self.get_full_metadata_video() # return m.ativa_auto_now() self.vincular_sistema_aos_videos() self.video_documento_na_galeria() def get_full_metadata_video(self): videos = Video.objects.all( ).order_by('execucao', '-created') # json__snippet__liveBroadcastContent__in=('upcoming', 'live') videos = videos[:100] #now = timezone.now() for v in videos: print(v.id, v.vid, v) try: pull_youtube_metadata_video(v) except: pass """upcoming_or_live = Video.objects.filter( json__snippet__liveBroadcastContent__in=('upcoming', 'live')) if upcoming_or_live.exists(): v = upcoming_or_live.first() td = now - v.modified if td.total_seconds() > 600: delay = timezone.now() + timedelta(seconds=30) task_pull_youtube.apply_async(eta=delay)""" def corrigir_erro_causado_em_full_metadata(self): videos = Video.objects.all() for v in videos: for vp in v.videoparte_set.all(): if isinstance(vp.content_object, Documento): d = vp.content_object # if d.classe_id == 233: # continue for r in d.revisoes.all(): if not r.user: continue if r.user.id == 76: d.titulo = r.obj[0]['fields']['titulo'] d.descricao = r.obj[0]['fields']['descricao'] d.save() print(r.id, r.user.id, r.user, d.id, d) break
cmjatai/cmj
cmj/videos/management/commands/pull_youtube.py
Python
gpl-3.0
4,572
# -*- coding: utf-8 -*- # Form implementation generated from reading ui file '/home/yc/code/calibre/calibre/src/calibre/gui2/dialogs/search_item.ui' # # Created: Thu Oct 25 16:54:55 2012 # by: PyQt4 UI code generator 4.8.5 # # WARNING! All changes made in this file will be lost! from PyQt4 import QtCore, QtGui try: _fromUtf8 = QtCore.QString.fromUtf8 except AttributeError: _fromUtf8 = lambda s: s class Ui_Form(object): def setupUi(self, Form): Form.setObjectName(_fromUtf8("Form")) Form.resize(400, 39) Form.setWindowTitle(_("Form")) self.hboxlayout = QtGui.QHBoxLayout(Form) self.hboxlayout.setObjectName(_fromUtf8("hboxlayout")) self.field = QtGui.QComboBox(Form) self.field.setObjectName(_fromUtf8("field")) self.hboxlayout.addWidget(self.field) self.label = QtGui.QLabel(Form) self.label.setText(_("contains")) self.label.setObjectName(_fromUtf8("label")) self.hboxlayout.addWidget(self.label) self.text = QtGui.QLineEdit(Form) self.text.setToolTip(_("The text to search for. It is interpreted as a regular expression.")) self.text.setObjectName(_fromUtf8("text")) self.hboxlayout.addWidget(self.text) self.negate = QtGui.QCheckBox(Form) self.negate.setToolTip(_("<p>Negate this match. That is, only return results that <b>do not</b> match this query.")) self.negate.setText(_("Negate")) self.negate.setObjectName(_fromUtf8("negate")) self.hboxlayout.addWidget(self.negate) self.retranslateUi(Form) QtCore.QMetaObject.connectSlotsByName(Form) def retranslateUi(self, Form): pass
yeyanchao/calibre
src/calibre/gui2/dialogs/search_item_ui.py
Python
gpl-3.0
1,707
from django.contrib.auth.decorators import user_passes_test from django.contrib.auth import REDIRECT_FIELD_NAME from django.core.urlresolvers import reverse_lazy def sadmin_prerequisites(function): actual_decorator = user_passes_test( lambda u: u.is_authenticated() and u.is_staff and u.is_superuser, login_url=reverse_lazy('sadmin2:login'), redirect_field_name=REDIRECT_FIELD_NAME ) return actual_decorator(function)
animekita/selvbetjening
selvbetjening/sadmin2/decorators.py
Python
mit
457
class TreeAsBin: def __init__(self, key, child = None, sibling = None): self.key = key self.child = child self.sibling = sibling
omar94250/Algo-Epita
TreeAsBin.py
Python
gpl-3.0
158
""" Serial communication with Korad KA3xxxP power supplies. The intent is to give easy access to the power supply as Python objects, eliminating the need to know special codes. The object supports the python `with` statement to release the serial port automatically: from koradserial import KoradSerial with KoradSerial('/dev/tty.usbmodemfd121') as device: print "Model: ", device.model print "Status: ", device.status LICENSE: MIT RESOURCES: http://www.eevblog.com/forum/testgear/power-supply-ps3005d-ka3005d-rs232-protocol/ http://www.eevblog.com/forum/testgear/korad-ka3005p-io-commands/ http://sigrok.org/wiki/Velleman_PS3005D https://gist.github.com/k-nowicki/5379272 """ from __future__ import print_function, unicode_literals from enum import Enum from time import sleep import serial __all__ = ['KoradSerial', 'ChannelMode', 'OnOffState', 'Tracking'] class ChannelMode(Enum): """ Represents channel modes. These values should correspond to the values returned by the ``STATUS?`` command. """ constant_current = 0 constant_voltage = 1 class OnOffState(Enum): """ Represents on/off states. This could just as easily be done as a Boolean, but is explicit. """ off = 0 on = 1 class Tracking(Enum): """ Tracking state for a multi-channel power supply. These values should correspond to the values returned by the ``STATUS?`` command. There seems to be conflicting information about these values. The other values I've seen are: * 0 - independent * 1 - series * 2 - parallel * 3 - symmetric However, I don't have a multi-channel power supply to test these. """ independent = 0 series = 1 parallel = 3 class Status(object): """ Decode the KoradSerial status byte. It appears that the firmware is a little wonky here. SOURCE: Taken from http://www.eevblog.com/forum/testgear/korad-ka3005p-io-commands/ Contents 8 bits in the following format Bit Item Description 0 CH1 0=CC mode, 1=CV mode 1 CH2 0=CC mode, 1=CV mode 2, 3 Tracking 00=Independent, 01=Tracking series,11=Tracking parallel 4 Beep 0=Off, 1=On 5 Lock 0=Lock, 1=Unlock 6 Output 0=Off, 1=On 7 N/A N/A """ def __init__(self, status): """ Initialize object with a KoradSerial status character. :param status: Status value :type status: int """ super(Status, self).__init__() self.raw = status self.channel1 = ChannelMode(status & 1) self.channel2 = ChannelMode((status >> 1) & 1) self.tracking = Tracking((status >> 2) & 3) self.beep = OnOffState((status >> 4) & 1) self.lock = OnOffState((status >> 5) & 1) self.output = OnOffState((status >> 6) & 1) def __repr__(self): return "{0}".format(self.raw) def __str__(self): return "Channel 1: {0}, Channel 2: {1}, Tracking: {2}, Beep: {3}, Lock: {4}, Output: {5}".format( self.channel1.name, self.channel2.name, self.tracking.name, self.beep.name, self.lock.name, self.output.name, ) def __unicode__(self): return self.__str__() def float_or_none(value): try: return float(value) except (TypeError, ValueError): return None class KoradSerial(object): """ Wrapper for communicating with a programmable KoradSerial KA3xxxxP power supply as a serial interface. """ class Channel(object): """ Wrap a channel. """ def __init__(self, serial_, channel_number): """ :type serial_: KoradSerial.Serial :type channel_number: int """ super(KoradSerial.Channel, self).__init__() self.__serial = serial_ self.number = channel_number @property def current(self): result = self.__serial.send_receive("ISET{0}?".format(self.number), fixed_length=6) # There's a bug that return a 6th character of previous output. # This has to be read and discarded otherwise it will be prepended to the next output return float_or_none(result[:5]) @current.setter def current(self, value): self.__serial.send("ISET{0}:{1:05.3f}".format(self.number, value)) @property def voltage(self): return float_or_none(self.__serial.send_receive("VSET{0}?".format(self.number), fixed_length=5)) @voltage.setter def voltage(self, value): self.__serial.send("VSET{0}:{1:05.2f}".format(self.number, value)) @property def output_current(self): """ Retrieve this channel's current current output. :return: Amperes :rtype: float or None """ result = self.__serial.send_receive("IOUT{0}?".format(self.number), fixed_length=5) return float_or_none(result) @property def output_voltage(self): """ Retrieve this channel's current current voltage. :return: Volts :rtype: float or None """ result = self.__serial.send_receive("VOUT{0}?".format(self.number), fixed_length=5) return float_or_none(result) class Memory(object): """ Wrap a memory setting. """ def __init__(self, serial_, memory_number): super(KoradSerial.Memory, self).__init__() self.__serial = serial_ self.number = memory_number def recall(self): """ Recall this memory's settings. """ self.__serial.send("RCL{0}".format(self.number)) def save(self): """ Save the current voltage and current to this memory. """ self.__serial.send("SAV{0}".format(self.number)) class OnOffButton(object): """ Wrap an off/off button. """ def __init__(self, serial_, on_command, off_command): super(KoradSerial.OnOffButton, self).__init__() self.__serial = serial_ self._on = on_command self._off = off_command def on(self): self.__serial.send(self._on) def off(self): self.__serial.send(self._off) class Serial(object): """ Serial operations. There are some quirky things in communication. They go here. """ def __init__(self, port, debug=False): super(KoradSerial.Serial, self).__init__() self.debug = debug self.port = serial.Serial(port, 9600, timeout=1) def read_character(self): c = self.port.read(1).decode('ascii') if self.debug: if len(c) > 0: print("read: {0} = '{1}'".format(ord(c), c)) else: print("read: timeout") return c def read_string(self, fixed_length=None): """ Read a string. It appears that the KoradSerial PSU returns zero-terminated strings. :return: str """ result = [] c = self.read_character() while len(c) > 0 and ord(c) != 0: result.append(c) if fixed_length is not None and len(result) == fixed_length: break c = self.read_character() return ''.join(result) def send(self, text): if self.debug: print("_send: ", text) sleep(0.1) self.port.write(text.encode('ascii')) def send_receive(self, text, fixed_length=None): self.send(text) return self.read_string(fixed_length) def __init__(self, port, debug=False): super(KoradSerial, self).__init__() self.__serial = KoradSerial.Serial(port, debug) # Channels: adjust voltage and current, discover current output voltage. self.channels = [KoradSerial.Channel(self.__serial, i) for i in range(1, 3)] # Memory recall/save buttons 1 through 5 self.memories = [KoradSerial.Memory(self.__serial, i) for i in range(1, 6)] # Second column buttons self.beep = KoradSerial.OnOffButton(self.__serial, "BEEP1", "BEEP0") self.output = KoradSerial.OnOffButton(self.__serial, "OUT1", "OUT0") self.over_current_protection = KoradSerial.OnOffButton(self.__serial, "OCP1", "OCP0") self.over_voltage_protection = KoradSerial.OnOffButton(self.__serial, "OVP1", "OVP0") def __enter__(self): """ See documentation for Python's ``with`` command. """ return self def __exit__(self, type, value, traceback): """ See documentation for Python's ``with`` command. """ self.close() return False # ################################################################################ # Serial operations # ################################################################################ @property def is_open(self): """ Report whether the serial port is open. :rtype: bool """ return self.__serial.port.isOpen() def close(self): """ Close the serial port """ self.__serial.port.close() def open(self): """ Open the serial port """ self.__serial.port.open() # ################################################################################ # Power supply operations # ################################################################################ @property def model(self): """ Report the power supply model information. :rtype: str """ return self.__serial.send_receive("*IDN?") @property def status(self): """ Report the power supply status. :rtype: KoradSerial.Status or None """ self.__serial.send("STATUS?") status = self.__serial.read_character() if len(status) == 0: return None else: return Status(ord(status)) def track(self, value): """ Set tracking mode. This does nothing on single-channel power supply. :param value: Tracking mode to set. :type value: Tracking """ translate = { Tracking.independent: "TRACK0", Tracking.series: "TRACK1", Tracking.parallel: "TRACK2", } if value in translate: self.__serial.send(translate[value])
starforgelabs/py-korad-serial
koradserial.py
Python
mit
10,720
import _plotly_utils.basevalidators class TextsrcValidator(_plotly_utils.basevalidators.SrcValidator): def __init__(self, plotly_name="textsrc", parent_name="histogram", **kwargs): super(TextsrcValidator, self).__init__( plotly_name=plotly_name, parent_name=parent_name, edit_type=kwargs.pop("edit_type", "none"), role=kwargs.pop("role", "info"), **kwargs )
plotly/python-api
packages/python/plotly/plotly/validators/histogram/_textsrc.py
Python
mit
440
from __future__ import absolute_import from __future__ import with_statement from mock import Mock, patch from celery import Celery from celery.bin.camqadm import ( AMQPAdmin, AMQShell, dump_message, AMQPAdminCommand, camqadm, main, ) from celery.tests.utils import AppCase, WhateverIO class test_AMQShell(AppCase): def setup(self): self.fh = WhateverIO() self.app = Celery(broker='memory://', set_as_current=False) self.adm = self.create_adm() self.shell = AMQShell(connect=self.adm.connect, out=self.fh) def create_adm(self, *args, **kwargs): return AMQPAdmin(app=self.app, out=self.fh, *args, **kwargs) def test_queue_declare(self): self.shell.onecmd('queue.declare foo') self.assertIn('ok', self.fh.getvalue()) def test_missing_command(self): self.shell.onecmd('foo foo') self.assertIn('unknown syntax', self.fh.getvalue()) def RV(self): raise Exception(self.fh.getvalue()) def test_missing_namespace(self): self.shell.onecmd('ns.cmd arg') self.assertIn('unknown syntax', self.fh.getvalue()) def test_help(self): self.shell.onecmd('help') self.assertIn('Example:', self.fh.getvalue()) def test_help_command(self): self.shell.onecmd('help queue.declare') self.assertIn('passive:no', self.fh.getvalue()) def test_help_unknown_command(self): self.shell.onecmd('help foo.baz') self.assertIn('unknown syntax', self.fh.getvalue()) def test_exit(self): with self.assertRaises(SystemExit): self.shell.onecmd('exit') self.assertIn("don't leave!", self.fh.getvalue()) def test_note_silent(self): self.shell.silent = True self.shell.note('foo bar') self.assertNotIn('foo bar', self.fh.getvalue()) def test_reconnect(self): self.shell.onecmd('queue.declare foo') self.shell.needs_reconnect = True self.shell.onecmd('queue.delete foo') def test_completenames(self): self.assertEqual( self.shell.completenames('queue.dec'), ['queue.declare'], ) self.assertEqual( self.shell.completenames('declare'), ['queue.declare', 'exchange.declare'], ) def test_empty_line(self): self.shell.emptyline = Mock() self.shell.default = Mock() self.shell.onecmd('') self.shell.emptyline.assert_called_with() self.shell.onecmd('foo') self.shell.default.assert_called_with('foo') def test_respond(self): self.shell.respond({'foo': 'bar'}) self.assertIn('foo', self.fh.getvalue()) def test_prompt(self): self.assertTrue(self.shell.prompt) def test_no_returns(self): self.shell.onecmd('queue.declare foo') self.shell.onecmd('exchange.declare bar direct yes') self.shell.onecmd('queue.bind foo bar baz') self.shell.onecmd('basic.ack 1') def test_dump_message(self): m = Mock() m.body = 'the quick brown fox' m.properties = {'a': 1} m.delivery_info = {'exchange': 'bar'} self.assertTrue(dump_message(m)) def test_dump_message_no_message(self): self.assertIn('No messages in queue', dump_message(None)) def test_note(self): self.adm.silent = True self.adm.note('FOO') self.assertNotIn('FOO', self.fh.getvalue()) def test_run(self): a = self.create_adm('queue.declare foo') a.run() self.assertIn('ok', self.fh.getvalue()) def test_run_loop(self): a = self.create_adm() a.Shell = Mock() shell = a.Shell.return_value = Mock() shell.cmdloop = Mock() a.run() shell.cmdloop.assert_called_with() shell.cmdloop.side_effect = KeyboardInterrupt() a.run() self.assertIn('bibi', self.fh.getvalue()) @patch('celery.bin.camqadm.AMQPAdminCommand') def test_main(self, Command): c = Command.return_value = Mock() main() c.execute_from_commandline.assert_called_with() @patch('celery.bin.camqadm.AMQPAdmin') def test_camqadm(self, cls): c = cls.return_value = Mock() camqadm() c.run.assert_called_with() @patch('celery.bin.camqadm.AMQPAdmin') def test_AMQPAdminCommand(self, cls): c = cls.return_value = Mock() camqadm() c.run.assert_called_with() x = AMQPAdminCommand(app=self.app) x.run() self.assertIs(cls.call_args[1]['app'], self.app) c.run.assert_called_with()
mozilla/firefox-flicks
vendor-local/lib/python/celery/tests/bin/test_camqadm.py
Python
bsd-3-clause
4,659
import re import sys if sys.version_info < (3,): from urllib2 import urlopen, Request from urlparse import urljoin else: from urllib.request import urlopen, Request from urllib.parse import urljoin class InvalidID(Exception): pass class InvalidHost(Exception): pass class BaseExtractor(object): def __init__(self): self.regex_url = None self.host_list = None self.holder_url = None self.regex_url = None self.example_urls = None def is_valid_host(self, host): return host in self.host_list def is_valid_url(self, url): return re.match(self.regex_url, url) def get_id(self, url): if self.is_valid_url(url): try: re.match(self.regex_url, url).group('id') except: raise InvalidID('Not a valid id') def get_host(self, url): if self.is_valid_url(url): try: re.match(self.regex_url, url).group('host') except: raise InvalidHost('Not a valid host') @property def name(self): return self.__class__.__name__.lower() def __str__(self): s = "{0}(name={1}, host_list={2})".format( self.__class__.__name__, self.name, self.host_list ) return s def fetch_page(self, url, extra_path=None): """ Download page using default user agent, read it and return its content If extra_path is given, it appends this path to url before request """ if extra_path: url = urljoin(url, extra_path) user_agent = 'Mozilla/5.0 (X11; Linux x86_64; rv:24.0) Gecko/20100101 Firefox/24.0' headers = {'User-Agent': user_agent} req = Request(url, data=None, headers=headers) response = urlopen(req) content = response.read() return content
marcwebbie/pycis
pycis/extractors/base_extractor.py
Python
mit
1,922
from django.core.urlresolvers import reverse def test_role_merge_page(admin_webtest_client, factories): role = factories.RoleFactory() url = reverse('admin:role-merge', kwargs={ 'department_pk': role.department_id, 'pk': role.pk, }) response = admin_webtest_client.get(url) assert response.status_code == 200 def test_role_merging(admin_webtest_client, factories, models): role_a = factories.RoleFactory(name='a') factories.ShiftFactory(role=role_a) role_b = factories.RoleFactory(name='b') factories.ShiftFactory(role=role_b) assert role_a != role_b # sanity check assert role_a.shifts.count() == 1 assert role_b.shifts.count() == 1 url = reverse('admin:role-merge', kwargs={ 'department_pk': role_a.department_id, 'pk': role_a.pk, }) response = admin_webtest_client.get(url) response.forms[1]['role'] = role_b.pk response.forms[1]['verify'] = role_a.name form_response = response.forms[1].submit() assert form_response.status_code == 302 assert not models.Role.objects.filter(pk=role_a.pk).exists() assert role_b.shifts.count() == 2
Apogaea/voldb
tests/departments/admin/test_role_merge_page.py
Python
gpl-3.0
1,165
# Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. import sys import time import traceback import logging from datetime import datetime, timedelta import pymongo from pylons import tmpl_context as c, app_globals as g from tg import config from paste.deploy.converters import asbool import ming from ming.utils import LazyProperty from ming import schema as S from ming.orm import session, FieldProperty from ming.orm.declarative import MappedClass from allura.lib.helpers import log_output from .session import task_orm_session log = logging.getLogger(__name__) class MonQTask(MappedClass): '''Task to be executed by the taskd daemon. Properties - _id - bson.ObjectId() for this task - state - 'ready', 'busy', 'error', 'complete', or 'skipped' task status - priority - integer priority, higher is more priority - result_type - either 'keep' or 'forget', what to do with the task when it's done - time_queue - time the task was queued - time_start - time taskd began working on the task - time_stop - time taskd stopped working on the task - task_name - full dotted name of the task function to run - process - identifier for which taskd process is working on the task - context - values used to set c.project, c.app, c.user for the task - args - ``*args`` to be sent to the task function - kwargs - ``**kwargs`` to be sent to the task function - result - if the task is complete, the return value. If in error, the traceback. ''' states = ('ready', 'busy', 'error', 'complete', 'skipped') result_types = ('keep', 'forget') class __mongometa__: session = task_orm_session name = 'monq_task' indexes = [ [ # used in MonQTask.get() method # also 'state' queries exist in several other methods ('state', ming.ASCENDING), ('priority', ming.DESCENDING), ('time_queue', ming.ASCENDING) ], [ # used by SF internal tool, but could be generally useful to # have an index on task_name 'state', 'task_name', 'time_queue' ], 'args', ] _id = FieldProperty(S.ObjectId) state = FieldProperty(S.OneOf(*states)) priority = FieldProperty(int) result_type = FieldProperty(S.OneOf(*result_types)) time_queue = FieldProperty(datetime, if_missing=datetime.utcnow) time_start = FieldProperty(datetime, if_missing=None) time_stop = FieldProperty(datetime, if_missing=None) task_name = FieldProperty(str) process = FieldProperty(str) context = FieldProperty(dict( project_id=S.ObjectId, app_config_id=S.ObjectId, user_id=S.ObjectId, notifications_disabled=bool)) args = FieldProperty([]) kwargs = FieldProperty({None: None}) result = FieldProperty(None, if_missing=None) def __repr__(self): from allura import model as M project = M.Project.query.get(_id=self.context.project_id) app = None if project: app_config = M.AppConfig.query.get(_id=self.context.app_config_id) if app_config: app = project.app_instance(app_config) user = M.User.query.get(_id=self.context.user_id) project_url = project and project.url() or None app_mount = app and app.config.options.mount_point or None username = user and user.username or None return '<%s %s (%s) P:%d %s %s project:%s app:%s user:%s>' % ( self.__class__.__name__, self._id, self.state, self.priority, self.task_name, self.process, project_url, app_mount, username) @LazyProperty def function(self): '''The function that is called by this task''' smod, sfunc = self.task_name.rsplit('.', 1) cur = __import__(smod, fromlist=[sfunc]) return getattr(cur, sfunc) @classmethod def post(cls, function, args=None, kwargs=None, result_type='forget', priority=10, delay=0): '''Create a new task object based on the current context.''' if args is None: args = () if kwargs is None: kwargs = {} task_name = '%s.%s' % ( function.__module__, function.__name__) context = dict( project_id=None, app_config_id=None, user_id=None, notifications_disabled=False) if getattr(c, 'project', None): context['project_id'] = c.project._id context[ 'notifications_disabled'] = c.project.notifications_disabled if getattr(c, 'app', None): context['app_config_id'] = c.app.config._id if getattr(c, 'user', None): context['user_id'] = c.user._id obj = cls( state='ready', priority=priority, result_type=result_type, task_name=task_name, args=args, kwargs=kwargs, process=None, result=None, context=context, time_queue=datetime.utcnow() + timedelta(seconds=delay)) session(obj).flush(obj) try: if g.amq_conn: g.amq_conn.queue.put('') except: log.warning('Error putting to amq_conn', exc_info=True) return obj @classmethod def get(cls, process='worker', state='ready', waitfunc=None, only=None): '''Get the highest-priority, oldest, ready task and lock it to the current process. If no task is available and waitfunc is supplied, call the waitfunc before trying to get the task again. If waitfunc is None and no tasks are available, return None. If waitfunc raises a StopIteration, stop waiting for a task ''' sort = [ ('priority', ming.DESCENDING), ('time_queue', ming.ASCENDING)] while True: try: query = dict(state=state) query['time_queue'] = {'$lte': datetime.utcnow()} if only: query['task_name'] = {'$in': only} obj = cls.query.find_and_modify( query=query, update={ '$set': dict( state='busy', process=process) }, new=True, sort=sort) if obj is not None: return obj except pymongo.errors.OperationFailure, exc: if 'No matching object found' not in exc.args[0]: raise if waitfunc is None: return None try: waitfunc() except StopIteration: return None @classmethod def timeout_tasks(cls, older_than): '''Mark all busy tasks older than a certain datetime as 'ready' again. Used to retry 'stuck' tasks.''' spec = dict(state='busy') spec['time_start'] = {'$lt': older_than} cls.query.update(spec, {'$set': dict(state='ready')}, multi=True) @classmethod def clear_complete(cls): '''Delete the task objects for complete tasks''' spec = dict(state='complete') cls.query.remove(spec) @classmethod def run_ready(cls, worker=None): '''Run all the tasks that are currently ready''' i = 0 for i, task in enumerate(cls.query.find(dict(state='ready')).all()): task.process = worker task() return i def __call__(self, restore_context=True): '''Call the task function with its context. If restore_context is True, c.project/app/user will be restored to the values they had before this function was called. ''' from allura import model as M self.time_start = datetime.utcnow() session(self).flush(self) log.info('starting %r', self) old_cproject = getattr(c, 'project', None) old_capp = getattr(c, 'app', None) old_cuser = getattr(c, 'user', None) try: func = self.function c.project = M.Project.query.get(_id=self.context.project_id) c.app = None if c.project: c.project.notifications_disabled = self.context.get( 'notifications_disabled', False) app_config = M.AppConfig.query.get( _id=self.context.app_config_id) if app_config: c.app = c.project.app_instance(app_config) c.user = M.User.query.get(_id=self.context.user_id) with log_output(log): self.result = func(*self.args, **self.kwargs) self.state = 'complete' return self.result except Exception, exc: if asbool(config.get('monq.raise_errors')): raise else: log.exception('Error "%s" on job %s', exc, self) self.state = 'error' if hasattr(exc, 'format_error'): self.result = exc.format_error() log.error(self.result) else: self.result = traceback.format_exc() finally: self.time_stop = datetime.utcnow() session(self).flush(self) if restore_context: c.project = old_cproject c.app = old_capp c.user = old_cuser def join(self, poll_interval=0.1): '''Wait until this task is either complete or errors out, then return the result.''' while self.state not in ('complete', 'error'): time.sleep(poll_interval) self.query.find(dict(_id=self._id), refresh=True).first() return self.result @classmethod def list(cls, state='ready'): '''Print all tasks of a certain status to sys.stdout. Used for debugging.''' for t in cls.query.find(dict(state=state)): sys.stdout.write('%r\n' % t)
apache/incubator-allura
Allura/allura/model/monq_model.py
Python
apache-2.0
11,231
# Copyright 2013-2021 Lawrence Livermore National Security, LLC and other # Spack Project Developers. See the top-level COPYRIGHT file for details. # # SPDX-License-Identifier: (Apache-2.0 OR MIT) import os.path from spack import * class Dyninst(CMakePackage): """API for dynamic binary instrumentation. Modify programs while they are executing without recompiling, re-linking, or re-executing.""" homepage = "https://dyninst.org" git = "https://github.com/dyninst/dyninst.git" maintainers = ['hainest'] tags = ['e4s'] version('master', branch='master') version('12.0.1', tag='v12.0.1') version('12.0.0', tag='v12.0.0') version('11.0.1', tag='v11.0.1') version('11.0.0', tag='v11.0.0') version('10.2.1', tag='v10.2.1') version('10.2.0', tag='v10.2.0') version('10.1.0', tag='v10.1.0') version('10.0.0', tag='v10.0.0') version('9.3.2', tag='v9.3.2') version('9.3.0', tag='v9.3.0') version('9.2.0', tag='v9.2.0') version('9.1.0', tag='v9.1.0') version('8.2.1', tag='v8.2.1') variant('openmp', default=True, description='Enable OpenMP support for ParseAPI ' '(version 10.0.0 or later)') variant('static', default=False, description='Build static libraries') variant('stat_dysect', default=False, description="Patch for STAT's DySectAPI") boost_libs = '+atomic+chrono+date_time+filesystem+system+thread+timer' depends_on('[email protected]:' + boost_libs, when='@10.1.0:') depends_on('[email protected]:1.69' + boost_libs, when='@:10.0') depends_on('[email protected]:' + boost_libs, when='@11.0.0:') depends_on('libiberty+pic') # Dyninst uses elfutils starting with 9.3.0, and used libelf # before that. # NB: Parallel DWARF parsing in Dyninst 10.2.0 requires a thread- # safe libdw depends_on('[email protected]:', type='link', when='@12.0.1:') depends_on('[email protected]:', type='link', when='@10.2.0:') depends_on('elfutils', type='link', when='@9.3.0:10.1') depends_on('libelf', type='link', when='@:9.2') # Dyninst uses libdw from elfutils starting with 10.0, and used # libdwarf before that. depends_on('libdwarf', when='@:9') depends_on('[email protected]:', when='@10.0.0:') depends_on('[email protected]:', type='build', when='@10.1.0:') depends_on('[email protected]:', type='build', when='@10.0.0:10.0') depends_on('[email protected]:', type='build', when='@:9') patch('stat_dysect.patch', when='+stat_dysect') patch('stackanalysis_h.patch', when='@9.2.0') patch('v9.3.2-auto.patch', when='@9.3.2 %gcc@:4.7') patch('tribool.patch', when='@9.3.0:10.0.0 ^[email protected]:') # No Mac support (including apple-clang) conflicts('platform=darwin', msg='macOS is not supported') # We currently only build with gcc conflicts('%clang') conflicts('%arm') conflicts('%cce') conflicts('%fj') conflicts('%intel') conflicts('%pgi') conflicts('%xl') conflicts('%xl_r') # Version 11.0 requires a C++11-compliant ABI conflicts('%gcc@:5', when='@11.0.0:') # Versions 9.3.x used cotire, but have no knob to turn it off. # Cotire has no real use for one-time builds and can break # parallel builds with both static and shared libs. @when('@9.3.0:9.3') def patch(self): filter_file('USE_COTIRE true', 'USE_COTIRE false', 'cmake/shared.cmake') # New style cmake args, starting with 10.1. @when('@10.1.0:') def cmake_args(self): spec = self.spec args = [ '-DBoost_ROOT_DIR=%s' % spec['boost'].prefix, '-DElfUtils_ROOT_DIR=%s' % spec['elf'].prefix, '-DLibIberty_ROOT_DIR=%s' % spec['libiberty'].prefix, '-DTBB_ROOT_DIR=%s' % spec['tbb'].prefix, self.define('LibIberty_LIBRARIES', spec['libiberty'].libs) ] if '+openmp' in spec: args.append('-DUSE_OpenMP=ON') else: args.append('-DUSE_OpenMP=OFF') if '+static' in spec: args.append('-DENABLE_STATIC_LIBS=YES') else: args.append('-DENABLE_STATIC_LIBS=NO') # Make sure Dyninst doesn't try to build its own dependencies # outside of Spack if spec.satisfies('@10.2.0:'): args.append('-DSTERILE_BUILD=ON') return args # Old style cmake args, up through 10.0. @when('@:10.0') def cmake_args(self): spec = self.spec # Elf -- the directory containing libelf.h. elf = spec['elf'].prefix elf_include = os.path.dirname( find_headers('libelf', elf.include, recursive=True)[0]) # Dwarf -- the directory containing elfutils/libdw.h or # libdwarf.h, and the path to libdw.so or libdwarf.so. if spec.satisfies('@10.0.0:'): dwarf_include = elf.include dwarf_lib = find_libraries('libdw', elf, recursive=True) else: dwarf_include = spec['libdwarf'].prefix.include dwarf_lib = spec['libdwarf'].libs args = [ '-DPATH_BOOST=%s' % spec['boost'].prefix, '-DIBERTY_LIBRARIES=%s' % spec['libiberty'].libs, '-DLIBELF_INCLUDE_DIR=%s' % elf_include, '-DLIBELF_LIBRARIES=%s' % spec['elf'].libs, '-DLIBDWARF_INCLUDE_DIR=%s' % dwarf_include, '-DLIBDWARF_LIBRARIES=%s' % dwarf_lib, ] # TBB include and lib directories, version 10.x or later. if spec.satisfies('@10.0.0:'): args.extend([ '-DTBB_INCLUDE_DIRS=%s' % spec['tbb'].prefix.include, '-DTBB_LIBRARY=%s' % spec['tbb'].prefix.lib, ]) # Openmp applies to version 10.x or later. if spec.satisfies('@10.0.0:'): if '+openmp' in spec: args.append('-DUSE_OpenMP=ON') else: args.append('-DUSE_OpenMP=OFF') # Static libs started with version 9.1.0. if spec.satisfies('@9.1.0:'): if '+static' in spec: args.append('-DENABLE_STATIC_LIBS=1') else: args.append('-DENABLE_STATIC_LIBS=NO') return args
LLNL/spack
var/spack/repos/builtin/packages/dyninst/package.py
Python
lgpl-2.1
6,257
import pandas as pd import numpy as np from datetime import datetime from datetime import timedelta import math from utility.datafilepath import g_singletonDataFilePath class GenerateResultCsv: def __init__(self): return def generateTestDate_0(self): startDate = datetime.strptime('2016-01-01', '%Y-%m-%d') res = [] for i in range(21): deltatime = timedelta(days = i) item = (startDate + deltatime).date() res.append(str(item)) return res def generateTestDate_1(self): startDate = datetime.strptime('2016-01-22', '%Y-%m-%d') res = [] for i in range(5): deltatime = timedelta(days = 2*i) item = (startDate + deltatime).date() res.append(str(item)) return res def generateSlotSet(self, testDates, slots): res = [] for testDate in testDates: for slot in slots: res.append(testDate + '-'+ str(slot)) return res def generateSlotSet_0(self): testDates = self.generateTestDate_0() slots = [46,58,70,82,94,106,118,130,142] return self.generateSlotSet(testDates, slots) def generateSlotSet_1(self): testDates = self.generateTestDate_1() slots = [46,58,70,82,94,106,118,130,142] return self.generateSlotSet(testDates, slots) def generateTestDistrict(self): return [i+ 1 for i in range(66)] def generatePrediction_0(self): testSlots = self.generateSlotSet_0() df = pd.read_csv(g_singletonDataFilePath.getGapCsv_Train()) df = df.loc[df['time_slotid'].isin(testSlots)] self.saveResultCsv(df, 'prediction_0.csv') #map 2016-01-22-1 to 2016-01-22-001 # df['timeslotrank'] = df['time_slotid'].map(lambda x: "-".join(x.split('-')[:3] + [x.split('-')[-1].zfill(3)])) # df = df.sort_values(by = ['timeslotrank','start_district_id']) # df.to_csv('prediction_0.csv', columns=['start_district_id', 'time_slotid', 'gap'], header=None, index=None) return def saveResultCsv(self, df, filename): #map 2016-01-22-1 to 2016-01-22-001 df['timeslotrank'] = df['time_slotid'].map(lambda x: "-".join(x.split('-')[:3] + [x.split('-')[-1].zfill(3)])) df = df.sort_values(by = ['start_district_id', 'timeslotrank']) df.to_csv(filename, columns=['start_district_id', 'time_slotid', 'gap'], header=None, index=None) return def generateActual_0(self): testSlots = self.generateSlotSet_0() df = pd.read_csv(g_singletonDataFilePath.getGapCsv_Train()) df = df.loc[df['time_slotid'].isin(testSlots)] self.saveResultCsv(df, 'actual_0.csv') return class Evaluate(GenerateResultCsv): def __init__(self): GenerateResultCsv.__init__(self) return def loadResultFiles(self, testSetNum): actualFile = 'actual_' + str(testSetNum) + '.csv' predictionFile = 'prediction_' + str(testSetNum) + '.csv' self.actualDict = self.loadDict(actualFile) self.predictonDict = self.loadDict(predictionFile) return def loadDict(self, filename): df = pd.read_csv(filename, header=None) res = {} for _, row in df.iterrows(): res[(row[0], row[1])] = row[2] return res def calFinalResult(self, testSetNum): self.loadResultFiles(testSetNum) res = [] for key, value in self.actualDict.iteritems(): actual = value if actual == 0: print "record {} is 0, not included in final calculation".format(key) continue prediction = self.predictonDict[key] temp = (actual - prediction)/float(actual) if math.isnan(temp): print temp res.append(abs(temp)) res = np.array(res) pd.DataFrame(res).to_csv('result.csv') print "final result: {}".format(res.mean()) return np.mean(res) def run(self): self.generateActual_0() self.generatePrediction_0() self.calFinalResult(0) return if __name__ == "__main__": obj= Evaluate() obj.run()
LevinJ/Supply-demand-forecasting
evaluation/evaluate.py
Python
mit
4,270
#!/usr/bin/env python # -*- coding: utf-8 -*- from setuptools import setup with open('README.rst') as readme_file: readme = readme_file.read() with open('HISTORY.rst') as history_file: history = history_file.read() requirements = [ 'transitions' # TODO: put package requirements here ] test_requirements = [ 'pip', 'flake8', 'pytest', 'mock', 'six', 'transitions' # TODO: put package test requirements here ] setup( name='test_manager', version='0.1.1', description="GUI Test manage to run multiple test plans", long_description=readme + '\n\n' + history, author="Matt Trott", author_email='[email protected]', url='https://github.com/trottmpq/test_manager', packages=[ 'test_manager', ], package_dir={'test_manager': 'test_manager'}, entry_points={ 'console_scripts': [ 'test_manager=test_manager.cli:main' ] }, include_package_data=True, install_requires=requirements, license="MIT license", zip_safe=False, keywords='test_manager', classifiers=[ 'Development Status :: 2 - Pre-Alpha', 'Intended Audience :: Developers', 'License :: OSI Approved :: MIT License', 'Natural Language :: English', "Programming Language :: Python :: 2", 'Programming Language :: Python :: 2.7', 'Programming Language :: Python :: 3', 'Programming Language :: Python :: 3.3', 'Programming Language :: Python :: 3.4', 'Programming Language :: Python :: 3.5', 'Programming Language :: Python :: 3.6', ], test_suite='tests', tests_require=test_requirements )
trottmpq/test_manager
setup.py
Python
mit
1,716
# coding=utf-8 # Copyright 2022 The Tensor2Tensor Authors. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Tests for Rouge metric.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function import numpy as np from tensor2tensor.utils import rouge import tensorflow.compat.v1 as tf class TestRouge2Metric(tf.test.TestCase): """Tests the rouge-2 metric.""" def testRouge2Identical(self): hypotheses = np.array([[1, 2, 3, 4, 5, 1, 6, 7, 0], [1, 2, 3, 4, 5, 1, 6, 8, 7]]) references = np.array([[1, 2, 3, 4, 5, 1, 6, 7, 0], [1, 2, 3, 4, 5, 1, 6, 8, 7]]) self.assertAllClose(rouge.rouge_n(hypotheses, references), 1.0, atol=1e-03) def testRouge2Disjoint(self): hypotheses = np.array([[1, 2, 3, 4, 5, 1, 6, 7, 0], [1, 2, 3, 4, 5, 1, 6, 8, 7]]) references = np.array([[8, 9, 10, 11, 12, 13, 14, 15, 16, 17], [9, 10, 11, 12, 13, 14, 15, 16, 17, 0]]) self.assertEqual(rouge.rouge_n(hypotheses, references), 0.0) def testRouge2PartialOverlap(self): hypotheses = np.array([[1, 2, 3, 4, 5, 1, 6, 7, 0], [1, 2, 3, 4, 5, 1, 6, 8, 7]]) references = np.array([[1, 9, 2, 3, 4, 5, 1, 10, 6, 7], [1, 9, 2, 3, 4, 5, 1, 10, 6, 7]]) self.assertAllClose(rouge.rouge_n(hypotheses, references), 0.53, atol=1e-03) class TestRougeLMetric(tf.test.TestCase): """Tests the rouge-l metric.""" def testRougeLIdentical(self): hypotheses = np.array([[1, 2, 3, 4, 5, 1, 6, 7, 0], [1, 2, 3, 4, 5, 1, 6, 8, 7]]) references = np.array([[1, 2, 3, 4, 5, 1, 6, 7, 0], [1, 2, 3, 4, 5, 1, 6, 8, 7]]) self.assertAllClose( rouge.rouge_l_sentence_level(hypotheses, references), 1.0, atol=1e-03) def testRougeLDisjoint(self): hypotheses = np.array([[1, 2, 3, 4, 5, 1, 6, 7, 0], [1, 2, 3, 4, 5, 1, 6, 8, 7]]) references = np.array([[8, 9, 10, 11, 12, 13, 14, 15, 16, 17], [9, 10, 11, 12, 13, 14, 15, 16, 17, 0]]) self.assertEqual(rouge.rouge_l_sentence_level(hypotheses, references), 0.0) def testRougeLPartialOverlap(self): hypotheses = np.array([[1, 2, 3, 4, 5, 1, 6, 7, 0], [1, 2, 3, 4, 5, 1, 6, 8, 7]]) references = np.array([[1, 9, 2, 3, 4, 5, 1, 10, 6, 7], [1, 9, 2, 3, 4, 5, 1, 10, 6, 7]]) self.assertAllClose( rouge.rouge_l_sentence_level(hypotheses, references), 0.837, atol=1e-03) class TestRougeMetricsE2E(tf.test.TestCase): """Tests the rouge metrics end-to-end.""" def testRouge2MetricE2E(self): vocab_size = 4 batch_size = 12 seq_length = 12 predictions = tf.one_hot( np.random.randint(vocab_size, size=(batch_size, seq_length, 1, 1)), depth=4, dtype=tf.float32) targets = np.random.randint(4, size=(12, 12, 1, 1)) with self.test_session() as session: scores, _ = rouge.rouge_2_fscore(predictions, tf.constant(targets, dtype=tf.int32)) a = tf.reduce_mean(scores) session.run(tf.global_variables_initializer()) session.run(a) def testRougeLMetricE2E(self): vocab_size = 4 batch_size = 12 seq_length = 12 predictions = tf.one_hot( np.random.randint(vocab_size, size=(batch_size, seq_length, 1, 1)), depth=4, dtype=tf.float32) targets = np.random.randint(4, size=(12, 12, 1, 1)) with self.test_session() as session: scores, _ = rouge.rouge_l_fscore( predictions, tf.constant(targets, dtype=tf.int32)) a = tf.reduce_mean(scores) session.run(tf.global_variables_initializer()) session.run(a) if __name__ == "__main__": tf.test.main()
tensorflow/tensor2tensor
tensor2tensor/utils/rouge_test.py
Python
apache-2.0
4,407
import numpy as np import tensorflow as tf from tensorflow.contrib import legacy_seq2seq from tensorflow.contrib import rnn # Cloned from https://github.com/sherjilozair/char-rnn-tensorflow # Used to sample trained models without having to call sample.py every time # which is extremely slow. Instead we load the data once in utils.init_tf # and use the data provided in the bot class Model: def __init__(self, args, training=True): self.args = args if not training: args.batch_size = 1 args.seq_length = 1 # choose different rnn cell if args.model == 'rnn': cell_fn = rnn.RNNCell elif args.model == 'gru': cell_fn = rnn.GRUCell elif args.model == 'lstm': cell_fn = rnn.LSTMCell elif args.model == 'nas': cell_fn = rnn.NASCell else: raise Exception("model type not supported: {}".format(args.model)) # warp multi layered rnn cell into one cell with dropout cells = [] for _ in range(args.num_layers): cell = cell_fn(args.rnn_size) if training and (args.output_keep_prob < 1.0 or args.input_keep_prob < 1.0): cell = rnn.DropoutWrapper(cell, input_keep_prob=args.input_keep_prob, output_keep_prob=args.output_keep_prob) cells.append(cell) self.cell = cell = rnn.MultiRNNCell(cells, state_is_tuple=True) # input/target data (int32 since input is char-level) self.input_data = tf.placeholder( tf.int32, [args.batch_size, args.seq_length]) self.targets = tf.placeholder( tf.int32, [args.batch_size, args.seq_length]) self.initial_state = cell.zero_state(args.batch_size, tf.float32) # softmax output layer, use softmax to classify with tf.variable_scope('rnnlm'): softmax_w = tf.get_variable("softmax_w", [args.rnn_size, args.vocab_size]) softmax_b = tf.get_variable("softmax_b", [args.vocab_size]) # transform input to embedding embedding = tf.get_variable("embedding", [args.vocab_size, args.rnn_size]) inputs = tf.nn.embedding_lookup(embedding, self.input_data) # dropout beta testing: double check which one should affect next line if training and args.output_keep_prob: inputs = tf.nn.dropout(inputs, args.output_keep_prob) # unstack the input to fits in rnn model inputs = tf.split(inputs, args.seq_length, 1) inputs = [tf.squeeze(input_, [1]) for input_ in inputs] # loop function for rnn_decoder, which take the previous i-th cell's output and generate the (i+1)-th cell's input def loop(prev, _): prev = tf.matmul(prev, softmax_w) + softmax_b prev_symbol = tf.stop_gradient(tf.argmax(prev, 1)) return tf.nn.embedding_lookup(embedding, prev_symbol) # rnn_decoder to generate the ouputs and final state. When we are not training the model, we use the loop function. outputs, last_state = legacy_seq2seq.rnn_decoder(inputs, self.initial_state, cell, loop_function=loop if not training else None, scope='rnnlm') output = tf.reshape(tf.concat(outputs, 1), [-1, args.rnn_size]) # output layer self.logits = tf.matmul(output, softmax_w) + softmax_b self.probs = tf.nn.softmax(self.logits) # loss is calculate by the log loss and taking the average. loss = legacy_seq2seq.sequence_loss_by_example( [self.logits], [tf.reshape(self.targets, [-1])], [tf.ones([args.batch_size * args.seq_length])]) with tf.name_scope('cost'): self.cost = tf.reduce_sum(loss) / args.batch_size / args.seq_length self.final_state = last_state self.lr = tf.Variable(0.0, trainable=False) tvars = tf.trainable_variables() # calculate gradients grads, _ = tf.clip_by_global_norm(tf.gradients(self.cost, tvars), args.grad_clip) with tf.name_scope('optimizer'): optimizer = tf.train.AdamOptimizer(self.lr) # apply gradient change to the all the trainable variable. self.train_op = optimizer.apply_gradients(zip(grads, tvars)) # instrument tensorboard tf.summary.histogram('logits', self.logits) tf.summary.histogram('loss', loss) tf.summary.scalar('train_loss', self.cost) def sample(self, sess, chars, vocab, num=200, prime='The ', sampling_type=1): state = sess.run(self.cell.zero_state(1, tf.float32)) for char in prime[:-1]: x = np.zeros((1, 1)) x[0, 0] = vocab[char] feed = {self.input_data: x, self.initial_state: state} [state] = sess.run([self.final_state], feed) def weighted_pick(weights): t = np.cumsum(weights) s = np.sum(weights) return int(np.searchsorted(t, np.random.rand(1)*s)) ret = prime char = prime[-1] for _ in range(num): x = np.zeros((1, 1)) x[0, 0] = vocab[char] feed = {self.input_data: x, self.initial_state: state} [probs, state] = sess.run([self.probs, self.final_state], feed) p = probs[0] if sampling_type == 0: sample = np.argmax(p) elif sampling_type == 2: if char == ' ': sample = weighted_pick(p) else: sample = np.argmax(p) else: # sampling_type == 1 default: sample = weighted_pick(p) pred = chars[sample] ret += pred char = pred return ret
s0hvaperuna/Not-a-bot
char_rnn/model.py
Python
mit
5,892
from Screens.Screen import Screen from Components.ConfigList import ConfigListScreen from Components.Sources.StaticText import StaticText from Components.config import config, ConfigSubsection, ConfigBoolean, getConfigListEntry, ConfigSelection, ConfigYesNo, ConfigIP from Components.Network import iNetwork from Components.Ipkg import IpkgComponent from enigma import eDVBDB config.misc.installwizard = ConfigSubsection() config.misc.installwizard.hasnetwork = ConfigBoolean(default = False) config.misc.installwizard.ipkgloaded = ConfigBoolean(default = False) config.misc.installwizard.channellistdownloaded = ConfigBoolean(default = False) class InstallWizard(Screen, ConfigListScreen): STATE_UPDATE = 0 STATE_CHOISE_CHANNELLIST = 1 # STATE_CHOISE_SOFTCAM = 2 def __init__(self, session, args = None): Screen.__init__(self, session) self.index = args self.list = [] ConfigListScreen.__init__(self, self.list) if self.index == self.STATE_UPDATE: config.misc.installwizard.hasnetwork.value = False config.misc.installwizard.ipkgloaded.value = False modes = {0: " "} self.enabled = ConfigSelection(choices = modes, default = 0) self.adapters = [(iNetwork.getFriendlyAdapterName(x),x) for x in iNetwork.getAdapterList()] is_found = False for x in self.adapters: if x[1] == 'eth0' or x[1] == 'eth1': if iNetwork.getAdapterAttribute(x[1], 'up'): self.ipConfigEntry = ConfigIP(default = iNetwork.getAdapterAttribute(x[1], "ip")) iNetwork.checkNetworkState(self.checkNetworkCB) if_found = True else: iNetwork.restartNetwork(self.checkNetworkLinkCB) break if is_found is False: self.createMenu() elif self.index == self.STATE_CHOISE_CHANNELLIST: self.enabled = ConfigYesNo(default = True) modes = {"ATV": "ATV default(13e-19e)", "19e": "Astra 1", "23e": "Astra 3", "19e-23e": "Astra 1 Astra 3", "19e-23e-28e": "Astra 1 Astra 2 Astra 3", "13e-19e-23e-28e": "Astra 1 Astra 2 Astra 3 Hotbird"} self.channellist_type = ConfigSelection(choices = modes, default = "ATV") self.createMenu() # elif self.index == self.STATE_CHOISE_SOFTCAM: # self.enabled = ConfigYesNo(default = True) # modes = {"cccam": _("default") + " (CCcam)", "scam": "scam"} # self.softcam_type = ConfigSelection(choices = modes, default = "cccam") # self.createMenu() def checkNetworkCB(self, data): if data < 3: config.misc.installwizard.hasnetwork.value = True self.createMenu() def checkNetworkLinkCB(self, retval): if retval: iNetwork.checkNetworkState(self.checkNetworkCB) else: self.createMenu() def createMenu(self): try: test = self.index except: return self.list = [] if self.index == self.STATE_UPDATE: if config.misc.installwizard.hasnetwork.value: self.list.append(getConfigListEntry(_("Your internet connection is working (ip: %s)") % (self.ipConfigEntry.getText()), self.enabled)) else: self.list.append(getConfigListEntry(_("Your receiver does not have an internet connection"), self.enabled)) elif self.index == self.STATE_CHOISE_CHANNELLIST: self.list.append(getConfigListEntry(_("Install channel list"), self.enabled)) if self.enabled.value: self.list.append(getConfigListEntry(_("Channel list type"), self.channellist_type)) # elif self.index == self.STATE_CHOISE_SOFTCAM: # self.list.append(getConfigListEntry(_("Install softcam"), self.enabled)) # if self.enabled.value: # self.list.append(getConfigListEntry(_("Softcam type"), self.softcam_type)) self["config"].list = self.list self["config"].l.setList(self.list) def keyLeft(self): if self.index == 0: return ConfigListScreen.keyLeft(self) self.createMenu() def keyRight(self): if self.index == 0: return ConfigListScreen.keyRight(self) self.createMenu() def run(self): if self.index == self.STATE_UPDATE: if config.misc.installwizard.hasnetwork.value: self.session.open(InstallWizardIpkgUpdater, self.index, _('Please wait (updating packages)'), IpkgComponent.CMD_UPDATE) elif self.index == self.STATE_CHOISE_CHANNELLIST and self.enabled.value and self.channellist_type.value != "ATV": self.session.open(InstallWizardIpkgUpdater, self.index, _('Please wait (downloading channel list)'), IpkgComponent.CMD_REMOVE, {'package': 'enigma2-plugin-settings-henksat-' + self.channellist_type.value}) # elif self.index == self.STATE_CHOISE_SOFTCAM and self.enabled.value: # self.session.open(InstallWizardIpkgUpdater, self.index, _('Please wait (downloading softcam)'), IpkgComponent.CMD_INSTALL, {'package': 'enigma2-plugin-softcams-' + self.softcam_type.value}) return class InstallWizardIpkgUpdater(Screen): def __init__(self, session, index, info, cmd, pkg = None): Screen.__init__(self, session) self["statusbar"] = StaticText(info) self.pkg = pkg self.index = index self.state = 0 self.ipkg = IpkgComponent() self.ipkg.addCallback(self.ipkgCallback) if self.index == InstallWizard.STATE_CHOISE_CHANNELLIST: self.ipkg.startCmd(cmd, {'package': 'enigma2-plugin-settings-*'}) else: self.ipkg.startCmd(cmd, pkg) def ipkgCallback(self, event, param): if event == IpkgComponent.EVENT_DONE: if self.index == InstallWizard.STATE_UPDATE: config.misc.installwizard.ipkgloaded.value = True elif self.index == InstallWizard.STATE_CHOISE_CHANNELLIST: if self.state == 0: self.ipkg.startCmd(IpkgComponent.CMD_INSTALL, self.pkg) self.state = 1 return else: config.misc.installwizard.channellistdownloaded.value = True eDVBDB.getInstance().reloadBouquets() eDVBDB.getInstance().reloadServicelist() self.close()
0sc0d3r/enigma2
lib/python/Screens/InstallWizard.py
Python
gpl-2.0
5,657
from direct.task.Task import Task import random from toontown.classicchars import CCharPaths from toontown.safezone import Playground from toontown.toonbase import TTLocalizer class TTPlayground(Playground.Playground): def enter(self, requestStatus): Playground.Playground.enter(self, requestStatus) taskMgr.doMethodLater(1, self.__birds, 'TT-birds') def exit(self): Playground.Playground.exit(self) taskMgr.remove('TT-birds') def showPaths(self): self.showPathPoints(CCharPaths.getPaths(TTLocalizer.Mickey)) def __birds(self, task): base.playSfx(random.choice(self.loader.birdSound)) time = random.random() * 20.0 + 1 taskMgr.doMethodLater(time, self.__birds, 'TT-birds') return Task.done
Spiderlover/Toontown
toontown/safezone/TTPlayground.py
Python
mit
783
## # Copyright (c) 2012-2014 Apple Inc. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. ## from caldavclientlibrary.protocol.url import URL from caldavclientlibrary.protocol.webdav.definitions import davxml from contrib.performance.sqlusage.requests.httpTests import HTTPTestBase from txweb2.dav.util import joinURL from pycalendar.datetime import DateTime ICAL = """BEGIN:VCALENDAR CALSCALE:GREGORIAN PRODID:-//Example Inc.//Example Calendar//EN VERSION:2.0 BEGIN:VTIMEZONE LAST-MODIFIED:20040110T032845Z TZID:US/Eastern BEGIN:DAYLIGHT DTSTART:20000404T020000 RRULE:FREQ=YEARLY;BYDAY=1SU;BYMONTH=4 TZNAME:EDT TZOFFSETFROM:-0500 TZOFFSETTO:-0400 END:DAYLIGHT BEGIN:STANDARD DTSTART:20001026T020000 RRULE:FREQ=YEARLY;BYDAY=-1SU;BYMONTH=10 TZNAME:EST TZOFFSETFROM:-0400 TZOFFSETTO:-0500 END:STANDARD END:VTIMEZONE BEGIN:VEVENT DTSTAMP:20051222T205953Z CREATED:20060101T150000Z DTSTART;TZID=US/Eastern:%d0101T100000 DURATION:PT1H SUMMARY:event 1 UID:sync-collection-%d-ics END:VEVENT END:VCALENDAR """.replace("\n", "\r\n") class SyncTest(HTTPTestBase): """ A sync operation """ def __init__(self, label, sessions, logFilePath, full, count): super(SyncTest, self).__init__(label, sessions, logFilePath) self.full = full self.count = count self.synctoken = "" def prepare(self): """ Do some setup prior to the real request. """ if not self.full: # Get current sync token results, _ignore_bad = self.sessions[0].getProperties(URL(path=self.sessions[0].calendarHref), (davxml.sync_token,)) self.synctoken = results[davxml.sync_token] # Add resources to create required number of changes now = DateTime.getNowUTC() for i in range(self.count): href = joinURL(self.sessions[0].calendarHref, "sync-collection-%d.ics" % (i + 1,)) self.sessions[0].writeData(URL(path=href), ICAL % (now.getYear() + 1, i + 1,), "text/calendar") def doRequest(self): """ Execute the actual HTTP request. """ props = ( davxml.getetag, davxml.getcontenttype, ) # Run sync collection self.sessions[0].syncCollection(URL(path=self.sessions[0].calendarHref), self.synctoken, props) def cleanup(self): """ Do some cleanup after the real request. """ if not self.full: # Remove created resources for i in range(self.count): href = joinURL(self.sessions[0].calendarHref, "sync-collection-%d.ics" % (i + 1,)) self.sessions[0].deleteResource(URL(path=href))
trevor/calendarserver
contrib/performance/sqlusage/requests/sync.py
Python
apache-2.0
3,208
# -*- coding: utf-8 -*- ############################################################################## # # OpenERP, Open Source Management Solution # Copyright (C) 2004-2010 Tiny SPRL (<http://tiny.be>). # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as # published by the Free Software Foundation, either version 3 of the # License, or (at your option) any later version. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <http://www.gnu.org/licenses/>. # ############################################################################## import time from openerp.osv import fields, osv class account_analytic_cost_ledger_journal_report(osv.osv_memory): _name = 'account.analytic.cost.ledger.journal.report' _description = 'Account Analytic Cost Ledger For Journal Report' _columns = { 'date1': fields.date('Start of period', required=True), 'date2': fields.date('End of period', required=True), 'journal': fields.many2many('account.analytic.journal', 'ledger_journal_rel', 'ledger_id', 'journal_id', 'Journals'), } _defaults = { 'date1': lambda *a: time.strftime('%Y-01-01'), 'date2': lambda *a: time.strftime('%Y-%m-%d') } def check_report(self, cr, uid, ids, context=None): if context is None: context = {} data = self.read(cr, uid, ids)[0] datas = { 'ids': context.get('active_ids',[]), 'model': 'account.analytic.account', 'form': data } return { 'type': 'ir.actions.report.xml', 'report_name': 'account.analytic.account.quantity_cost_ledger', 'datas': datas, } account_analytic_cost_ledger_journal_report() # vim:expandtab:smartindent:tabstop=4:softtabstop=4:shiftwidth=4:
inovtec-solutions/OpenERP
openerp/addons/account/project/wizard/account_analytic_cost_ledger_for_journal_report.py
Python
agpl-3.0
2,240
# -*- coding: utf-8 -*- """ Created on Tue Oct 07 16:25:23 2014 @author: Yang Xuefeng """ from __future__ import division import numpy as np import cPickle as cp import sys import scipy.stats as ss import bisect import argparse class evaluation(object): def __init__(self, wl): s = set(wl.keys()) f = np.load(r'D:\SS\ResourceData\antonmys\wordsim353.npz') words = f['w'] score = f['s'] score = [float(i) for i in score] select_index = [i for i in xrange(len(words)) if words[i][0] in s and words[i][1] in s] self.words353 = [words[i] for i in select_index] self.score353 = [score[i] for i in select_index] self.index353 = [(wl.get(i[0],0), wl.get(i[1],0)) for i in self.words353] f = np.load(r'D:\SS\ResourceData\antonmys\turk771.npz') words = f['w'] score = f['s'] score = [float(i) for i in score] select_index = [i for i in xrange(len(words)) if words[i][0] in s and words[i][1] in s] self.words771 = [words[i] for i in select_index] self.score771 = [score[i] for i in select_index] self.index771 = [(wl.get(i[0],0), wl.get(i[1],0)) for i in self.words771] f = np.load(r'D:\SS\ResourceData\antonmys\rg65.npz') words = f['w'] score = f['s'] score = [float(i) for i in score] select_index = [i for i in xrange(len(words)) if words[i][0] in s and words[i][1] in s] self.words65 = [words[i] for i in select_index] self.score65 = [score[i] for i in select_index] self.index65 = [(wl.get(i[0],0), wl.get(i[1],0)) for i in self.words65] f = np.load(r'D:\SS\ResourceData\antonmys\yp130.npz') words = f['w'] score = f['s'] score = [float(i) for i in score] select_index = [i for i in xrange(len(words)) if words[i][0] in s and words[i][1] in s] self.words130 = [words[i] for i in select_index] self.score130 = [score[i] for i in select_index] self.index130 = [(wl.get(i[0],0), wl.get(i[1],0)) for i in self.words130] f = np.load(r'D:\SS\ResourceData\antonmys\M3k.npz') words = f['w'] score = f['s'] score = [float(i) for i in score] select_index = [i for i in xrange(len(words)) if words[i][0] in s and words[i][1] in s] self.words3k = [words[i] for i in select_index] self.score3k = [score[i] for i in select_index] self.index3k = [(wl.get(i[0],0), wl.get(i[1],0)) for i in self.words3k] l = cp.load(open(r'D:\SS\ResourceData\antonmys\analogy_g.pkl')) l = [i for i in l if i[0] in s and i[1] in s and i[2] in s and i[3] in s] self.word_g = l self.index_g = [(wl[i[0]],wl[i[1]],wl[i[2]],wl[i[3]]) for i in l] index_list = zip(*self.index_g) self.index_g_mat = [list(i) for i in index_list] l = cp.load(open(r'D:\SS\ResourceData\antonmys\analogy_m.pkl')) l = [i for i in l if i[0] in s and i[1] in s and i[2] in s and i[3] in s] self.word_m = l self.index_m = [(wl[i[0]],wl[i[1]],wl[i[2]],wl[i[3]]) for i in l] index_list = zip(*self.index_m) self.index_m_mat = [list(i) for i in index_list] f = np.load(r'D:\SS\ResourceData\antonmys\sent_complete.npz') select = [] for i in xrange(len(f['c'])): t = [1 for j in f['c'][i] if j in s] p = [1 for j in f['s'][i] if j in s] if len(t)==5 and 2*len(p)>len(f['s'][i]): select.append(i) #print len(select) self.sents = [f['s'][i] for i in select] self.candidates = [f['c'][i] for i in select] self.answers = [f['a'][i] for i in select] self.index_sents = [] self.index_candidates = [] self.index_answers = [wl[i] for i in self.answers] for i in self.sents: t = [wl[j] for j in i if j in s] self.index_sents.append(t) for i in self.candidates: t = [wl[j] for j in i] self.index_candidates.append(t) def sent_completation(self,epoch,wm): r = [] for i in xrange(len(self.answers)): t = [] for j in self.index_candidates[i]: simi = [self.get_cosine(wm[j,:], wm[k,:]) for k in self.index_sents[i]] t.append((j,np.mean(simi))) t.sort(key=lambda x:x[1]) r.append(t[-1][0]) f = [1 if r[i]==self.index_answers[i] else 0 for i in xrange(len(r))] result = sum(f)/len(r) return result def word353(self, wm): simi = [self.get_cosine(wm[i[0],:], wm[i[1],:]) for i in self.index353] r,p = ss.spearmanr(simi, self.score353) return r def turk771(self, wm): simi = [self.get_cosine(wm[i[0],:], wm[i[1],:]) for i in self.index771] r,p = ss.spearmanr(simi, self.score771) return r def rg65(self,wm): simi = [self.get_cosine(wm[i[0],:], wm[i[1],:]) for i in self.index65] r,p = ss.spearmanr(simi, self.score65) return r def yp130(self, wm): simi = [self.get_cosine(wm[i[0],:], wm[i[1],:]) for i in self.index130] r,p = ss.spearmanr(simi, self.score130) return r def m3k(self, wm): simi = [self.get_cosine(wm[i[0],:], wm[i[1],:]) for i in self.index3k] r,p = ss.spearmanr(simi, self.score3k) return r def analogy(self,wm,t): wm_t = wm.transpose() if t == 'g': a = self.index_g_mat[0] b = self.index_g_mat[1] c = self.index_g_mat[2] d = self.index_g_mat[3] elif t == 'm': a = self.index_m_mat[0] b = self.index_m_mat[1] c = self.index_m_mat[2] d = self.index_m_mat[3] ma = wm[a,:] mb = wm[b,:] mc = wm[c,:] m = mb + mc- ma l = [] for i in xrange(len(a)): simi = np.dot(m[i,:],wm_t) simi[[a[i],b[i],c[i]]] = -1 l.append(np.argmax(simi)) r = [1 if d[i]==l[i] else 0 for i in xrange(len(d))] r = sum(r)/len(d) return r def eval_all(self,wm): r = [] r.append(self.word353(wm)) r.append(self.rg65(wm)) r.append(self.yp130(wm)) r.append(self.turk771(wm)) r.append(self.m3k(wm)) r.append(self.analogy(wm,'g')) r.append(self.analogy(wm,'m')) r.append(self.sent_completation(wm)) return r class fine_tuning(object): def __init__(self, wl,sr): """ """ self.sr = float(sr) self.wl = wl it = wl.items() it = [(i[1],i[0]) for i in it] self.lw = dict(it) def normalization_mat(self, wm): a,b = wm.shape norms = [np.sqrt(np.sum(np.square(wm[i,:]))) for i in xrange(a)] norms = np.array(norms).reshape(a,1) wm = wm/norms return wm def normalization_vec(self, v): norm = np.sqrt(np.sum(np.square(v))) v = v/norm return v def random_matrix_thres(self, wm): np.random.seed(10000) a,b = wm.shape rm = np.random.uniform(-1,1,(a,b)) norms = [np.sqrt(np.sum(np.square(rm[i,:]))) for i in xrange(a)] norms = np.array(norms).reshape(a,1) rm = rm/norms rand_index = np.random.randint(0,a-1,300) r = [] rmt = rm.transpose() for i in rand_index: simi = np.dot(rm[i,:],rmt) r.append(np.mean(np.sort(simi)[-3:-1])) thres = np.mean(r) self.thres = thres def judge(self,i1,i2): if i1 < i2: return 1 elif i1 > i2: return -1 else: return 0 def get_local_direction(self, k, wm,simi,kb): index = np.argsort(simi) simi_sort = simi[index] number = wm.shape[0] - bisect.bisect_left(simi_sort, self.thres) if number > 300: number = 300 index = index[::-1] index_dict = {index[i]:i-1 for i in xrange(len(index))} inter = set.intersection(set(index[0:number]),set(kb)) kb_bad = set(kb)-inter index_bad = set(index[0:number])-inter index_bad_sign = [(i,-1) for i in index_bad] index_bad_error = [abs(number-index_dict[i]) for i in index_bad] kb_bad_sign = [(i,1) for i in kb_bad] kb_bad_error = [abs(index_dict[kb[i]]-i) for i in xrange(len(kb)) if kb[i] in kb_bad] inter_sign_error = [abs(index_dict[kb[i]]-i) for i in xrange(len(kb)) if kb[i] in inter] inter_sign = [(kb[i],self.judge(i,index_dict[kb[i]])) for i in xrange(len(kb)) if kb[i] in inter] inter_sign = [i for i in inter_sign if i[1]!=0] kb_bad_sign.extend(inter_sign) kb_bad_sign.extend(index_bad_sign) kb_bad_error.extend(index_bad_error) kb_bad_error.extend(inter_sign_error) error = np.sum(kb_bad_error) index_sign = zip(*kb_bad_sign) index = list(index_sign[0]) sign = np.array(index_sign[1]).reshape(len(index_sign[1]),1) temp = wm[index,:] result = sign * temp return result ,error def get_update(self, k, wm, simi, kb): """ """ result, error = self.get_local_direction(k,wm,simi,kb) result = np.mean(result,axis=0).reshape(1,result.shape[1]) result = self.normalization_vec(result) return result, error def get_cosine(self, x, y): nominator = np.sum( x * y ) dominator = np.sqrt(np.sum(x*x)) * np.sqrt(np.sum(y*y)) return nominator/dominator def training(self, wl, wm, kb, eva,evaluate=True): epoch = 1 wm = ft.normalization_mat(wm) wm_t = wm.transpose() if eva: result = eva.eval_all(wm) print result error_list = [] error_list.append(100000000000) stop = True learning_rate = 0.1 while(stop): count = 0 l_e = [] print 'epoch: {}'.format(epoch) for k in kb.keys(): count = count + 1 simi = np.dot(wm[k,:],wm_t) update, error = self.get_update(k, wm, simi, kb[k]) #print error l_e.append(error) update = update * learning_rate wm[k,:] = wm[k,:]+ update wm[k,:] = ft.normalization_vec(wm[k,:]) sys.stdout.write('{:10d} fin'.format(count)) sys.stdout.write('\r') sys.stdout.flush() epoch = epoch + 1 if eva: result = eva.eval_all(wm) print result error = np.mean(l_e) error_list.append(error) if len(error_list)>2: if error_list[-2]-error_list[-1]< error_list[1] * ft.sr: stop = False print error return wm, error_list if __name__ == "__main__": parser = argparse.ArgumentParser() parser.add_argument('-wm','-word_matrix') parser.add_argument('-wl','-word_list') parser.add_argument('-kb','-knowledge_base') parser.add_argument('-out','-output_file') #parser.add_argument('-res','-output_result') parser.add_argument('-s','-stop_rate') args = parser.parse_args() name_wl = args.wl name_wm = args.wm name_kb = args.kb name_out = args.out #name_res = args.res sr = args.s print 'loading' kb = cp.load(open(name_kb)) wl = cp.load(open(name_wl)) wm = np.load(name_wm) norms = np.sqrt(np.sum(np.square(wm),axis=1)) print 'Generating Threshold' ft = fine_tuning(wl,sr) ft.random_matrix_thres(wm) #eva = evaluation(wl) print 'Training Start' eva = False wm,el = ft.training(wl, wm, kb, eva) np.save(name_out,wm)
YangXuefeng/SWEL
train_embedding_git.py
Python
mit
12,334
# -*- coding: utf-8 -*- from __future__ import unicode_literals import inspect import os.path import biplist settingsFilename = inspect.getframeinfo(inspect.currentframe()).filename settingsPath = os.path.dirname(os.path.abspath(settingsFilename)) # # Example settings file for dmgbuild # # Use like this: dmgbuild -s settings.py "Test Volume" test.dmg # You can actually use this file for your own application (not just TextEdit) # by doing e.g. # # dmgbuild -s settings.py -D app=/path/to/My.app "My Application" MyApp.dmg # .. Useful stuff .............................................................. application = defines.get('app', '/Applications/TextEdit.app') appname = os.path.basename(application) def icon_from_app(app_path): plist_path = os.path.join(app_path, 'Contents', 'Info.plist') plist = biplist.readPlist(plist_path) icon_name = plist['CFBundleIconFile'] icon_root, icon_ext = os.path.splitext(icon_name) if not icon_ext: icon_ext = '.icns' icon_name = icon_root + icon_ext return os.path.join(app_path, 'Contents', 'Resources', icon_name) # .. Basics .................................................................... # Uncomment to override the output filename # filename = 'test.dmg' # Uncomment to override the output volume name # volume_name = 'Test' # Volume format (see hdiutil create -help) format = defines.get('format', 'UDBZ') # Volume size size = defines.get('size', None) # Files to include files = [application] # Symlinks to create symlinks = {'Applications': '/Applications'} # Volume icon # # You can either define icon, in which case that icon file will be copied to the # image, *or* you can define badge_icon, in which case the icon file you specify # will be used to badge the system's Removable Disk icon # # icon = '/path/to/icon.icns' badge_icon = icon_from_app(application) # Where to put the icons icon_locations = { # appname: (140, 120), # 'Applications': (500, 120) appname: (175, 180), 'Applications': (440, 180) } # .. Window configuration ...................................................... # Background # # This is a STRING containing any of the following: # # #3344ff - web-style RGB color # #34f - web-style RGB color, short form (#34f == #3344ff) # rgb(1,0,0) - RGB color, each value is between 0 and 1 # hsl(120,1,.5) - HSL (hue saturation lightness) color # hwb(300,0,0) - HWB (hue whiteness blackness) color # cmyk(0,1,0,0) - CMYK color # goldenrod - X11/SVG named color # builtin-arrow - A simple built-in background with a blue arrow # /foo/bar/baz.png - The path to an image file # # The hue component in hsl() and hwb() may include a unit; it defaults to # degrees ('deg'), but also supports radians ('rad') and gradians ('grad' # or 'gon'). # # Other color components may be expressed either in the range 0 to 1, or # as percentages (e.g. 60% is equivalent to 0.6). # background = 'builtin-arrow' background = os.path.join(settingsPath, 'background.tiff') show_status_bar = False show_tab_view = False show_toolbar = False show_pathbar = False show_sidebar = False sidebar_width = 180 # Window position in ((x, y), (w, h)) format # window_rect = ((100, 100), (640, 280)) window_rect = ((100, 100), (600, 400)) # Select the default view; must be one of # # 'icon-view' # 'list-view' # 'column-view' # 'coverflow' # default_view = 'icon-view' # General view configuration show_icon_preview = False # Set these to True to force inclusion of icon/list view settings (otherwise # we only include settings for the default view) include_icon_view_settings = 'auto' include_list_view_settings = 'auto' # .. Icon view configuration ................................................... arrange_by = None grid_offset = (0, 0) grid_spacing = 100 scroll_position = (0, 0) label_pos = 'bottom' # or 'right' text_size = 16 icon_size = 96 # .. List view configuration ................................................... # Column names are as follows: # # name # date-modified # date-created # date-added # date-last-opened # size # kind # label # version # comments # list_icon_size = 16 list_text_size = 12 list_scroll_position = (0, 0) list_sort_by = 'name' list_use_relative_dates = True list_calculate_all_sizes = False, list_columns = ('name', 'date-modified', 'size', 'kind', 'date-added') list_column_widths = { 'name': 300, 'date-modified': 181, 'date-created': 181, 'date-added': 181, 'date-last-opened': 181, 'size': 97, 'kind': 115, 'label': 100, 'version': 75, 'comments': 300, } list_column_sort_directions = { 'name': 'ascending', 'date-modified': 'descending', 'date-created': 'descending', 'date-added': 'descending', 'date-last-opened': 'descending', 'size': 'descending', 'kind': 'ascending', 'label': 'ascending', 'version': 'ascending', 'comments': 'ascending', } # .. License configuration ..................................................... # Text in the license configuration is stored in the resources, which means # it gets stored in a legacy Mac encoding according to the language. dmgbuild # will *try* to convert Unicode strings to the appropriate encoding, *but* # you should be aware that Python doesn't support all of the necessary encodings; # in many cases you will need to encode the text yourself and use byte strings # instead here. # Recognized language names are: # # af_ZA, ar, be_BY, bg_BG, bn, bo, br, ca_ES, cs_CZ, cy, da_DK, de_AT, de_CH, # de_DE, dz_BT, el_CY, el_GR, en_AU, en_CA, en_GB, en_IE, en_SG, en_US, eo, # es_419, es_ES, et_EE, fa_IR, fi_FI, fo_FO, fr_001, fr_BE, fr_CA, fr_CH, # fr_FR, ga-Latg_IE, ga_IE, gd, grc, gu_IN, gv, he_IL, hi_IN, hr_HR, hu_HU, # hy_AM, is_IS, it_CH, it_IT, iu_CA, ja_JP, ka_GE, kl, ko_KR, lt_LT, lv_LV, # mk_MK, mr_IN, mt_MT, nb_NO, ne_NP, nl_BE, nl_NL, nn_NO, pa, pl_PL, pt_BR, # pt_PT, ro_RO, ru_RU, se, sk_SK, sl_SI, sr_RS, sv_SE, th_TH, to_TO, tr_TR, # uk_UA, ur_IN, ur_PK, uz_UZ, vi_VN, zh_CN, zh_TW # license = { # 'default-language': 'en_US', # 'licenses': { # # For each language, the text of the license. This can be plain text, # # RTF (in which case it must start "{\rtf1"), or a path to a file # # containing the license text. If you're using RTF, # # watch out for Python escaping (or read it from a file). # 'English': b'''{\\rtf1\\ansi\\ansicpg1252\\cocoartf1504\\cocoasubrtf820 # {\\fonttbl\\f0\\fnil\\fcharset0 Helvetica-Bold;\\f1\\fnil\\fcharset0 Helvetica;} # {\\colortbl;\\red255\\green255\\blue255;\\red0\\green0\\blue0;} # {\\*\\expandedcolortbl;;\\cssrgb\\c0\\c0\\c0;} # \\paperw11905\\paperh16837\\margl1133\\margr1133\\margb1133\\margt1133 # \\deftab720 # \\pard\\pardeftab720\\sa160\\partightenfactor0 # \\f0\\b\\fs60 \\cf2 \\expnd0\\expndtw0\\kerning0 # \\up0 \\nosupersub \\ulnone \\outl0\\strokewidth0 \\strokec2 Test License\\ # \\pard\\pardeftab720\\sa160\\partightenfactor0 # \\fs36 \\cf2 \\strokec2 What is this?\\ # \\pard\\pardeftab720\\sa160\\partightenfactor0 # \\f1\\b0\\fs22 \\cf2 \\strokec2 This is the English license. It says what you are allowed to do with this software.\\ # \\ # }''', # }, # 'buttons': { # # For each language, text for the buttons on the licensing window. # # # # Default buttons and text are built-in for the following languages: # # # # English (en_US), German (de_DE), Spanish (es_ES), French (fr_FR), # # Italian (it_IT), Japanese (ja_JP), Dutch (nl_NL), Swedish (sv_SE), # # Brazilian Portuguese (pt_BR), Simplified Chinese (zh_CN), # # Traditional Chinese (zh_TW), Danish (da_DK), Finnish (fi_FI), # # Korean (ko_KR), Norwegian (nb_NO) # # # # You don't need to specify them for those languages; if you fail to # # specify them for some other language, English will be used instead. # 'en_US': ( # b'English', # b'Agree', # b'Disagree', # b'Print', # b'Save', # b'If you agree with the terms of this license, press "Agree" to ' # b'install the software. If you do not agree, press "Disagree".' # ), # }, # }
OpenEstate/OpenEstate-Tool-Server
src/dmgbuild/settings.py
Python
apache-2.0
8,372
import locale from jinja2.utils import generate_lorem_ipsum from pelican.contents import Article, Author from pelican.paginator import Paginator from pelican.settings import DEFAULT_CONFIG from pelican.tests.support import get_settings, unittest # generate one paragraph, enclosed with <p> TEST_CONTENT = str(generate_lorem_ipsum(n=1)) TEST_SUMMARY = generate_lorem_ipsum(n=1, html=False) class TestPage(unittest.TestCase): def setUp(self): super().setUp() self.old_locale = locale.setlocale(locale.LC_ALL) locale.setlocale(locale.LC_ALL, 'C') self.page_kwargs = { 'content': TEST_CONTENT, 'context': { 'localsiteurl': '', }, 'metadata': { 'summary': TEST_SUMMARY, 'title': 'foo bar', }, 'source_path': '/path/to/file/foo.ext' } def tearDown(self): locale.setlocale(locale.LC_ALL, self.old_locale) def test_save_as_preservation(self): settings = get_settings() # fix up pagination rules from pelican.paginator import PaginationRule pagination_rules = [ PaginationRule(*r) for r in settings.get( 'PAGINATION_PATTERNS', DEFAULT_CONFIG['PAGINATION_PATTERNS'], ) ] settings['PAGINATION_PATTERNS'] = sorted( pagination_rules, key=lambda r: r[0], ) self.page_kwargs['metadata']['author'] = Author('Blogger', settings) object_list = [Article(**self.page_kwargs), Article(**self.page_kwargs)] paginator = Paginator('foobar.foo', 'foobar/foo', object_list, settings) page = paginator.page(1) self.assertEqual(page.save_as, 'foobar.foo') def test_custom_pagination_pattern(self): from pelican.paginator import PaginationRule settings = get_settings() settings['PAGINATION_PATTERNS'] = [PaginationRule(*r) for r in [ (1, '/{url}', '{base_name}/index.html'), (2, '/{url}{number}/', '{base_name}/{number}/index.html') ]] self.page_kwargs['metadata']['author'] = Author('Blogger', settings) object_list = [Article(**self.page_kwargs), Article(**self.page_kwargs)] paginator = Paginator('blog/index.html', '//blog.my.site/', object_list, settings, 1) # The URL *has to* stay absolute (with // in the front), so verify that page1 = paginator.page(1) self.assertEqual(page1.save_as, 'blog/index.html') self.assertEqual(page1.url, '//blog.my.site/') page2 = paginator.page(2) self.assertEqual(page2.save_as, 'blog/2/index.html') self.assertEqual(page2.url, '//blog.my.site/2/') def test_custom_pagination_pattern_last_page(self): from pelican.paginator import PaginationRule settings = get_settings() settings['PAGINATION_PATTERNS'] = [PaginationRule(*r) for r in [ (1, '/{url}1/', '{base_name}/1/index.html'), (2, '/{url}{number}/', '{base_name}/{number}/index.html'), (-1, '/{url}', '{base_name}/index.html'), ]] self.page_kwargs['metadata']['author'] = Author('Blogger', settings) object_list = [Article(**self.page_kwargs), Article(**self.page_kwargs), Article(**self.page_kwargs)] paginator = Paginator('blog/index.html', '//blog.my.site/', object_list, settings, 1) # The URL *has to* stay absolute (with // in the front), so verify that page1 = paginator.page(1) self.assertEqual(page1.save_as, 'blog/1/index.html') self.assertEqual(page1.url, '//blog.my.site/1/') page2 = paginator.page(2) self.assertEqual(page2.save_as, 'blog/2/index.html') self.assertEqual(page2.url, '//blog.my.site/2/') page3 = paginator.page(3) self.assertEqual(page3.save_as, 'blog/index.html') self.assertEqual(page3.url, '//blog.my.site/')
getpelican/pelican
pelican/tests/test_paginator.py
Python
agpl-3.0
4,173
class Time(object): def __init__(self, hours=0, minutes=0, seconds=0): self.hours = hours self.minutes = minutes self.seconds = seconds def __str__(self): return str(self.hours) + ":" + \ str(self.minutes) + ":" + \ str(self.seconds)
medifle/python_6.00.1x
classTime.py
Python
mit
306
# # Module implementing queues # # multiprocessing/queues.py # # Copyright (c) 2006-2008, R Oudkerk --- see COPYING.txt # __all__ = ['Queue', 'SimpleQueue', 'JoinableQueue'] import sys import os import threading import collections import time import atexit import weakref from queue import Empty, Full import _multiprocessing from multiprocessing import Pipe from multiprocessing.synchronize import Lock, BoundedSemaphore, Semaphore, Condition from multiprocessing.util import debug, info, Finalize, register_after_fork from multiprocessing.forking import assert_spawning # # Queue type using a pipe, buffer and thread # class Queue(object): def __init__(self, maxsize=0): if maxsize <= 0: maxsize = _multiprocessing.SemLock.SEM_VALUE_MAX self._maxsize = maxsize self._reader, self._writer = Pipe(duplex=False) self._rlock = Lock() self._opid = os.getpid() if sys.platform == 'win32': self._wlock = None else: self._wlock = Lock() self._sem = BoundedSemaphore(maxsize) self._after_fork() if sys.platform != 'win32': register_after_fork(self, Queue._after_fork) def __getstate__(self): assert_spawning(self) return (self._maxsize, self._reader, self._writer, self._rlock, self._wlock, self._sem, self._opid) def __setstate__(self, state): (self._maxsize, self._reader, self._writer, self._rlock, self._wlock, self._sem, self._opid) = state self._after_fork() def _after_fork(self): debug('Queue._after_fork()') self._notempty = threading.Condition(threading.Lock()) self._buffer = collections.deque() self._thread = None self._jointhread = None self._joincancelled = False self._closed = False self._close = None self._send = self._writer.send self._recv = self._reader.recv self._poll = self._reader.poll def put(self, obj, block=True, timeout=None): assert not self._closed if not self._sem.acquire(block, timeout): raise Full self._notempty.acquire() try: if self._thread is None: self._start_thread() self._buffer.append(obj) self._notempty.notify() finally: self._notempty.release() def get(self, block=True, timeout=None): if block and timeout is None: self._rlock.acquire() try: res = self._recv() self._sem.release() return res finally: self._rlock.release() else: if block: deadline = time.time() + timeout if not self._rlock.acquire(block, timeout): raise Empty try: if not self._poll(block and (deadline-time.time()) or 0.0): raise Empty res = self._recv() self._sem.release() return res finally: self._rlock.release() def qsize(self): # Raises NotImplementedError on Mac OSX because of broken sem_getvalue() return self._maxsize - self._sem._semlock._get_value() def empty(self): return not self._poll() def full(self): return self._sem._semlock._is_zero() def get_nowait(self): return self.get(False) def put_nowait(self, obj): return self.put(obj, False) def close(self): self._closed = True self._reader.close() if self._close: self._close() def join_thread(self): debug('Queue.join_thread()') assert self._closed if self._jointhread: self._jointhread() def cancel_join_thread(self): debug('Queue.cancel_join_thread()') self._joincancelled = True try: self._jointhread.cancel() except AttributeError: pass def _start_thread(self): debug('Queue._start_thread()') # Start thread which transfers data from buffer to pipe self._buffer.clear() self._thread = threading.Thread( target=Queue._feed, args=(self._buffer, self._notempty, self._send, self._wlock, self._writer.close), name='QueueFeederThread' ) self._thread.daemon = True debug('doing self._thread.start()') self._thread.start() debug('... done self._thread.start()') # On process exit we will wait for data to be flushed to pipe. # # However, if this process created the queue then all # processes which use the queue will be descendants of this # process. Therefore waiting for the queue to be flushed # is pointless once all the child processes have been joined. created_by_this_process = (self._opid == os.getpid()) if not self._joincancelled and not created_by_this_process: self._jointhread = Finalize( self._thread, Queue._finalize_join, [weakref.ref(self._thread)], exitpriority=-5 ) # Send sentinel to the thread queue object when garbage collected self._close = Finalize( self, Queue._finalize_close, [self._buffer, self._notempty], exitpriority=10 ) @staticmethod def _finalize_join(twr): debug('joining queue thread') thread = twr() if thread is not None: thread.join() debug('... queue thread joined') else: debug('... queue thread already dead') @staticmethod def _finalize_close(buffer, notempty): debug('telling queue thread to quit') notempty.acquire() try: buffer.append(_sentinel) notempty.notify() finally: notempty.release() @staticmethod def _feed(buffer, notempty, send, writelock, close): debug('starting thread to feed data to pipe') from .util import is_exiting nacquire = notempty.acquire nrelease = notempty.release nwait = notempty.wait bpopleft = buffer.popleft sentinel = _sentinel if sys.platform != 'win32': wacquire = writelock.acquire wrelease = writelock.release else: wacquire = None try: while 1: nacquire() try: if not buffer: nwait() finally: nrelease() try: while 1: obj = bpopleft() if obj is sentinel: debug('feeder thread got sentinel -- exiting') close() return if wacquire is None: send(obj) else: wacquire() try: send(obj) finally: wrelease() except IndexError: pass except Exception as e: # Since this runs in a daemon thread the resources it uses # may be become unusable while the process is cleaning up. # We ignore errors which happen after the process has # started to cleanup. try: if is_exiting(): info('error in queue thread: %s', e) else: import traceback traceback.print_exc() except Exception: pass _sentinel = object() # # A queue type which also supports join() and task_done() methods # # Note that if you do not call task_done() for each finished task then # eventually the counter's semaphore may overflow causing Bad Things # to happen. # class JoinableQueue(Queue): def __init__(self, maxsize=0): Queue.__init__(self, maxsize) self._unfinished_tasks = Semaphore(0) self._cond = Condition() def __getstate__(self): return Queue.__getstate__(self) + (self._cond, self._unfinished_tasks) def __setstate__(self, state): Queue.__setstate__(self, state[:-2]) self._cond, self._unfinished_tasks = state[-2:] def put(self, item, block=True, timeout=None): Queue.put(self, item, block, timeout) self._unfinished_tasks.release() def task_done(self): self._cond.acquire() try: if not self._unfinished_tasks.acquire(False): raise ValueError('task_done() called too many times') if self._unfinished_tasks._semlock._is_zero(): self._cond.notify_all() finally: self._cond.release() def join(self): self._cond.acquire() try: if not self._unfinished_tasks._semlock._is_zero(): self._cond.wait() finally: self._cond.release() # # Simplified Queue type -- really just a locked pipe # class SimpleQueue(object): def __init__(self): self._reader, self._writer = Pipe(duplex=False) self._rlock = Lock() if sys.platform == 'win32': self._wlock = None else: self._wlock = Lock() self._make_methods() def empty(self): return not self._reader.poll() def __getstate__(self): assert_spawning(self) return (self._reader, self._writer, self._rlock, self._wlock) def __setstate__(self, state): (self._reader, self._writer, self._rlock, self._wlock) = state self._make_methods() def _make_methods(self): recv = self._reader.recv racquire, rrelease = self._rlock.acquire, self._rlock.release def get(): racquire() try: return recv() finally: rrelease() self.get = get if self._wlock is None: # writes to a message oriented win32 pipe are atomic self.put = self._writer.send else: send = self._writer.send wacquire, wrelease = self._wlock.acquire, self._wlock.release def put(obj): wacquire() try: return send(obj) finally: wrelease() self.put = put
MalloyPower/parsing-python
front-end/testsuite-python-lib/Python-3.1/Lib/multiprocessing/queues.py
Python
mit
10,719
#!/usr/bin/env python3 # -*- coding: utf-8 -*- # ''' Creation of a FA file from a compacted fact int file. @author pierre peterlongo [email protected] ''' import sys import K3000_common as kc def index_sequences_seek(compacted_facts_fa_file_name): ''' Stores for each sequence header its position in the fa file. This is used latter to retrieve the corresponding sequences ''' header_to_file_position = {} compacted_facts_fa_file=open(compacted_facts_fa_file_name) file_size=kc.file_size(compacted_facts_fa_file) step=0 while(True): if step%10000==0: kc.update_progress(compacted_facts_fa_file.tell()/file_size) step+=1 pos=compacted_facts_fa_file.tell() header_fa=compacted_facts_fa_file.readline() if not header_fa: break header_fa=header_fa.strip().split()[0] # remove the starting and ending positions from the headers. TODO use them for provinding the overlap length between nodes. compacted_facts_fa_file.readline().strip() # dont care header_to_file_position[kc.generate_header(header_fa[1:])]=pos # print(header_fa[1:]," pos ",pos) kc.update_progress(1) compacted_facts_fa_file.close() return header_to_file_position def yield_occurring_positions_reverse(k,kmer, seq): for i in range(len(seq)-k,-1,-1): if seq[i:i+k] == kmer: # if kc.hamming_near_perfect(seq[i:i+k],kmer): yield i def overlap_length(seqA, seqB): ''' For two UPPER CASE sequences that overlap at least by at least k characters, return the length of the largest overlap with hamming distance < 5 1/ find on seqB all occurrence positions of the last kmer of seqA 2/ check for each position (from the biggest) that the overlap is perfect 3/ return the length of the biggest overlap. ''' k=13 last_seqA_kmer=seqA[-k:] # print("seqA", seqA) # print("seqB", seqB) # print("last_seqA_kmer", last_seqA_kmer) erro_code=-1 for i in yield_occurring_positions_reverse(k,last_seqA_kmer, seqB): if len(seqA[-i-k:]) != len(seqB[:i+k]): # a sequence is included into another one, we do not print those edges erro_code=-2 if i+k > len(seqA): erro_code=-2 if kc.hamming_near_perfect(seqA[-i-k:], seqB[:i+k]): return len(seqA[-i-k:]) # else: print("what") # TODO: here it may happens that two sequences have bad overlap. This is due to the # fact that their N numbers was different because of read sequencing errors while phasing with kissreads # One may correct the N number of the lowest covered sequence for instance. return erro_code # print(overlap_length("TCAACTACTTATTTGTCGTACAAAACTGTCCCGTACATAGGATGATCTTATTCCCGTACCGGATTTCGTACACAATAACAGGAACAATGTCGATATAAAATTTTCTTCAAATGGCTTCAACCCTTACATTATTATGGCAGACGATGTAAACTCTCTAGTCTTCTCAACTCTATTAATAATACATAGTAGTAGCTATTCAGCCATTTTAAAAACGCAATACAACGTTTGTCCCGTAATATT","CTACTTATTTGTCGTACAAAACTGTCCCGTACATAGGATGATCTTATTCCTGTACCGGATTTCGTACACAATAACAGGAACAATGTCGATATAAAATTTTCTTCAAATGGCTTCAACCCTTACATTATTATGGCAGACGACGTAAACTCTCTAGTCTTCTCAACTCTATTAATAATACATAGTAGTAGCTATTCAGCCATTTTAAAAACGCAATACAACGTTTGTCCCGTAATAT")) def modify_gfa_file(gfa_file_name, compacted_facts_fa_file_name, header_to_file_position): print ("H\t#################") print ("H\t# GFA of variants") print ("H\t#################") print ("H\t# Nodes are (compacted) facts with their read mapping coverage. Eg. \"S 1 gtGCAATAAGAATTGTCTTTCTTATAATAATTGTCCAACTTAGgGTCAATTTCTGTACaaacaaCACCATCCAAt AS:-577h;-977l;1354l; SP:0_44;11_64;32_75; BP:0_41;-26_41;-25_41; FC:i:52 min:17 max:410 mean:180.0 AC:113;17;410\".") print ("H\t# * field AS stands for \"Allele Set\". It reminds the ids of the variants that compose this fact and that were used for reconstructing the genomic sequence") print ("H\t# * field SP stands for \"Sequence Position\". It indicates for each allele of the fact its starting and ending position in the ACGT sequence") print ("H\t# * field BP stands for \"Bubble Position\". For each allele of the fact it indicates:") print ("H\t# - first: the relative position of first nucleotide of the bubble with respect to the position of the last nucleotide of the bubble of the previous allele. This value is equal to zero for the first allele") print ("H\t# - second: the length of the bubble of the allele") print ("H\t# * field EV strands for \"Extreme Variant\". Facts having at least one variant with no input or no output edge are considered as facts having an extreme variants. Their value is set to EV:1. Else, the value is set to EV:0") print ("H\t# * field FC is the coverage of the fact, as provided by the total number of reads that phased at least two alleles of the fact") print ("H\t# - first: the relative position of first nucleotide of the bubble with respect to the position of the last nucleotide of the bubble of the previous allele. This value is equal to zero for the first allele") print ("H\t# - second: the length of the bubble of the allele") print ("H\t# * fields min, max, and mean stand resp. for the min, max and mean of the read coverage of all alleles") print ("H\t# * field AC stands for \"Allele Coverage\". The number of reads that map each allele is given in the same order as the variant ids (eg. \"17;410;113;\" are respectively, the coverages of variants \"-577h;-977l;1354l\")") print ("H\t# Four types of edges:") print ("H\t# 1. Overlap between facts, Overlap length is >0. Eg, \"L 1 - 29384 + 8M OFL:i:2\"") print ("H\t# \"S 1 ACGGACGGACCGT RC:i:24\", and") print ("H\t# \"S 29384 CGGACCGTACGGACGATCCG; RC:i:43\".") print ("H\t# OLF field reminds the length of the fact overlap length (number of variants overlapping)") print ("H\t# 2. Facts linked by paired end reads. Eg \"L 10735 + 29384 + 0M FC:i:5\".") print ("H\t# The coverage (FC field) indicates the number of pairend read linking the two facts") print ("H\t# These links have a fake overlap of length 0.") print ("H\t# 3. Facts linked by unitigs. The unitig finishing a fact overlaps the unitig starting another fact. Eg \"L 19946 + 11433 + -1M\".") print ("H\t# These links are directed and validate the facts orientation. ") print ("H\t# These links have a fake overlap of length -1.") print ("H\t# 4. Facts sharing at least one SNP identifier.") print ("H\t# These links have an overlap of length -2.") gfa_file=open(gfa_file_name) compacted_facts_fa_file=open(compacted_facts_fa_file_name) node_id_to_sequence={} file_size=kc.file_size(gfa_file) step=0 while(True): if step%10000==0: kc.update_progress(gfa_file.tell()/file_size) step+=1 gfa_line=gfa_file.readline() if not gfa_line: break gfa_line.strip() if gfa_line[0]=='H': continue #Header was changed if gfa_line[0]=='S': #Deal with sequences #FROM: #S 1 -577h;-977l;1354l; SP:0_44;11_64;32_75; BP:0_41;-26_41;-25_41; EV:0 FC:i:52 min:17 max:410 mean:180.0 AC:410;17;113; #TO #S 1 gtGCAATAAGAATTGTCTTTCTTATAATAATTGTCCAACTTAGgGTCAATTTCTGTACaaacaaCACCATCCAAt SP:0_44;11_64;32_75; BP:0_41;-26_41;-25_41; EV:0 FC:i:52 AS:-577h;-977l;1354l; min:17 max:410 mean:180.0 AC:17;410;113; gfa_line=gfa_line.split() assert gfa_line[2] in header_to_file_position, gfa_line[2]+" is not in header_to_file_position" compacted_facts_fa_file.seek(header_to_file_position[gfa_line[2]]) compacted_facts_fa_file.readline().strip() # dont care sequence_fa=compacted_facts_fa_file.readline().strip() # assert gfa_line[2] == allele_header,gfa_line[2]+" is not "+allele_header+" "+header_fa[1:] node_id_to_sequence[gfa_line[1]]=sequence_fa #TODO: optimize this to avoid memory usage. One may store the position of the node in the file and retreive the sequence latter print(gfa_line[0]+"\t"+gfa_line[1]+"\t"+sequence_fa+"\tAS:"+gfa_line[2]+"\t"+gfa_line[3]+"\t"+gfa_line[4]+"\t"+gfa_line[5]+"\t"+gfa_line[6]+"\t"+gfa_line[7]+"\t"+gfa_line[8]+"\t"+gfa_line[9]+"\t"+gfa_line[10]) continue if gfa_line[0]=='L': split_gfa_line=gfa_line.split() if split_gfa_line[1] == split_gfa_line[3]: #no not print self loops continue # print (split_gfa_line) if split_gfa_line[5]=="0M" or split_gfa_line[5]=="-1M" or split_gfa_line[5]=="-2M": # non overlapping edges, we simply write them print(gfa_line.strip()) continue # if we are here, this is a true overlapping edge: L 3 + 255 - 2M # we need to retreive the sequences of the two nodes # print(split_gfa_line) seqA = node_id_to_sequence[split_gfa_line[1]].upper() seqB = node_id_to_sequence[split_gfa_line[3]].upper() if split_gfa_line[2]=='-': seqA=kc.get_reverse_complement(seqA) if split_gfa_line[4]=='-': seqB=kc.get_reverse_complement(seqB) OL = overlap_length(seqA,seqB) if OL>-1: print (split_gfa_line[0]+"\t"+split_gfa_line[1]+"\t"+split_gfa_line[2]+"\t"+split_gfa_line[3]+"\t"+split_gfa_line[4]+"\t"+str(OL)+"M\tOFL:i:"+split_gfa_line[5][:-1]) continue print(gfa_line.strip()) # shold not happend kc.update_progress(1) gfa_file.close() compacted_facts_fa_file.close() def main(): ''' Produces a gfa file replacing the node content from int ids of alleles to their sequence ''' if len(sys.argv) !=3: sys.stderr.write("Usage: python K3000_node_ids_to_node_sequences.py graph_plus.gfa compacted_facts.fa > graph_final.gfa\n") sys.exit(0) sys.stderr.write("Indexing sequence positions\n") header_to_file_position = index_sequences_seek(sys.argv[2]) sys.stderr.write("Writing the updated gfa file\n") modify_gfa_file(sys.argv[1],sys.argv[2], header_to_file_position) if __name__ == "__main__": main()
GATB/DiscoSnp
scripts/k3000/K3000_node_ids_to_node_sequences.py
Python
agpl-3.0
10,467
""" """ def decode(ciphertext): key = ''.join([(" " * 32), "xz.~^7;>od-DF )}uS1[=cU`mGWis3MT4{N%9Zq2/Ew(&+", "vkV:l\!hKp8fCOAR6?0|nYbI_LtPB'H<Q$Xy\"aJ@g#j5],*re"]) plaintext = ''.join([key[ord(x)] for x in ciphertext]) return (ciphertext[0:4] + "... " + plaintext) print(decode('P~})sbs')) #"Verdana" print(decode('ZU~5O-11g-5~}h;Y;5sh~""')) #"check SSL certificate.." print(decode('-----iR~s<~-Js;h""""""')) #"please wait......" print(decode('UhhWQHHh}0URs}bs*8s50}s""5!H;8vHR(v(""v;Y')) #"http://truhlarna-macura..cz/img/logo..gif" print(decode('UhhWQHHv0s8sh~b""5(8HW}0~dsHR(v(""v;Y')) #"http://guamaten..com/prueba/logo..gif" print(decode('UhhWQHHW}~Y8sF0s""5(8Hf50<0);HR(v(""v;Y')) #"http://prefmaqua..com/_cusudi/logo..gif" print(decode('B(-;bh~}b~h-s55~<<""-?0}b-(YY-sbq-Y;}~JsRR-(}-sbh;*N;}0<-<(YhJs}~-sb)-h}q-svs;b""')) #"No internet access.. Turn off any firewall or anti-virus software and try again.."" print(decode('I}}(}')) #"Error" print(decode('?U~-Y;R~-;<-5(}}0Wh~)-sb)-5sbb(h-d~-(W~b~)')) #"The file is corrupted and cannot be opened" print(decode('15};Wh;bv"",;R~1q<h~8[dx~5h')) #"Scripting..FileSystemObject" print(decode('u~5U(-(YY')) #"@echo off" print(decode('W;bu-G2""2G""@@""G=-*b-2-*J-G```-\'-B6g')) #"pin@ 21.12.44.23 -n 1 -w 2000 NUL" print(decode('<hs}h-')) #"start" print(decode('[W~b')) #"Open"
martyn-smith/ursnif_decoder
acuzamu.py
Python
lgpl-3.0
1,362
#! /usr/bin/env python """ Module with post-processing related functions called from within the NFC algorithm. """ __all__ = ['cube_planet_free'] import numpy as np from ..phot import cube_inject_companions import math from matplotlib.pyplot import plot, xlim, ylim, hold, axes, gca, show def cube_planet_free(planet_parameter, cube, angs, psfn, plsc): """ Return a cube in which we have injected negative fake companion at the position/flux given by planet_parameter. Parameters ---------- planet_parameter: numpy.array or list The (r, theta, flux) for all known companions. cube: numpy.array The cube of fits images expressed as a numpy.array. angs: numpy.array The parallactic angle fits image expressed as a numpy.array. psfsn: numpy.array The scaled psf expressed as a numpy.array. plsc: float The platescale, in arcsec per pixel. Returns ------- cpf : numpy.array The cube with negative companions injected at the position given in planet_parameter. """ cpf = np.zeros_like(cube) planet_parameter = np.array(planet_parameter) for i in range(planet_parameter.shape[0]): if i == 0: cube_temp = cube else: cube_temp = cpf cpf = cube_inject_companions(cube_temp, psfn, angs, flevel=-planet_parameter[i, 2], plsc=plsc, rad_dists=[planet_parameter[i, 0]], n_branches=1, theta=planet_parameter[i, 1], verbose=False) return cpf def radial_to_eq(r=1, t=0, rError=0, tError=0, display=False): """ Convert the position given in (r,t) into \delta RA and \delta DEC, as well as the corresponding uncertainties. t = 0 deg (resp. 90 deg) points toward North (resp. East). Parameters ---------- r: float The radial coordinate. t: float The angular coordinate. rError: float The error bar related to r. tError: float The error bar related to t. display: boolean, optional If True, a figure illustrating the error ellipse is displayed. Returns ------- out : tuple ((RA, RA error), (DEC, DEC error)) """ ra = (r * np.sin(math.radians(t))) dec = (r * np.cos(math.radians(t))) u, v = (ra, dec) nu = np.mod(np.pi/2.-math.radians(t), 2*np.pi) a, b = (rError,r*np.sin(math.radians(tError))) beta = np.linspace(0,2*np.pi,5000) x, y = (u + (a * np.cos(beta) * np.cos(nu) - b * np.sin(beta) * np.sin(nu)), v + (b * np.sin(beta) * np.cos(nu) + a * np.cos(beta) * np.sin(nu))) raErrorInf = u - np.amin(x) raErrorSup = np.amax(x) - u decErrorInf = v - np.amin(y) decErrorSup = np.amax(y) - v if display: hold(True) plot(u,v,'ks',x,y,'r') plot((r+rError) * np.cos(nu), (r+rError) * np.sin(nu),'ob', (r-rError) * np.cos(nu), (r-rError) * np.sin(nu),'ob') plot(r * np.cos(nu+math.radians(tError)), r*np.sin(nu+math.radians(tError)),'ok') plot(r * np.cos(nu-math.radians(tError)), r*np.sin(nu-math.radians(tError)),'ok') plot(0,0,'og',np.cos(np.linspace(0,2*np.pi,10000)) * r, np.sin(np.linspace(0,2*np.pi,10000)) * r,'y') plot([0,r*np.cos(nu+math.radians(tError*0))], [0,r*np.sin(nu+math.radians(tError*0))],'k') axes().set_aspect('equal') lim = np.amax([a,b]) * 2. xlim([ra-lim,ra+lim]) ylim([dec-lim,dec+lim]) gca().invert_xaxis() show() return ((ra,np.mean([raErrorInf,raErrorSup])), (dec,np.mean([decErrorInf,decErrorSup]))) def cart_to_polar(y, x, ceny=0, cenx=0): """ Convert cartesian into polar coordinates (r,theta) with respect to a given center (cenx,ceny). Parameters ---------- x,y: float The cartesian coordinates. Returns ------- out : tuple The polar coordinates (r,theta) with respect to the (cenx,ceny). Note that theta is given in degrees. """ r = np.sqrt((y-ceny)**2 + (x-cenx)**2) theta = np.degrees(np.arctan2(y-ceny, x-cenx)) return (r,np.mod(theta,360)) def polar_to_cart(r, theta, ceny=0, cenx=0): """ Convert polar coordinates with respect to the center (cenx,ceny) into cartesian coordinates (x,y) with respect to the bottom left corner of the image.. Parameters ---------- r,theta: float The polar coordinates. Returns ------- out : tuple The cartesian coordinates (x,y) with respect to the bottom left corner of the image.. """ x = r*np.cos(np.deg2rad(theta)) + cenx y = r*np.sin(np.deg2rad(theta)) + ceny return (x,y) def ds9index_to_polar(y, x, ceny=0, cenx=0): """ Convert pixel index read on image displayed with DS9 into polar coordinates (r,theta) with respect to a given center (cenx,ceny). Note that ds9 index (x,y) = Python matrix index (y,x). Furthermore, when an image M is displayed with DS9, the coordinates of the center of the pixel associated with M[0,0] is (1,1). Then, there is a shift of (0.5, 0.5) of the center of the coordinate system. As a conclusion, when you read (x_ds9, y_ds9) on a image displayed with DS9, the corresponding position is (y-0.5, x-0.5) and the associated pixel value is M(np.floor(y)-1,np.floor(x)-1). Parameters ---------- x,y: float The pixel index in DS9 Returns ------- out : tuple The polar coordinates (r,theta) with respect to the (cenx,ceny). Note that theta is given in degrees. """ r = np.sqrt((y-0.5-ceny)**2 + (x-0.5-cenx)**2) theta = np.degrees(np.arctan2(y-0.5-ceny, x-0.5-cenx)) return (r,np.mod(theta,360)) def polar_to_ds9index(r, theta, ceny=0, cenx=0): """ Convert position (r,theta) in an image with respect to a given center (cenx,ceny) into position in the image displayed with DS9. Note that ds9 index (x,y) = Python matrix index (y,x). Furthermore, when an image M is displayed with DS9, the coordinates of the center of the pixel associated with M[0,0] is (1,1). Then, there is a shift of (0.5, 0.5) of the center of the coordinate system. As a conclusion, when you read (x_ds9, y_ds9) on a image displayed with DS9, the corresponding position is (y-0.5, x-0.5) and the associated pixel value is M(np.floor(y)-1,np.floor(x)-1). Parameters ---------- x,y: float The pixel index in DS9 Returns ------- out : tuple The polar coordinates (r,theta) with respect to the (cenx,ceny). Note that theta is given in degrees. """ x_ds9 = r*np.cos(np.deg2rad(theta)) + 0.5 + cenx y_ds9 = r*np.sin(np.deg2rad(theta)) + 0.5 + ceny return (x_ds9,y_ds9)
henry-ngo/VIP
vip_hci/negfc/utils_negfc.py
Python
mit
7,251
""" @file @brief Subpart related to the documentation generation. """ from .conf_path_tools import find_graphviz_dot from .default_conf import set_sphinx_variables, custom_setup from .helpgen_exceptions import HelpGenException, ImportErrorHelpGen, HelpGenConvertError from .help_usage import get_help_usage from .pandoc_helper import latex2rst from .process_notebook_api import nb2slides, nb2html, nb2rst from .rst_converters import rst2html, docstring2html, rst2rst_folder from .sphinx_helper import sphinx_add_scripts # Disable to speed up import time. # from .sphinx_main import generate_help_sphinx, process_notebooks from .utils_sphinx_config import NbImage from .utils_pywin32 import import_pywin32
sdpython/pyquickhelper
src/pyquickhelper/helpgen/__init__.py
Python
mit
705
""" WSGI config for myproject project. It exposes the WSGI callable as a module-level variable named ``application``. For more information on this file, see https://docs.djangoproject.com/en/1.8/howto/deployment/wsgi/ """ import os os.environ.setdefault("DJANGO_SETTINGS_MODULE", "myproject.settings") from django.core.wsgi import get_wsgi_application # flake8: noqa application = get_wsgi_application()
Perkville/django-tastypie
docs/code/myproject/wsgi.py
Python
bsd-3-clause
409
# -*- coding: UTF-8 -*- from scheduler import Scheduler from state import StateMachine import datetime import logging import timer import asyncio class Engine: """Core of the application""" def __init__(self, channels): """ :param channels: a list of Channel object """ self._channels = channels self._statemachine = {} self.__savestartdate = {} self.__saveenddate = {} self._currentstate = {} self._timer = {} for ch in self._channels: self._statemachine[ch.nb] = StateMachine() self._statemachine[ch.nb].register("NotRunning", self._not_running, [ch]) self._statemachine[ch.nb].register("Running", self._running, [ch]) self._statemachine[ch.nb].register("ManualOn", self._manual_on, [ch]) self._statemachine[ch.nb].register("ManualOff", self._manual_off, [ch]) self._statemachine[ch.nb].setState("NotRunning") self._currentstate[ch.nb] = {'nb': ch.nb, 'state': "NotRunning"} self._timer[ch.nb] = timer.Timer() self._oldstate = self._currentstate.copy() self._sched = Scheduler(self.run) self._logger = logging.getLogger('sprinkler') self._event_new_state = asyncio.Event() def get_event_new_state(self): return self._event_new_state @staticmethod def get_datetime_now(): return datetime.datetime.now() def run(self): self._logger.debug("Running engine...") for ch in self._channels: self._statemachine[ch.nb].run() def _manual_on(self, channel): """ Force running """ channel.running = True if channel.manual == "OFF": self._logger.info(f"Channel {channel.name} ({channel.nb}) forced OFF") self._statemachine[channel.nb].setState("ManualOff") self._save_channel_state(channel.nb, "ManualOff") self._statemachine[channel.nb].run() elif channel.manual == "AUTO": self._logger.info(f"Channel {channel.name} ({channel.nb}) set in program mode") self._statemachine[channel.nb].setState("NotRunning") self._save_channel_state(channel.nb, "NotRunning") self._statemachine[channel.nb].run() def _manual_off(self, channel): """ Force stop """ channel.running = False if channel.manual == "ON": self._logger.info(f"Channel '{channel.name}' ({channel.nb}) forced ON") self._statemachine[channel.nb].setState("ManualOn") self._statemachine[channel.nb].run() elif channel.manual == "AUTO": self._logger.info(f"Channel '{channel.name}' ({channel.nb}) set in program mode") self._statemachine[channel.nb].setState("NotRunning") self._save_channel_state(channel.nb, "NotRunning") self._statemachine[channel.nb].run() def _running(self, channel): """ When channel is running """ if channel.manual == "OFF": self._logger.info(f"Channel '{channel.name}' ({channel.nb}) forced OFF") self._statemachine[channel.nb].setState("ManualOff") self._save_channel_state(channel.nb, "ManualOff") self._statemachine[channel.nb].run() elif channel.manual == "ON": self._logger.info(f"Channel '{channel.name}' ({channel.nb}) forced ON") self._statemachine[channel.nb].setState("ManualOn") self._statemachine[channel.nb].run() else: channel_status = [] if channel.isenable: for prog in channel.progs: if prog.isactive: day = self.get_datetime_now().weekday() if prog.get_one_day(day): # Programme is active for today now = self.get_datetime_now() self._logger.debug(f"{channel.name}: Start date: {self.__savestartdate[channel.nb].isoformat()}") self._logger.debug(f"{channel.name} End date: {self.__saveenddate[channel.nb].isoformat()}") self._logger.debug(f"Now: {now.isoformat()}") channel_status.append( self.__savestartdate[channel.nb] <= now < self.__saveenddate[channel.nb]) if True in channel_status: channel.running = True self._save_channel_state(channel.nb, "Running") else: self._logger.info(f"Channel '{channel.name}' ({channel.nb}) is now OFF") self._statemachine[channel.nb].setState("NotRunning") self._save_channel_state(channel.nb, "NotRunning") self._statemachine[channel.nb].run() channel.running = False def _not_running(self, channel): """ When channel is not running """ if channel.manual == "OFF": self._logger.info(f"Channel {channel.name} ({channel.nb}) forced OFF") self._statemachine[channel.nb].setState("ManualOff") self._save_channel_state(channel.nb, "ManualOff") self._statemachine[channel.nb].run() elif channel.manual == "ON": self._logger.info(f"Channel {channel.name} ({channel.nb}) forced ON") self._statemachine[channel.nb].setState("ManualOn") self._statemachine[channel.nb].run() else: channel_status = [] if channel.isenable: for prog in channel.progs: if prog.isactive: day = self.get_datetime_now().weekday() if prog.get_one_day(day): # Programme is active for today now = self.get_datetime_now() start = prog.stime.startDate(now) end = prog.stime.endDate(now) self._logger.debug(f"{channel.name} Start date: {start.isoformat()}") self._logger.debug(f"{channel.name} End date: {end.isoformat()}") self._logger.debug(f"Now: {now.isoformat()}") channel_status.append(start <= now < end) if True in channel_status: self._logger.info(f"Channel '{channel.name}' ({channel.nb}) is now ON ") self._statemachine[channel.nb].setState("Running") self._save_channel_state(channel.nb, "Running") # save start and end date to prevent false detection around # midnight self.__savestartdate[channel.nb] = start self.__saveenddate[channel.nb] = end channel.running = True self._statemachine[channel.nb].run() else: channel.running = False self._save_channel_state(channel.nb, "NotRunning") def _save_channel_state(self, channel_nb, state, duration=0): # replace current value if state == "ManualOn": self._currentstate[channel_nb] = {'nb': channel_nb, 'state': state, 'duration': duration} else: self._currentstate[channel_nb] = {'nb': channel_nb, 'state': state} # Notify if there is some change if self._currentstate[channel_nb] != self._oldstate[channel_nb]: self._event_new_state.set() self._oldstate[channel_nb] = self._currentstate[channel_nb] def channel_forced(self, nb, action, duration=0): """ Set channel action :param nb: channel number :param action: channel action. "ON", "OFF", "AUTO" :param duration: when action is ON, the duration in minutes of the sprinkler""" for ch in self._channels: if nb == ch.nb: if action in ("OFF", "AUTO"): self._logger.info(f"Channel {ch.name} ({ch.nb}) forced to {action}") if action == "OFF": self._save_channel_state(nb, "ManualOff") else: self._save_channel_state(nb, "NotRunning") self._timer[ch.nb].cancel() ch.manual = action elif action == "ON" and duration != 0: self._logger.info(f"Channel {ch.name} ({ch.nb}) forced to ON for {duration} minutes") self._save_channel_state(nb, "ManualOn", duration) # Remove all already forced sprinkler self._timer[ch.nb].cancel() self._timer[ch.nb] = timer.Timer(duration*60, self._stop_ch_after_delay, args=(ch.nb,)) ch.manual = "ON" self.run() async def _stop_ch_after_delay(self, nb): """ Callback called to switch channel ch to AUTO after a delay """ self._logger.info(f"Channel n°{nb}: end of forced ON") for ch in self._channels: if nb == ch.nb: ch.manual = "AUTO" self.run() def get_channel_state(self): return [x for x in self._currentstate.values()] def stop(self): for nb in self._timer: self._timer[nb].cancel() self._sched.cancel()
pade/sprinkler
src/engine.py
Python
gpl-3.0
9,380
from sqlalchemy import ( Column, Float, Index, Integer, Unicode, UnicodeText ) from sqlalchemy.ext.declarative import declarative_base from sqlalchemy.orm import ( scoped_session, sessionmaker ) from zope.sqlalchemy import ZopeTransactionExtension import time DBSession = scoped_session(sessionmaker(extension=ZopeTransactionExtension())) Base = declarative_base() ### TODO: group should be called group_id. id should be a foreign key. class Users(Base): __tablename__ = 'users' id = Column(Integer, primary_key=True) name = Column(Unicode(100)) group = Column(Integer) password = Column(UnicodeText) def __init__(self, name, group, password): self.name = name self.group = group self.password = password ### TODO: authorid is a foreign key. categoryid is a foreign key. class Posts(Base): __tablename__ = 'posts' id = Column(Integer, primary_key=True) date = Column(Float) title = Column(UnicodeText) authorid = Column(Integer) categoryid = Column(Integer) post = Column(UnicodeText) def __init__(self, title, authorid, categoryid, post): self.title = title self.date = time.time() self.authorid = authorid self.categoryid = categoryid self.post = post ### TODO: id is a foreign key. class Categories(Base): __tablename__ = 'categories' id = Column(Integer, primary_key=True) name = Column(UnicodeText) def __init__(self, name): self.name = name
zmarvel/coffeespot
coffeespot/models/tables.py
Python
gpl-2.0
1,545
import celery def test_run(django_scheduler, django_schedule): django_scheduler.set_task() assert(isinstance(django_scheduler.celery_task, celery.Task)) def test_add_schedule(django_scheduler, django_schedule): assert(not django_scheduler.jobs) django_scheduler.add(django_schedule) assert(django_scheduler.jobs) def test_remove_schedule(django_scheduler, django_schedule): django_scheduler.add(django_schedule) assert(django_scheduler.jobs) django_scheduler.remove(django_schedule) assert(not django_scheduler.jobs)
kuc2477/news
tests/test_scheduler.py
Python
mit
559
# coding=utf-8 # Author: Nic Wolfe <[email protected]> # # URL: https://sickrage.github.io # # This file is part of SickRage. # # SickRage is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # SickRage is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with SickRage. If not, see <http://www.gnu.org/licenses/>. from __future__ import print_function, unicode_literals import datetime import sys from six.moves import urllib import sickbeard from sickbeard.common import Quality, USER_AGENT from sickrage.helper.common import dateTimeFormat class SickBeardURLopener(urllib.request.FancyURLopener, object): version = USER_AGENT class SearchResult(object): # pylint: disable=too-few-public-methods, too-many-instance-attributes """ Represents a search result from an indexer. """ def __init__(self, episodes): self.provider = None # release show object self.show = None # URL to the NZB/torrent file self.url = '' # used by some providers to store extra info associated with the result self.extraInfo = [] # list of TVEpisode objects that this result is associated with self.episodes = episodes # quality of the release self.quality = Quality.UNKNOWN # release name self.name = '' # size of the release (-1 = n/a) self.size = -1 # release group self.release_group = '' # version self.version = -1 # hash self.hash = None # content self.content = None self.resultType = '' def __str__(self): if self.provider is None: return 'Invalid provider, unable to print self' my_string = '{0} @ {1}\n'.format(self.provider.name, self.url) my_string += 'Extra Info:\n' for extra in self.extraInfo: my_string += ' {0}\n'.format(extra) my_string += 'Episodes:\n' for ep in self.episodes: my_string += ' {0}\n'.format(ep) my_string += 'Quality: {0}\n'.format(Quality.qualityStrings[self.quality]) my_string += 'Name: {0}\n'.format(self.name) my_string += 'Size: {0}\n'.format(self.size) my_string += 'Release Group: {0}\n'.format(self.release_group) return my_string def fileName(self): return '{0}.{1}'.format(self.episodes[0].prettyName(), self.resultType) class NZBSearchResult(SearchResult): # pylint: disable=too-few-public-methods """ Regular NZB result with an URL to the NZB """ def __init__(self, episodes): super(NZBSearchResult, self).__init__(episodes) self.resultType = 'nzb' class NZBDataSearchResult(SearchResult): # pylint: disable=too-few-public-methods """ NZB result where the actual NZB XML data is stored in the extraInfo """ def __init__(self, episodes): super(NZBDataSearchResult, self).__init__(episodes) self.resultType = 'nzbdata' class TorrentSearchResult(SearchResult): # pylint: disable=too-few-public-methods """ Torrent result with an URL to the torrent """ def __init__(self, episodes): super(TorrentSearchResult, self).__init__(episodes) self.resultType = 'torrent' class AllShowsListUI(object): # pylint: disable=too-few-public-methods """ This class is for indexer api. Instead of prompting with a UI to pick the desired result out of a list of shows it tries to be smart about it based on what shows are in SickRage. """ def __init__(self, config, log=None): self.config = config self.log = log def selectSeries(self, all_results): search_results = [] # get all available shows if all_results and 'searchterm' in self.config: show_id_list = {int(x.indexerid) for x in sickbeard.showList if x} for curShow in all_results: if curShow in search_results: continue if 'seriesname' not in curShow: continue try: # We need to know if it's in our show list already curShow['in_show_list'] = int(curShow.get('id')) in show_id_list except Exception: # If it doesnt have an id, we cant use it anyways. continue if 'firstaired' not in curShow: curShow['firstaired'] = 'Unknown' if curShow not in search_results: search_results += [curShow] return search_results class ShowListUI(object): # pylint: disable=too-few-public-methods """ This class is for tvdb-api. Instead of prompting with a UI to pick the desired result out of a list of shows it tries to be smart about it based on what shows are in SickRage. """ def __init__(self, config, log=None): self.config = config self.log = log @staticmethod def selectSeries(all_results): # try to pick a show that's in my show list show_id_list = {int(x.indexerid) for x in sickbeard.showList if x} for curShow in all_results: try: if int(curShow.get('id')) in show_id_list: return curShow except Exception: pass # if nothing matches then return first result return all_results[0] class Proper(object): # pylint: disable=too-few-public-methods, too-many-instance-attributes def __init__(self, name, url, date, show): self.name = name self.url = url self.date = date self.provider = None self.quality = Quality.UNKNOWN self.release_group = None self.version = -1 self.show = show self.indexer = None self.indexerid = -1 self.season = -1 self.episode = -1 self.scene_season = -1 self.scene_episode = -1 def __str__(self): return '{date} {name} {season}x{episode} of {series_id} from {indexer}'.format( date=self.date, name=self.name, season=self.season, episode=self.episode, series_id=self.indexerid, indexer=sickbeard.indexerApi(self.indexer).name) class ErrorViewer(object): """ Keeps a static list of UIErrors to be displayed on the UI and allows the list to be cleared. """ errors = [] def __init__(self): ErrorViewer.errors = [] @staticmethod def add(error): ErrorViewer.errors = [e for e in ErrorViewer.errors if e.message != error.message] ErrorViewer.errors.append(error) @staticmethod def clear(): ErrorViewer.errors = [] @staticmethod def get(): return ErrorViewer.errors class WarningViewer(object): """ Keeps a static list of (warning) UIErrors to be displayed on the UI and allows the list to be cleared. """ errors = [] def __init__(self): WarningViewer.errors = [] @staticmethod def add(error): WarningViewer.errors = [e for e in WarningViewer.errors if e.message != error.message] WarningViewer.errors.append(error) @staticmethod def clear(): WarningViewer.errors = [] @staticmethod def get(): return WarningViewer.errors class UIError(object): # pylint: disable=too-few-public-methods """ Represents an error to be displayed in the web UI. """ def __init__(self, message): self.title = sys.exc_info()[-2] or message self.message = message self.time = datetime.datetime.now().strftime(dateTimeFormat)
b0ttl3z/SickRage
sickbeard/classes.py
Python
gpl-3.0
8,105
import sys import os import pickle import re import getpass from mechanicalsoup import Browser from .config import CONFIG_DIR_NAME def login(username=None, password=None): if username is None: username = input('Please provide username: ') if password is None: password = getpass.getpass('Please provide password: ') config_dir_path = os.path.join( os.path.expanduser('~'), CONFIG_DIR_NAME ) pickle_path = os.path.join( config_dir_path, 'browser.pickle' ) if os.path.isfile(pickle_path): try: with open(pickle_path, 'rb') as file: data = pickle.load(file) if data['username'] == username and \ data['password'] == password: return data['browser'] except: pass browser = Browser() login_url = 'https://www.kaggle.com/account/login' login_page = browser.get(login_url) token = re.search( 'antiForgeryToken: \'(?P<token>.+)\'', str(login_page.soup) ).group(1) login_result_page = browser.post( login_url, data={ 'username': username, 'password': password, '__RequestVerificationToken': token } ) error_match = re.search( '"errors":\["(?P<error>.+)"\]', str(login_result_page.soup) ) if error_match: print(error_match.group(1)) return if not os.path.isdir(config_dir_path): os.mkdir(config_dir_path, 0o700) with open(pickle_path, 'wb') as f: pickle.dump(dict( username=username, password=password, browser=browser ), f) return browser
floydwch/kaggle-cli
kaggle_cli/common.py
Python
mit
1,733
#!/usr/bin/env python import os import sys if __name__ == "__main__": os.environ.setdefault("DJANGO_SETTINGS_MODULE", "PracticaP5.settings") from django.core.management import execute_from_command_line execute_from_command_line(sys.argv)
PaulDiaconescu/pentagram
PracticaP5/manage.py
Python
gpl-3.0
263
# coding: utf-8 """ Utilities for dealing with text encodings """ #----------------------------------------------------------------------------- # Copyright (C) 2008-2012 The IPython Development Team # # Distributed under the terms of the BSD License. The full license is in # the file COPYING, distributed as part of this software. #----------------------------------------------------------------------------- #----------------------------------------------------------------------------- # Imports #----------------------------------------------------------------------------- import sys import locale import warnings # to deal with the possibility of sys.std* not being a stream at all def get_stream_enc(stream, default=None): """Return the given stream's encoding or a default. There are cases where ``sys.std*`` might not actually be a stream, so check for the encoding attribute prior to returning it, and return a default if it doesn't exist or evaluates as False. ``default`` is None if not provided. """ if not hasattr(stream, 'encoding') or not stream.encoding: return default else: return stream.encoding # Less conservative replacement for sys.getdefaultencoding, that will try # to match the environment. # Defined here as central function, so if we find better choices, we # won't need to make changes all over IPython. def getdefaultencoding(prefer_stream=True): """Return IPython's guess for the default encoding for bytes as text. If prefer_stream is True (default), asks for stdin.encoding first, to match the calling Terminal, but that is often None for subprocesses. Then fall back on locale.getpreferredencoding(), which should be a sensible platform default (that respects LANG environment), and finally to sys.getdefaultencoding() which is the most conservative option, and usually ASCII on Python 2 or UTF8 on Python 3. """ enc = None if prefer_stream: enc = get_stream_enc(sys.stdin) if not enc or enc == 'ascii': try: # There are reports of getpreferredencoding raising errors # in some cases, which may well be fixed, but let's be conservative # here. enc = locale.getpreferredencoding() except Exception: pass enc = enc or sys.getdefaultencoding() # On windows `cp0` can be returned to indicate that there is no code page. # Since cp0 is an invalid encoding return instead cp1252 which is the # Western European default. if enc == 'cp0': warnings.warn( "Invalid code page cp0 detected - using cp1252 instead." "If cp1252 is incorrect please ensure a valid code page " "is defined for the process.", RuntimeWarning) return 'cp1252' return enc DEFAULT_ENCODING = getdefaultencoding()
mattvonrocketstein/smash
smashlib/ipy3x/utils/encoding.py
Python
mit
2,881
# Tweepy # Copyright 2009-2022 Joshua Roesslein # See LICENSE for details. """ Tweepy Twitter API library """ __version__ = '4.6.0' __author__ = 'Joshua Roesslein' __license__ = 'MIT' from tweepy.api import API from tweepy.auth import ( AppAuthHandler, OAuthHandler, OAuth1UserHandler, OAuth2AppHandler, OAuth2BearerHandler, OAuth2UserHandler ) from tweepy.cache import Cache, FileCache, MemoryCache from tweepy.client import Client, Response from tweepy.cursor import Cursor from tweepy.errors import ( BadRequest, Forbidden, HTTPException, NotFound, TooManyRequests, TweepyException, TwitterServerError, Unauthorized ) from tweepy.list import List from tweepy.media import Media from tweepy.pagination import Paginator from tweepy.place import Place from tweepy.poll import Poll from tweepy.space import Space from tweepy.streaming import ( Stream, StreamingClient, StreamResponse, StreamRule ) from tweepy.tweet import ReferencedTweet, Tweet from tweepy.user import User # Global, unauthenticated instance of API api = API()
tweepy/tweepy
tweepy/__init__.py
Python
mit
1,051
import json import random random_samples = { "documents": [] } for i in range(200): new_sample = { "id": "twitter_handle_ayy"+str(i), "user": "twitter_handle_ayy"+str(i), "type": "activity", "vote": random.choice(["true", "false"]), "lat": str(random.uniform(56.0, 58.0)), "lng": str(random.uniform(21.0, 28.0)), "photo_link": "This is my photo!" } random_samples["documents"].append(new_sample) print json.dumps(random_samples)
charleslai/geotap-node
make_samples.py
Python
mit
449
## This file is part of Invenio. ## Copyright (C) 2004, 2005, 2006, 2007, 2008, 2009, 2010, 2011, 2012 CERN. ## ## Invenio is free software; you can redistribute it and/or ## modify it under the terms of the GNU General Public License as ## published by the Free Software Foundation; either version 2 of the ## License, or (at your option) any later version. ## ## Invenio is distributed in the hope that it will be useful, but ## WITHOUT ANY WARRANTY; without even the implied warranty of ## MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU ## General Public License for more details. ## ## Youshould have received a copy of the GNU General Public License ## along with Invenio; if not, write to the Free Software Foundation, Inc., ## 59 Temple Place, Suite 330, Boston, MA 02111-1307, USA. """Invenio BibRank Administrator Interface.""" __revision__ = "$Id$" import os import ConfigParser from invenio.config import \ CFG_SITE_LANG, \ CFG_ETCDIR, \ CFG_SITE_URL import invenio.access_control_engine as acce from invenio.messages import language_list_long from invenio.dbquery import run_sql def getnavtrail(previous = ''): navtrail = """<a class="navtrail" href="%s/help/admin">Admin Area</a> """ % (CFG_SITE_URL,) navtrail = navtrail + previous return navtrail def check_user(req, role, adminarea=2, authorized=0): (auth_code, auth_message) = is_adminuser(req, role) if not authorized and auth_code != 0: return ("false", auth_message) return ("", auth_message) def is_adminuser(req, role): """check if user is a registered administrator. """ return acce.acc_authorize_action(req, role) def perform_index(ln=CFG_SITE_LANG): """create the bibrank main area menu page.""" header = ['Code', 'Translations', 'Collections', 'Rank method'] rnk_list = get_def_name('', "rnkMETHOD") actions = [] for (rnkID, name) in rnk_list: actions.append([name]) for col in [(('Modify', 'modifytranslations'),), (('Modify', 'modifycollection'),), (('Show Details', 'showrankdetails'), ('Modify', 'modifyrank'), ('Delete', 'deleterank'))]: actions[-1].append('<a href="%s/admin/bibrank/bibrankadmin.py/%s?rnkID=%s&amp;ln=%s">%s</a>' % (CFG_SITE_URL, col[0][1], rnkID, ln, col[0][0])) for (str, function) in col[1:]: actions[-1][-1] += ' / <a href="%s/admin/bibrank/bibrankadmin.py/%s?rnkID=%s&amp;ln=%s">%s</a>' % (CFG_SITE_URL, function, rnkID, ln, str) output = """ <a href="%s/admin/bibrank/bibrankadmin.py/addrankarea?ln=%s">Add new rank method</a><br /><br /> """ % (CFG_SITE_URL, ln) output += tupletotable(header=header, tuple=actions) return addadminbox("""Overview of rank methods&nbsp;&nbsp;&nbsp;<small>[<a title="See guide" href="%s/help/admin/bibrank-admin-guide#mi">?</a>]</small>""" % CFG_SITE_URL, datalist=[output, '']) def perform_modifycollection(rnkID='', ln=CFG_SITE_LANG, func='', colID='', confirm=0): """Modify which collections the rank method is visible to""" output = "" subtitle = "" if rnkID: rnkNAME = get_def_name(rnkID, "rnkMETHOD")[0][1] if func in ["0", 0] and confirm in ["1", 1]: finresult = attach_col_rnk(rnkID, colID) elif func in ["1", 1] and confirm in ["1", 1]: finresult = detach_col_rnk(rnkID, colID) if colID: colNAME = get_def_name(colID, "collection")[0][1] subtitle = """Step 1 - Select collection to enable/disable rank method '%s' for""" % rnkNAME output = """ <dl> <dt>The rank method is currently enabled for these collections:</dt> <dd> """ col_list = get_rnk_col(rnkID, ln) if not col_list: output += """No collections""" else: for (id, name) in col_list: output += """%s, """ % name output += """</dd> </dl> """ col_list = get_def_name('', "collection") col_rnk = dict(get_rnk_col(rnkID)) col_list = filter(lambda x: not col_rnk.has_key(x[0]), col_list) if col_list: text = """ <span class="adminlabel">Enable for:</span> <select name="colID" class="admin_w200"> <option value="">- select collection -</option> """ for (id, name) in col_list: text += """<option value="%s" %s>%s</option>""" % (id, (func in ["0", 0] and confirm in ["0", 0] and colID and int(colID) == int(id)) and 'selected="selected"' or '' , name) text += """</select>""" output += createhiddenform(action="modifycollection", text=text, button="Enable", rnkID=rnkID, ln=ln, func=0, confirm=1) if confirm in ["0", 0] and func in ["0", 0] and colID: subtitle = "Step 2 - Confirm to enable rank method for the chosen collection" text = "<b><p>Please confirm to enable rank method '%s' for the collection '%s'</p></b>" % (rnkNAME, colNAME) output += createhiddenform(action="modifycollection", text=text, button="Confirm", rnkID=rnkID, ln=ln, colID=colID, func=0, confirm=1) elif confirm in ["1", 1] and func in ["0", 0] and colID: subtitle = "Step 3 - Result" output += write_outcome(finresult) elif confirm not in ["0", 0] and func in ["0", 0]: output += """<b><span class="info">Please select a collection.</span></b>""" col_list = get_rnk_col(rnkID, ln) if col_list: text = """ <span class="adminlabel">Disable for:</span> <select name="colID" class="admin_w200"> <option value="">- select collection -</option> """ for (id, name) in col_list: text += """<option value="%s" %s>%s</option>""" % (id, (func in ["1", 1] and confirm in ["0", 0] and colID and int(colID) == int(id)) and 'selected="selected"' or '' , name) text += """</select>""" output += createhiddenform(action="modifycollection", text=text, button="Disable", rnkID=rnkID, ln=ln, func=1, confirm=1) if confirm in ["1", 1] and func in ["1", 1] and colID: subtitle = "Step 3 - Result" output += write_outcome(finresult) elif confirm not in ["0", 0] and func in ["1", 1]: output += """<b><span class="info">Please select a collection.</span></b>""" body = [output] return addadminbox(subtitle + """&nbsp;&nbsp;&nbsp;<small>[<a title="See guide" href="%s/help/admin/bibrank-admin-guide#mc">?</a>]</small>""" % CFG_SITE_URL, body) def perform_modifytranslations(rnkID, ln, sel_type, trans, confirm, callback='yes'): """Modify the translations of a rank method""" output = '' subtitle = '' langs = get_languages() langs.sort() if confirm in ["2", 2] and rnkID: finresult = modify_translations(rnkID, langs, sel_type, trans, "rnkMETHOD") rnk_name = get_def_name(rnkID, "rnkMETHOD")[0][1] rnk_dict = dict(get_i8n_name('', ln, get_rnk_nametypes()[0][0], "rnkMETHOD")) if rnkID and rnk_dict.has_key(int(rnkID)): rnkID = int(rnkID) subtitle = """<a name="3">3. Modify translations for rank method '%s'</a>""" % rnk_name if type(trans) is str: trans = [trans] if sel_type == '': sel_type = get_rnk_nametypes()[0][0] header = ['Language', 'Translation'] actions = [] text = """ <span class="adminlabel">Name type</span> <select name="sel_type" class="admin_w200"> """ types = get_rnk_nametypes() if len(types) > 1: for (key, value) in types: text += """<option value="%s" %s>%s""" % (key, key == sel_type and 'selected="selected"' or '', value) trans_names = get_name(rnkID, ln, key, "rnkMETHOD") if trans_names and trans_names[0][0]: text += ": %s" % trans_names[0][0] text += "</option>" text += """</select>""" output += createhiddenform(action="modifytranslations", text=text, button="Select", rnkID=rnkID, ln=ln, confirm=0) if confirm in [-1, "-1", 0, "0"]: trans = [] for key, value in langs: try: trans_names = get_name(rnkID, key, sel_type, "rnkMETHOD") trans.append(trans_names[0][0]) except StandardError, e: trans.append('') for nr in range(0,len(langs)): actions.append(["%s" % (langs[nr][1],)]) actions[-1].append('<input type="text" name="trans" size="30" value="%s"/>' % trans[nr]) text = tupletotable(header=header, tuple=actions) output += createhiddenform(action="modifytranslations", text=text, button="Modify", rnkID=rnkID, sel_type=sel_type, ln=ln, confirm=2) if sel_type and len(trans) and confirm in ["2", 2]: output += write_outcome(finresult) body = [output] return addadminbox(subtitle + """&nbsp;&nbsp;&nbsp;<small>[<a title="See guide" href="%s/help/admin/bibrank-admin-guide#mt">?</a>]</small>""" % CFG_SITE_URL, body) def perform_addrankarea(rnkcode='', ln=CFG_SITE_LANG, template='', confirm=-1): """form to add a new rank method with these values:""" subtitle = 'Step 1 - Create new rank method' output = """ <dl> <dt>BibRank code:</dt> <dd>A unique code that identifies a rank method, is used when running the bibrank daemon and used to name the configuration file for the method. <br />The template files includes the necessary parameters for the chosen rank method, and only needs to be edited with the correct tags and paths. <br />For more information, please go to the <a title="See guide" href="%s/help/admin/bibrank-admin-guide">BibRank guide</a> and read the section about adding a rank method</dd> </dl> """ % CFG_SITE_URL text = """ <span class="adminlabel">BibRank code</span> <input class="admin_wvar" type="text" name="rnkcode" value="%s" /> """ % (rnkcode) text += """<br /> <span class="adminlabel">Cfg template</span> <select name="template" class="admin_w200"> <option value="">No template</option> """ templates = get_templates() for templ in templates: text += """<option value="%s" %s>%s</option>""" % (templ, template == templ and 'selected="selected"' or '', templ[9:len(templ)-4]) text += """</select>""" output += createhiddenform(action="addrankarea", text=text, button="Add rank method", ln=ln, confirm=1) if rnkcode: if confirm in ["0", 0]: subtitle = 'Step 2 - Confirm addition of rank method' text = """<b>Add rank method with BibRank code: '%s'.</b>""" % (rnkcode) if template: text += """<br /><b>Using configuration template: '%s'.</b>""" % (template) else: text += """<br /><b>Create empty configuration file.</b>""" output += createhiddenform(action="addrankarea", text=text, rnkcode=rnkcode, button="Confirm", template=template, confirm=1) elif confirm in ["1", 1]: rnkID = add_rnk(rnkcode) subtitle = "Step 3 - Result" if rnkID[0] == 1: rnkID = rnkID[1] text = """<b><span class="info">Added new rank method with BibRank code '%s'</span></b>""" % rnkcode try: if template: infile = open("%s/bibrank/%s" % (CFG_ETCDIR, template), 'r') indata = infile.readlines() infile.close() else: indata = () file = open("%s/bibrank/%s.cfg" % (CFG_ETCDIR, get_rnk_code(rnkID)[0][0]), 'w') for line in indata: file.write(line) file.close() if template: text += """<b><span class="info"><br />Configuration file created using '%s' as template.</span></b>""" % template else: text += """<b><span class="info"><br />Empty configuration file created.</span></b>""" except StandardError, e: text += """<b><span class="info"><br />Sorry, could not create configuration file: '%s/bibrank/%s.cfg', either because it already exists, or not enough rights to create file. <br />Please create the file in the path given.</span></b>""" % (CFG_ETCDIR, get_rnk_code(rnkID)[0][0]) else: text = """<b><span class="info">Sorry, could not add rank method, rank method with the same BibRank code probably exists.</span></b>""" output += text elif not rnkcode and confirm not in [-1, "-1"]: output += """<b><span class="info">Sorry, could not add rank method, not enough data submitted.</span></b>""" body = [output] return addadminbox(subtitle + """&nbsp;&nbsp;&nbsp;<small>[<a title="See guide" href="%s/help/admin/bibrank-admin-guide#ar">?</a>]</small>""" % CFG_SITE_URL, body) def perform_modifyrank(rnkID, rnkcode='', ln=CFG_SITE_LANG, template='', cfgfile='', confirm=0): """form to modify a rank method rnkID - id of the rank method """ if not rnkID: return "No ranking method selected." if not get_rnk_code(rnkID): return "Ranking method %s does not seem to exist." % str(rnkID) subtitle = 'Step 1 - Please modify the wanted values below' if not rnkcode: oldcode = get_rnk_code(rnkID)[0] else: oldcode = rnkcode output = """ <dl> <dd>When changing the BibRank code of a rank method, you must also change any scheduled tasks using the old value. <br />For more information, please go to the <a title="See guide" href="%s/help/admin/bibrank-admin-guide">BibRank guide</a> and read the section about modifying a rank method's BibRank code.</dd> </dl> """ % CFG_SITE_URL text = """ <span class="adminlabel">BibRank code</span> <input class="admin_wvar" type="text" name="rnkcode" value="%s" /> <br /> """ % (oldcode) try: text += """<span class="adminlabel">Cfg file</span>""" textarea = "" if cfgfile: textarea +=cfgfile else: file = open("%s/bibrank/%s.cfg" % (CFG_ETCDIR, get_rnk_code(rnkID)[0][0])) for line in file.readlines(): textarea += line text += """<textarea class="admin_wvar" name="cfgfile" rows="15" cols="70">""" + textarea + """</textarea>""" except StandardError, e: text += """<b><span class="info">Cannot load file, either it does not exist, or not enough rights to read it: '%s/bibrank/%s.cfg'<br />Please create the file in the path given.</span></b>""" % (CFG_ETCDIR, get_rnk_code(rnkID)[0][0]) output += createhiddenform(action="modifyrank", text=text, rnkID=rnkID, button="Modify", confirm=1) if rnkcode and confirm in ["1", 1] and get_rnk_code(rnkID)[0][0] != rnkcode: oldcode = get_rnk_code(rnkID)[0][0] result = modify_rnk(rnkID, rnkcode) subtitle = "Step 3 - Result" if result: text = """<b><span class="info">Rank method modified.</span></b>""" try: file = open("%s/bibrank/%s.cfg" % (CFG_ETCDIR, oldcode), 'r') file2 = open("%s/bibrank/%s.cfg" % (CFG_ETCDIR, rnkcode), 'w') lines = file.readlines() for line in lines: file2.write(line) file.close() file2.close() os.remove("%s/bibrank/%s.cfg" % (CFG_ETCDIR, oldcode)) except StandardError, e: text = """<b><span class="info">Sorry, could not change name of cfg file, must be done manually: '%s/bibrank/%s.cfg'</span></b>""" % (CFG_ETCDIR, oldcode) else: text = """<b><span class="info">Sorry, could not modify rank method.</span></b>""" output += text if cfgfile and confirm in ["1", 1]: try: file = open("%s/bibrank/%s.cfg" % (CFG_ETCDIR, get_rnk_code(rnkID)[0][0]), 'w') file.write(cfgfile) file.close() text = """<b><span class="info"><br />Configuration file modified: '%s/bibrank/%s.cfg'</span></b>""" % (CFG_ETCDIR, get_rnk_code(rnkID)[0][0]) except StandardError, e: text = """<b><span class="info"><br />Sorry, could not modify configuration file, please check for rights to do so: '%s/bibrank/%s.cfg'<br />Please modify the file manually.</span></b>""" % (CFG_ETCDIR, get_rnk_code(rnkID)[0][0]) output += text finoutput = addadminbox(subtitle + """&nbsp;&nbsp;&nbsp;<small>[<a title="See guide" href="%s/help/admin/bibrank-admin-guide#mr">?</a>]</small>""" % CFG_SITE_URL, [output]) output = "" text = """ <span class="adminlabel">Select</span> <select name="template" class="admin_w200"> <option value="">- select template -</option> """ templates = get_templates() for templ in templates: text += """<option value="%s" %s>%s</option>""" % (templ, template == templ and 'selected="selected"' or '', templ[9:len(templ)-4]) text += """</select><br />""" output += createhiddenform(action="modifyrank", text=text, rnkID=rnkID, button="Show template", confirm=0) try: if template: textarea = "" text = """<span class="adminlabel">Content:</span>""" file = open("%s/bibrank/%s" % (CFG_ETCDIR, template), 'r') lines = file.readlines() for line in lines: textarea += line file.close() text += """<textarea class="admin_wvar" readonly="true" rows="15" cols="70">""" + textarea + """</textarea>""" output += text except StandardError, e: output += """Cannot load file, either it does not exist, or not enough rights to read it: '%s/bibrank/%s'""" % (CFG_ETCDIR, template) finoutput += addadminbox("View templates", [output]) return finoutput def perform_deleterank(rnkID, ln=CFG_SITE_LANG, confirm=0): """form to delete a rank method """ subtitle ='' output = """ <span class="warning"> <dl> <dt><strong>WARNING:</strong></dt> <dd><strong>When deleting a rank method, you also deletes all data related to the rank method, like translations, which collections it was attached to and the data necessary to rank the searchresults. Any scheduled tasks using the deleted rank method will also stop working. <br /><br />For more information, please go to the <a title="See guide" href="%s/help/admin/bibrank-admin-guide">BibRank guide</a> and read the section regarding deleting a rank method.</strong></dd> </dl> </span> """ % CFG_SITE_URL if rnkID: if confirm in ["0", 0]: rnkNAME = get_def_name(rnkID, "rnkMETHOD")[0][1] subtitle = 'Step 1 - Confirm deletion' text = """Delete rank method '%s'.""" % (rnkNAME) output += createhiddenform(action="deleterank", text=text, button="Confirm", rnkID=rnkID, confirm=1) elif confirm in ["1", 1]: try: rnkNAME = get_def_name(rnkID, "rnkMETHOD")[0][1] rnkcode = get_rnk_code(rnkID)[0][0] table = "" try: config = ConfigParser.ConfigParser() config.readfp(open("%s/bibrank/%s.cfg" % (CFG_ETCDIR, rnkcode), 'r')) table = config.get(config.get('rank_method', "function"), "table") except Exception: pass result = delete_rnk(rnkID, table) subtitle = "Step 2 - Result" if result: text = """<b><span class="info">Rank method deleted</span></b>""" try: os.remove("%s/bibrank/%s.cfg" % (CFG_ETCDIR, rnkcode)) text += """<br /><b><span class="info">Configuration file deleted: '%s/bibrank/%s.cfg'.</span></b>""" % (CFG_ETCDIR, rnkcode) except StandardError, e: text += """<br /><b><span class="info">Sorry, could not delete configuration file: '%s/bibrank/%s.cfg'.</span><br />Please delete the file manually.</span></b>""" % (CFG_ETCDIR, rnkcode) else: text = """<b><span class="info">Sorry, could not delete rank method</span></b>""" except StandardError, e: text = """<b><span class="info">Sorry, could not delete rank method, most likely already deleted</span></b>""" output = text body = [output] return addadminbox(subtitle + """&nbsp;&nbsp;&nbsp;<small>[<a title="See guide" href="%s/help/admin/bibrank-admin-guide#dr">?</a>]</small>""" % CFG_SITE_URL, body) def perform_showrankdetails(rnkID, ln=CFG_SITE_LANG): """Returns details about the rank method given by rnkID""" if not rnkID: return "No ranking method selected." if not get_rnk_code(rnkID): return "Ranking method %s does not seem to exist." % str(rnkID) subtitle = """Overview <a href="%s/admin/bibrank/bibrankadmin.py/modifyrank?rnkID=%s&amp;ln=%s">[Modify]</a>""" % (CFG_SITE_URL, rnkID, ln) text = """ BibRank code: %s<br /> Last updated by BibRank: """ % (get_rnk_code(rnkID)[0][0]) if get_rnk(rnkID)[0][2]: text += "%s<br />" % get_rnk(rnkID)[0][2] else: text += "Not yet run.<br />" output = addadminbox(subtitle, [text]) subtitle = """Rank method statistics""" text = "" try: text = "Not yet implemented" except StandardError, e: text = "BibRank not yet run, cannot show statistics for method" output += addadminbox(subtitle, [text]) subtitle = """Attached to collections <a href="%s/admin/bibrank/bibrankadmin.py/modifycollection?rnkID=%s&amp;ln=%s">[Modify]</a>""" % (CFG_SITE_URL, rnkID, ln) text = "" col = get_rnk_col(rnkID, ln) for key, value in col: text+= "%s<br />" % value if not col: text +="No collections" output += addadminbox(subtitle, [text]) subtitle = """Translations <a href="%s/admin/bibrank/bibrankadmin.py/modifytranslations?rnkID=%s&amp;ln=%s">[Modify]</a>""" % (CFG_SITE_URL, rnkID, ln) prev_lang = '' trans = get_translations(rnkID) types = get_rnk_nametypes() types = dict(map(lambda x: (x[0], x[1]), types)) text = "" languages = dict(get_languages()) if trans: for lang, type, name in trans: if lang and languages.has_key(lang) and type and name: if prev_lang != lang: prev_lang = lang text += """%s: <br />""" % (languages[lang]) if types.has_key(type): text+= """<span style="margin-left: 10px">'%s'</span><span class="note">(%s)</span><br />""" % (name, types[type]) else: text = """No translations exists""" output += addadminbox(subtitle, [text]) subtitle = """Configuration file: '%s/bibrank/%s.cfg' <a href="%s/admin/bibrank/bibrankadmin.py/modifyrank?rnkID=%s&amp;ln=%s">[Modify]</a>""" % (CFG_ETCDIR, get_rnk_code(rnkID)[0][0], CFG_SITE_URL, rnkID, ln) text = "" try: file = open("%s/bibrank/%s.cfg" % (CFG_ETCDIR, get_rnk_code(rnkID)[0][0])) text += """<pre>""" for line in file.readlines(): text += line text += """</pre>""" except StandardError, e: text = """Cannot load file, either it does not exist, or not enough rights to read it.""" output += addadminbox(subtitle, [text]) return output def compare_on_val(second, first): return cmp(second[1], first[1]) def get_rnk_code(rnkID): """Returns the name from rnkMETHOD based on argument rnkID - id from rnkMETHOD""" try: res = run_sql("SELECT name FROM rnkMETHOD where id=%s" % (rnkID)) return res except StandardError, e: return () def get_rnk(rnkID=''): """Return one or all rank methods rnkID - return the rank method given, or all if not given""" try: if rnkID: res = run_sql("SELECT id,name,DATE_FORMAT(last_updated, '%%Y-%%m-%%d %%H:%%i:%%s') from rnkMETHOD WHERE id=%s" % rnkID) else: res = run_sql("SELECT id,name,DATE_FORMAT(last_updated, '%%Y-%%m-%%d %%H:%%i:%%s') from rnkMETHOD") return res except StandardError, e: return () def get_translations(rnkID): """Returns the translations in rnkMETHODNAME for a rankmethod rnkID - the id of the rankmethod from rnkMETHOD """ try: res = run_sql("SELECT ln, type, value FROM rnkMETHODNAME where id_rnkMETHOD=%s ORDER BY ln,type" % (rnkID)) return res except StandardError, e: return () def get_rnk_nametypes(): """Return a list of the various translationnames for the rank methods""" type = [] type.append(('ln', 'Long name')) #type.append(('sn', 'Short name')) return type def get_col_nametypes(): """Return a list of the various translationnames for the rank methods""" type = [] type.append(('ln', 'Long name')) return type def get_rnk_col(rnkID, ln=CFG_SITE_LANG): """ Returns a list of the collections the given rank method is attached to rnkID - id from rnkMETHOD""" try: res1 = dict(run_sql("SELECT id_collection, '' FROM collection_rnkMETHOD WHERE id_rnkMETHOD=%s" % rnkID)) res2 = get_def_name('', "collection") result = filter(lambda x: res1.has_key(x[0]), res2) return result except StandardError, e: return () def get_templates(): """Read CFG_ETCDIR/bibrank and returns a list of all files with 'template' """ templates = [] files = os.listdir(CFG_ETCDIR + "/bibrank/") for file in files: if str.find(file,"template_") != -1: templates.append(file) return templates def attach_col_rnk(rnkID, colID): """attach rank method to collection rnkID - id from rnkMETHOD table colID - id of collection, as in collection table """ try: res = run_sql("INSERT INTO collection_rnkMETHOD(id_collection, id_rnkMETHOD) values (%s,%s)" % (colID, rnkID)) return (1, "") except StandardError, e: return (0, e) def detach_col_rnk(rnkID, colID): """detach rank method from collection rnkID - id from rnkMETHOD table colID - id of collection, as in collection table """ try: res = run_sql("DELETE FROM collection_rnkMETHOD WHERE id_collection=%s AND id_rnkMETHOD=%s" % (colID, rnkID)) return (1, "") except StandardError, e: return (0, e) def delete_rnk(rnkID, table=""): """Deletes all data for the given rank method rnkID - delete all data in the tables associated with ranking and this id """ try: res = run_sql("DELETE FROM rnkMETHOD WHERE id=%s" % rnkID) res = run_sql("DELETE FROM rnkMETHODNAME WHERE id_rnkMETHOD=%s" % rnkID) res = run_sql("DELETE FROM collection_rnkMETHOD WHERE id_rnkMETHOD=%s" % rnkID) res = run_sql("DELETE FROM rnkMETHODDATA WHERE id_rnkMETHOD=%s" % rnkID) if table: res = run_sql("truncate %s" % table) res = run_sql("truncate %sR" % table[:-1]) return (1, "") except StandardError, e: return (0, e) def modify_rnk(rnkID, rnkcode): """change the code for the rank method given rnkID - change in rnkMETHOD where id is like this rnkcode - new value for field 'name' in rnkMETHOD """ try: res = run_sql("UPDATE rnkMETHOD set name=%s WHERE id=%s", (rnkcode, rnkID)) return (1, "") except StandardError, e: return (0, e) def add_rnk(rnkcode): """Adds a new rank method to rnkMETHOD rnkcode - the "code" for the rank method, to be used by bibrank daemon """ try: res = run_sql("INSERT INTO rnkMETHOD (name) VALUES (%s)", (rnkcode,)) res = run_sql("SELECT id FROM rnkMETHOD WHERE name=%s", (rnkcode,)) if res: return (1, res[0][0]) else: raise StandardError except StandardError, e: return (0, e) def addadminbox(header='', datalist=[], cls="admin_wvar"): """used to create table around main data on a page, row based. header - header on top of the table datalist - list of the data to be added row by row cls - possible to select wich css-class to format the look of the table.""" if len(datalist) == 1: per = '100' else: per = '75' output = '<table class="%s" ' % (cls, ) + 'width="95%">\n' output += """ <thead> <tr> <th class="adminheaderleft" colspan="%s">%s</th> </tr> </thead> <tbody> """ % (len(datalist), header) output += ' <tr>\n' output += """ <td style="vertical-align: top; margin-top: 5px; width: %s;"> %s </td> """ % (per+'%', datalist[0]) if len(datalist) > 1: output += """ <td style="vertical-align: top; margin-top: 5px; width: %s;"> %s </td> """ % ('25%', datalist[1]) output += ' </tr>\n' output += """ </tbody> </table> """ return output def tupletotable(header=[], tuple=[], start='', end='', extracolumn='', highlight_rows_p=False, alternate_row_colors_p=False): """create html table for a tuple. header - optional header for the columns tuple - create table of this start - text to be added in the beginning, most likely beginning of a form end - text to be added in the end, mot likely end of a form. extracolumn - mainly used to put in a button. highlight_rows_p - if the cursor hovering a row should highlight the full row or not alternate_row_colors_p - if alternate background colours should be used for the rows """ # study first row in tuple for alignment align = [] try: firstrow = tuple[0] if type(firstrow) in [int, long]: align = ['admintdright'] elif type(firstrow) in [str, dict]: align = ['admintdleft'] else: for item in firstrow: if type(item) is int: align.append('admintdright') else: align.append('admintdleft') except IndexError: firstrow = [] tblstr = '' for h in header + ['']: tblstr += ' <th class="adminheader">%s</th>\n' % (h, ) if tblstr: tblstr = ' <tr>\n%s\n </tr>\n' % (tblstr, ) tblstr = start + '<table class="admin_wvar_nomargin">\n' + tblstr # extra column try: extra = '<tr class="%s">' % (highlight_rows_p and 'admin_row_highlight' or '') if type(firstrow) not in [int, long, str, dict]: # for data in firstrow: extra += '<td class="%s">%s</td>\n' % ('admintd', data) for i in range(len(firstrow)): extra += '<td class="%s">%s</td>\n' % (align[i], firstrow[i]) else: extra += ' <td class="%s">%s</td>\n' % (align[0], firstrow) extra += '<td class="extracolumn" rowspan="%s" style="vertical-align: top;">\n%s\n</td>\n</tr>\n' % (len(tuple), extracolumn) except IndexError: extra = '' tblstr += extra # for i in range(1, len(tuple)): j = 0 for row in tuple[1:]: j += 1 tblstr += ' <tr class="%s %s">\n' % (highlight_rows_p and 'admin_row_highlight' or '', (j % 2 and alternate_row_colors_p) and 'admin_row_color' or '') # row = tuple[i] if type(row) not in [int, long, str, dict]: # for data in row: tblstr += '<td class="admintd">%s</td>\n' % (data,) for i in range(len(row)): tblstr += '<td class="%s">%s</td>\n' % (align[i], row[i]) else: tblstr += ' <td class="%s">%s</td>\n' % (align[0], row) tblstr += ' </tr> \n' tblstr += '</table> \n ' tblstr += end return tblstr def tupletotable_onlyselected(header=[], tuple=[], selected=[], start='', end='', extracolumn=''): """create html table for a tuple. header - optional header for the columns tuple - create table of this selected - indexes of selected rows in the tuple start - put this in the beginning end - put this in the beginning extracolumn - mainly used to put in a button""" tuple2 = [] for index in selected: tuple2.append(tuple[int(index)-1]) return tupletotable(header=header, tuple=tuple2, start=start, end=end, extracolumn=extracolumn) def addcheckboxes(datalist=[], name='authids', startindex=1, checked=[]): """adds checkboxes in front of the listdata. datalist - add checkboxes in front of this list name - name of all the checkboxes, values will be associated with this name startindex - usually 1 because of the header checked - values of checkboxes to be pre-checked """ if not type(checked) is list: checked = [checked] for row in datalist: if 1 or row[0] not in [-1, "-1", 0, "0"]: # always box, check another place chkstr = str(startindex) in checked and 'checked="checked"' or '' row.insert(0, '<input type="checkbox" name="%s" value="%s" %s />' % (name, startindex, chkstr)) else: row.insert(0, '') startindex += 1 return datalist def createhiddenform(action="", text="", button="confirm", cnfrm='', **hidden): """create select with hidden values and submit button action - name of the action to perform on submit text - additional text, can also be used to add non hidden input button - value/caption on the submit button cnfrm - if given, must check checkbox to confirm **hidden - dictionary with name=value pairs for hidden input """ output = '<form action="%s" method="post">\n' % (action, ) output += '<table>\n<tr><td style="vertical-align: top">' output += text if cnfrm: output += ' <input type="checkbox" name="confirm" value="1"/>' for key in hidden.keys(): if type(hidden[key]) is list: for value in hidden[key]: output += ' <input type="hidden" name="%s" value="%s"/>\n' % (key, value) else: output += ' <input type="hidden" name="%s" value="%s"/>\n' % (key, hidden[key]) output += '</td><td style="vertical-align: bottom">' output += ' <input class="adminbutton" type="submit" value="%s"/>\n' % (button, ) output += '</td></tr></table>' output += '</form>\n' return output def get_languages(): languages = [] for (lang, lang_namelong) in language_list_long(): languages.append((lang, lang_namelong)) languages.sort() return languages def get_def_name(ID, table): """Returns a list of the names, either with the name in the current language, the default language, or just the name from the given table ln - a language supported by Invenio type - the type of value wanted, like 'ln', 'sn'""" name = "name" if table[-1:].isupper(): name = "NAME" try: if ID: res = run_sql("SELECT id,name FROM %s where id=%s" % (table, ID)) else: res = run_sql("SELECT id,name FROM %s" % table) res = list(res) res.sort(compare_on_val) return res except StandardError, e: return [] def get_i8n_name(ID, ln, rtype, table): """Returns a list of the names, either with the name in the current language, the default language, or just the name from the given table ln - a language supported by Invenio type - the type of value wanted, like 'ln', 'sn'""" name = "name" if table[-1:].isupper(): name = "NAME" try: res = "" if ID: res = run_sql("SELECT id_%s,value FROM %s%s where type='%s' and ln='%s' and id_%s=%s" % (table, table, name, rtype,ln, table, ID)) else: res = run_sql("SELECT id_%s,value FROM %s%s where type='%s' and ln='%s'" % (table, table, name, rtype,ln)) if ln != CFG_SITE_LANG: if ID: res1 = run_sql("SELECT id_%s,value FROM %s%s WHERE ln='%s' and type='%s' and id_%s=%s" % (table, table, name, CFG_SITE_LANG, rtype, table, ID)) else: res1 = run_sql("SELECT id_%s,value FROM %s%s WHERE ln='%s' and type='%s'" % (table, table, name, CFG_SITE_LANG, rtype)) res2 = dict(res) result = filter(lambda x: not res2.has_key(x[0]), res1) res = res + result if ID: res1 = run_sql("SELECT id,name FROM %s where id=%s" % (table, ID)) else: res1 = run_sql("SELECT id,name FROM %s" % table) res2 = dict(res) result = filter(lambda x: not res2.has_key(x[0]), res1) res = res + result res = list(res) res.sort(compare_on_val) return res except StandardError, e: raise StandardError def get_name(ID, ln, rtype, table): """Returns the value from the table name based on arguments ID - id ln - a language supported by Invenio type - the type of value wanted, like 'ln', 'sn' table - tablename""" name = "name" if table[-1:].isupper(): name = "NAME" try: res = run_sql("SELECT value FROM %s%s WHERE type='%s' and ln='%s' and id_%s=%s" % (table, name, rtype, ln, table, ID)) return res except StandardError, e: return () def modify_translations(ID, langs, sel_type, trans, table): """add or modify translations in tables given by table frmID - the id of the format from the format table sel_type - the name type langs - the languages trans - the translations, in same order as in langs table - the table""" name = "name" if table[-1:].isupper(): name = "NAME" try: for nr in range(0,len(langs)): res = run_sql("SELECT value FROM %s%s WHERE id_%s=%%s AND type=%%s AND ln=%%s" % (table, name, table), (ID, sel_type, langs[nr][0])) if res: if trans[nr]: res = run_sql("UPDATE %s%s SET value=%%s WHERE id_%s=%%s AND type=%%s AND ln=%%s" % (table, name, table), (trans[nr], ID, sel_type, langs[nr][0])) else: res = run_sql("DELETE FROM %s%s WHERE id_%s=%%s AND type=%%s AND ln=%%s" % (table, name, table), (ID, sel_type, langs[nr][0])) else: if trans[nr]: res = run_sql("INSERT INTO %s%s (id_%s, type, ln, value) VALUES (%%s,%%s,%%s,%%s)" % (table, name, table), (ID, sel_type, langs[nr][0], trans[nr])) return (1, "") except StandardError, e: return (0, e) def write_outcome(res): """ Write the outcome of an update of some settings. Parameter 'res' is a tuple (int, str), where 'int' is 0 when there is an error to display, and 1 when everything went fine. 'str' is a message displayed when there is an error. """ if res and res[0] == 1: return """<b><span class="info">Operation successfully completed.</span></b>""" elif res: return """<b><span class="info">Operation failed. Reason:</span></b><br />%s""" % res[1]
AlbertoPeon/invenio
modules/bibrank/lib/bibrankadminlib.py
Python
gpl-2.0
41,781
# coding = utf-8 """ Shopping and shopkeepers. 'Tale' mud driver, mudlib and interactive fiction framework Copyright by Irmen de Jong ([email protected]) Shopping related commands will be roughly: SHOP/LIST [item type] list what the shop has for sale INFO/INQUIRE/ASK about [item/number] same as "ask [shopkeeper] about [item/number]" It will display info about the item on sale, as if you examined it. BUY > buy sword (buy the first sword on the list) > buy #3 (buy the third item on the list) SELL > sell sword (sell the first sword in your inventory) VALUE/APPRAISE ask shop keeper how much he is willing to pay for an item: > value sword (appraise the first sword in your inventory) """ from __future__ import absolute_import, print_function, division, unicode_literals import random import datetime from .npc import NPC from .base import Item, clone from .items.basic import Trash from .errors import ActionRefused, ParseError, RetrySoulVerb from .util import search_item, sorted_by_name from . import mud_context from . import lang banking_money_limit = 15000.0 class Shopkeeper(NPC): def init(self): super(Shopkeeper, self).init() self.shop = ShopBehavior() self.verbs = { "shop": "Go shopping! This shows some information about the shop, and what it has for sale.", "list": "Go shopping! This shows some information about the shop, and what it has for sale.", "sell": "Sell stuff", "buy": "Buy stuff", "value": "Ask the shopkeeper about what he or she's willing to pay for an item", "appraise": "Ask the shopkeeper about what he or she's willing to pay for an item", "info": "Ask about an item on sale. Name the item or give its list number.", "inquire": "Ask about an item on sale. Name the item or give its list number.", "ask": "Ask about an item on sale. Name the item or give its list number." # overrides default 'ask' } def set_shop(self, shop): if any(item not in self for item in shop.forsale): raise ValueError("not all items from shop.forsale are in the shopkeeper's inventory") self.shop = shop if self.shop.banks_money: self.money = min(self.money, banking_money_limit) # make sure we don't have surplus cash def do_wander(self, ctx): # let the shopkeeper wander randomly direction = self.select_random_move() if direction: self.move(direction.target, self) ctx.driver.defer(random.randint(20, 60), self.do_wander) def validate_open_hours(self, actor=None, current_time=None): if actor and "wizard" in actor.privileges: return # for wizards, shops are always open if current_time is None: current_time = mud_context.driver.game_clock.clock.time() assert isinstance(current_time, datetime.time) for from_hr, to_hr in self.shop.open_hours: from_t = datetime.time(from_hr) to_t = datetime.time(to_hr) if from_hr < to_hr: if from_t <= current_time < to_t: # normal order such as 9..17 return # we're open! else: if from_t <= current_time or current_time < to_t: # reversed order, passes midnight, such as 20..3 return # we're open! raise ActionRefused("The shop is currently closed! Come back another time, during opening hours.") def _parse_item(self, parsed, actor): if len(parsed.who_info) != 1: raise ParseError("I don't understand what single item you're talking about.") item, info = parsed.who_info.popitem() if item not in actor: raise ActionRefused(self.shop.msg_playercantsell or "You don't have that.") if not isinstance(item, Item): raise ActionRefused("You can't sell %s, %s is not trade goods!" % (item.objective, item.subjective)) designator = info.previous_word or "" return item, designator def _get_from_list(self, number): shoplist = sorted_by_name(self.inventory) try: return shoplist[number-1] except IndexError: raise ActionRefused("That number doesn't appear on the list of items that are for sale.") def notify_action(self, parsed, actor): # react to some things people might say such as "ask about <item>/<number>" if parsed.verb in self.verbs: return # avoid reacting to verbs we already have a handler for unparsed = parsed.unparsed.split() if self in parsed.who_info or self.name in unparsed or lang.capital(self.name) in unparsed \ or parsed.verb in ("hi", "hello", "greet", "wave"): # someone referred to us if random.random() < 0.2: self.do_socialize("smile at " + actor.name) elif random.random() < 0.2: self.do_socialize("wave at " + actor.name) elif random.random() < 0.2: self.do_socialize("nod at " + actor.name) def handle_verb(self, parsed, actor): if self.shop.banks_money: self.money = min(self.money, banking_money_limit) # make sure we don't have surplus cash self.validate_open_hours(actor) if parsed.verb in ("shop", "list"): return self.shop_list(parsed, actor) elif parsed.verb in ("info", "inquire", "ask"): return self.shop_inquire(parsed, actor) elif parsed.verb in ("value", "appraise"): return self.shop_appraise(parsed, actor) elif parsed.verb == "buy": return self.shop_buy(parsed, actor) elif parsed.verb == "sell": return self.shop_sell(parsed, actor) else: return False # unrecognised verb def shop_list(self, parsed, actor): open_hrs = lang.join(["%d to %d" % hours for hours in self.shop.open_hours]) actor.tell("%s says: \"Welcome. Our opening hours are:" % lang.capital(self.title), open_hrs) if "wizard" in actor.privileges: actor.tell(" (but for wizards, we're always open)") if self.shop.willbuy: actor.tell(", and we specialize in", lang.join(lang.pluralize(word) for word in self.shop.willbuy)) actor.tell("\"\n", end=True) # don't show shop.forsale, it is for the code to know what items have limitless supply if self.inventory_size == 0: actor.tell("%s apologizes, \"I'm sorry, but our stuff is all gone for the moment. Come back later.\"" % lang.capital(self.subjective)) self.do_socialize("shrug at " + actor.name) else: actor.tell("%s shows you a list of what is in stock at the moment:" % lang.capital(self.subjective), end=True) txt = ["<ul> # <dim>|</><ul> item <dim>|</><ul> price </>"] for i, item in enumerate(sorted_by_name(self.inventory), start=1): price = item.value * self.shop.sellprofit txt.append("%3d. %-30s %s" % (i, item.title, mud_context.driver.moneyfmt.display(price))) actor.tell(*txt, format=False) return True def shop_inquire(self, parsed, actor): item = None if len(parsed.who_order) == 2: # 'ask lucy about clock/#5/5' item = parsed.who_order[0] if not isinstance(item, Item): item = parsed.who_order[1] if not isinstance(item, Item): item = None elif len(parsed.who_order) == 1: # 'ask about clock/#5/5' item = parsed.who_order[0] if not isinstance(item, Item): item = None if item: # the parser found an item, check if there's one in the shop too with the same name. shop_item = search_item(item.name, self.inventory) if shop_item: item = shop_item if not item: # no items in the question, try to extract name/number and look in the shop list # for word in parsed.unrecognized: if word in ("#", "about", "over"): continue if word.startswith("#"): word = word[1:] try: number = int(word) if number <= 0: continue except ValueError: # not a number, search by name item = search_item(word, self.inventory) if not item: continue else: # got a number in the shop item = self._get_from_list(number) if item: # got an item, inquire about it if item not in self: raise ActionRefused("That is not something from the shop. You can examine the %s as usual." % item.name) actor.tell("The shop sells %s." % lang.a(item.title)) if item.name in item.extra_desc: actor.tell(lang.fullstop(item.extra_desc[item.name])) elif item.description: actor.tell(lang.fullstop(item.description)) if random.random() < 0.1: actor.tell("\"Would you like to buy something?\", %s asks." % self.title) elif random.random() < 0.1: actor.tell("\"Take your time\", %s says." % self.title) return True if parsed.verb == "ask": raise RetrySoulVerb else: raise ParseError("It's unclear what item you want to inquire about.") def shop_appraise(self, parsed, actor): item, designator = self._parse_item(parsed, actor) if designator: raise ParseError("It's not clear what item you mean.") if item.value <= 0: actor.tell("%s tells you it's worthless." % lang.capital(self.title)) return True # @todo charisma bonus/malus price = item.value * self.shop.buyprofit value_str = mud_context.driver.moneyfmt.display(price) actor.tell("%s appraises the %s." % (lang.capital(self.title), item.name)) actor.tell("%s tells you: \"I'll give you %s for it.\"" % (lang.capital(self.subjective), value_str)) return True def shop_buy(self, parsed, actor): if len(parsed.args) != 1: raise ParseError("I don't understand what you want to buy.") item = None name = parsed.args[0] if name[0] == '#': # it's the Nth from the list try: num = int(name[1:]) if num <= 0: raise ValueError("num needs to be 1 or higher") item = sorted_by_name(self.inventory)[num - 1] if search_item(item.title, self.shop.forsale): item = clone(item) # make a clone and sell that, the forsale items should never run out except ValueError: raise ParseError("What number on the list do you mean?") except IndexError: raise ParseError("That number is not on the list.") if not item: item = search_item(name, self.shop.forsale) if item: item = clone(item) # make a clone and sell that, the forsale items should never run out else: # search inventory item = self.search_item(name, include_inventory=True, include_location=False, include_containers_in_inventory=False) if not item: actor.tell("%s says: \"%s\"" % (lang.capital(self.title), self.shop.msg_playercantbuy)) return True # sell the item to the customer # @todo charisma bonus/malus price = item.value * self.shop.sellprofit if price > actor.money: actor.tell("%s tells you: \"%s\"" % (lang.capital(self.title), self.shop.msg_playercantafford)) if self.shop.action_temper: self.do_socialize("%s %s" % (self.shop.action_temper, actor.name)) return True item.move(actor, actor) actor.money -= price self.money += price assert actor.money >= 0.0 self.do_socialize("thank " + actor.name) actor.tell("You've bought the %s!" % item.name) if self.shop.msg_shopsolditem: if "%d" in self.shop.msg_shopsolditem: # old-style (circle) message with just a numeric value for the money sold_msg = self.shop.msg_shopsolditem % price else: # new-style (tale) message with a %s placeholder for the money text sold_msg = self.shop.msg_shopsolditem % mud_context.driver.moneyfmt.display(price) actor.tell("%s says: \"%s\"" % (lang.capital(self.title), sold_msg)) else: actor.tell("You paid %s for it." % mud_context.driver.moneyfmt.display(price)) if self.shop.banks_money: # shopkeeper puts money over a limit in the bank if self.money > banking_money_limit: self.tell_others("Swiftly, %s puts some excess money away in a secret stash somewhere. You failed to see where it went." % self.title) self.money = banking_money_limit return True def shop_sell(self, parsed, actor): item, designator = self._parse_item(parsed, actor) if designator: raise ParseError("It's not clear what item you want to sell.") if item.value <= 0 or isinstance(item, Trash): actor.tell("%s tells you: \"%s\"" % (lang.capital(self.title), self.shop.msg_shopdoesnotbuy)) if self.shop.action_temper: self.do_socialize("%s %s" % (self.shop.action_temper, actor.name)) return True if search_item(item.title, self.shop.forsale): # if the item is on the forsale list, don't buy it (we already have an endless supply) actor.tell("%s tells you: \"%s\"" % (lang.capital(self.title), self.shop.msg_shopdoesnotbuy)) return True # @todo check wontdealwith # @todo check item type # check money # @todo charisma bonus/malus price = item.value * self.shop.buyprofit limit = self.money * 0.75 # shopkeeper should not spend more than 75% of his money on a single sale if price >= limit: actor.tell("%s says: \"%s\"" % (lang.capital(self.title), self.shop.msg_shopcantafford)) return True item.move(self, actor) actor.money += price self.money -= price assert self.money >= 0.0 actor.tell("You've sold the %s." % item.name) if self.shop.msg_shopboughtitem: if "%d" in self.shop.msg_shopboughtitem: # old-style (circle) message with just a numeric value for the money bought_msg = self.shop.msg_shopboughtitem % price else: # new-style (tale) message with a %s placeholder for the money text bought_msg = self.shop.msg_shopboughtitem % mud_context.driver.moneyfmt.display(price) actor.tell("%s says: \"%s\"" % (lang.capital(self.title), bought_msg)) else: actor.tell("%s gave you %s for it." % (lang.capital(self.title), mud_context.driver.moneyfmt.display(price))) self.do_socialize("thank " + actor.name) return True class ShopBehavior(object): """the data describing the behavior of a particular shop""" def __init__(self): self.shopkeeper_vnum = None # used for circle data to designate the shopkeeper belonging to this shop self.banks_money = False self.will_fight = False self._buyprofit = 0.3 # price factor when shop buys item self._sellprofit = 1.6 # price factor when shop sells item self.open_hours = [(9, 17), (18, 22)] self.forsale = set() # items the shop always sells no matter how many are bought (should be in shopkeeper's inventory as well!) self.msg_playercantafford = "No cash, no goods!" self.msg_playercantbuy = "We don't sell that." self.msg_playercantsell = "I don't think you have that." self.msg_shopboughtitem = "Thank-you very much. Here are your %s as payment." self.msg_shopcantafford = "I can't afford to buy anything, I'm only a poor peddler." self.msg_shopdoesnotbuy = "I don't buy that stuff. Try another shop." self.msg_shopsolditem = "Here you go. That'll be... %s." self.action_temper = "smoke" self.willbuy = set() self.wontdealwith = set() @property def buyprofit(self): return self._buyprofit @buyprofit.setter def buyprofit(self, value): assert value <= 1.0 self._buyprofit = value @property def sellprofit(self): return self._sellprofit @sellprofit.setter def sellprofit(self, value): assert value >= 1.0 self._sellprofit = value
sils1297/Tale
tale/shop.py
Python
gpl-3.0
17,240
# coding: utf-8 """ Onshape REST API The Onshape REST API consumed by all clients. # noqa: E501 The version of the OpenAPI document: 1.113 Contact: [email protected] Generated by: https://openapi-generator.tech """ from __future__ import absolute_import import re # noqa: F401 import sys # noqa: F401 import six # noqa: F401 import nulltype # noqa: F401 from onshape_client.oas.model_utils import ( # noqa: F401 ModelComposed, ModelNormal, ModelSimple, date, datetime, file_type, int, none_type, str, validate_get_composed_info, ) try: from onshape_client.oas.models import btm_individual_query_base139 except ImportError: btm_individual_query_base139 = sys.modules[ "onshape_client.oas.models.btm_individual_query_base139" ] try: from onshape_client.oas.models import btm_individual_query_with_occurrence811_all_of except ImportError: btm_individual_query_with_occurrence811_all_of = sys.modules[ "onshape_client.oas.models.btm_individual_query_with_occurrence811_all_of" ] try: from onshape_client.oas.models import btm_individual_query_with_occurrence_base904 except ImportError: btm_individual_query_with_occurrence_base904 = sys.modules[ "onshape_client.oas.models.btm_individual_query_with_occurrence_base904" ] try: from onshape_client.oas.models import btm_inference_query_with_occurrence1083 except ImportError: btm_inference_query_with_occurrence1083 = sys.modules[ "onshape_client.oas.models.btm_inference_query_with_occurrence1083" ] class BTMIndividualQueryWithOccurrence811(ModelComposed): """NOTE: This class is auto generated by OpenAPI Generator. Ref: https://openapi-generator.tech Do not edit the class manually. Attributes: allowed_values (dict): The key is the tuple path to the attribute and the for var_name this is (var_name,). The value is a dict with a capitalized key describing the allowed value and an allowed value. These dicts store the allowed enum values. attribute_map (dict): The key is attribute name and the value is json key in definition. discriminator_value_class_map (dict): A dict to go from the discriminator variable value to the discriminator class name. validations (dict): The key is the tuple path to the attribute and the for var_name this is (var_name,). The value is a dict that stores validations for max_length, min_length, max_items, min_items, exclusive_maximum, inclusive_maximum, exclusive_minimum, inclusive_minimum, and regex. additional_properties_type (tuple): A tuple of classes accepted as additional properties values. """ allowed_values = {} validations = {} additional_properties_type = None @staticmethod def openapi_types(): """ This must be a class method so a model may have properties that are of type self, this ensures that we don't create a cyclic import Returns openapi_types (dict): The key is attribute name and the value is attribute type. """ return { "bt_type": (str,), # noqa: E501 "entity_query": (str,), # noqa: E501 "deterministic_id_list": ( btm_individual_query_base139.BTMIndividualQueryBase139, ), # noqa: E501 "deterministic_ids": ([str],), # noqa: E501 "import_microversion": (str,), # noqa: E501 "node_id": (str,), # noqa: E501 "path": ([str],), # noqa: E501 "query": ( btm_individual_query_base139.BTMIndividualQueryBase139, ), # noqa: E501 "query_string": (str,), # noqa: E501 } @staticmethod def discriminator(): return { "bt_type": { "BTMInferenceQueryWithOccurrence-1083": btm_inference_query_with_occurrence1083.BTMInferenceQueryWithOccurrence1083, }, } attribute_map = { "bt_type": "btType", # noqa: E501 "entity_query": "entityQuery", # noqa: E501 "deterministic_id_list": "deterministicIdList", # noqa: E501 "deterministic_ids": "deterministicIds", # noqa: E501 "import_microversion": "importMicroversion", # noqa: E501 "node_id": "nodeId", # noqa: E501 "path": "path", # noqa: E501 "query": "query", # noqa: E501 "query_string": "queryString", # noqa: E501 } required_properties = set( [ "_data_store", "_check_type", "_from_server", "_path_to_item", "_configuration", "_composed_instances", "_var_name_to_model_instances", "_additional_properties_model_instances", ] ) def __init__( self, _check_type=True, _from_server=False, _path_to_item=(), _configuration=None, **kwargs ): # noqa: E501 """btm_individual_query_with_occurrence811.BTMIndividualQueryWithOccurrence811 - a model defined in OpenAPI Keyword Args: _check_type (bool): if True, values for parameters in openapi_types will be type checked and a TypeError will be raised if the wrong type is input. Defaults to True _path_to_item (tuple/list): This is a list of keys or values to drill down to the model in received_data when deserializing a response _from_server (bool): True if the data is from the server False if the data is from the client (default) _configuration (Configuration): the instance to use when deserializing a file_type parameter. If passed, type conversion is attempted If omitted no type conversion is done. bt_type (str): [optional] # noqa: E501 entity_query (str): [optional] # noqa: E501 deterministic_id_list (btm_individual_query_base139.BTMIndividualQueryBase139): [optional] # noqa: E501 deterministic_ids ([str]): [optional] # noqa: E501 import_microversion (str): [optional] # noqa: E501 node_id (str): [optional] # noqa: E501 path ([str]): [optional] # noqa: E501 query (btm_individual_query_base139.BTMIndividualQueryBase139): [optional] # noqa: E501 query_string (str): [optional] # noqa: E501 """ self._data_store = {} self._check_type = _check_type self._from_server = _from_server self._path_to_item = _path_to_item self._configuration = _configuration constant_args = { "_check_type": _check_type, "_path_to_item": _path_to_item, "_from_server": _from_server, "_configuration": _configuration, } required_args = {} # remove args whose value is Null because they are unset required_arg_names = list(required_args.keys()) for required_arg_name in required_arg_names: if required_args[required_arg_name] is nulltype.Null: del required_args[required_arg_name] model_args = {} model_args.update(required_args) model_args.update(kwargs) composed_info = validate_get_composed_info(constant_args, model_args, self) self._composed_instances = composed_info[0] self._var_name_to_model_instances = composed_info[1] self._additional_properties_model_instances = composed_info[2] unused_args = composed_info[3] for var_name, var_value in required_args.items(): setattr(self, var_name, var_value) for var_name, var_value in six.iteritems(kwargs): if ( var_name in unused_args and self._configuration is not None and self._configuration.discard_unknown_keys and not self._additional_properties_model_instances ): # discard variable. continue setattr(self, var_name, var_value) @staticmethod def _composed_schemas(): # we need this here to make our import statements work # we must store _composed_schemas in here so the code is only run # when we invoke this method. If we kept this at the class # level we would get an error beause the class level # code would be run when this module is imported, and these composed # classes don't exist yet because their module has not finished # loading return { "anyOf": [], "allOf": [ btm_individual_query_with_occurrence811_all_of.BTMIndividualQueryWithOccurrence811AllOf, btm_individual_query_with_occurrence_base904.BTMIndividualQueryWithOccurrenceBase904, ], "oneOf": [], } @classmethod def get_discriminator_class(cls, from_server, data): """Returns the child class specified by the discriminator""" discriminator = cls.discriminator() discr_propertyname_py = list(discriminator.keys())[0] discr_propertyname_js = cls.attribute_map[discr_propertyname_py] if from_server: class_name = data[discr_propertyname_js] else: class_name = data[discr_propertyname_py] class_name_to_discr_class = discriminator[discr_propertyname_py] return class_name_to_discr_class.get(class_name)
onshape-public/onshape-clients
python/onshape_client/oas/models/btm_individual_query_with_occurrence811.py
Python
mit
9,868
import random from apps.algorithms.mean import Mean from apps.algorithms.standart_deviation import StandartDeviation from apps.algorithms.z_value import ZValue from apps.datasets.dataset import DataSet __author__ = 'cenk' def demo2(): data_list = [] value_size = 10000 val = 0 while val < value_size: data_list.append(random.randint(0, 1000000000)) val += 1 ## I add here anomly data_list.append(999999999999999999) random.shuffle(data_list) dataset = DataSet() dataset.set(data_list) train, validation, test = dataset.split_train_validation_test_data() training_list = train.get() validation_list = validation.get() test_list = test.get() standart_deviation = StandartDeviation() standart_deviation_value = standart_deviation.calculate(training_list) mean = Mean() mean_value = mean.calculate(training_list) # print "Training Set: %s, Validation Set: %s, Test Set: %s" % (training_list, validation_list, test_list) print "Standart Deviation: %f, Mean Value: %f" % (standart_deviation_value, mean_value) z_value = ZValue() counter = 0 for val in validation_list: z_value.calculate(val, mean=mean_value, standart_deviation=standart_deviation_value) table_value = z_value.find_from_table() if table_value == -1: print "This val is anomaly:", val counter += 1 print "Anomaly Count: %d, Dataset Count: %d" % (counter, dataset.__len__()) counter = 0 for val in test_list: z_value.calculate(val, mean=mean_value, standart_deviation=standart_deviation_value) table_value = z_value.find_from_table() if table_value == -1: print "This val is anomaly:", val counter += 1 print "Anomaly Count: %d, Dataset Count: %d" % (counter, dataset.__len__()) if __name__ == "__main__": print "-*-" * 20, "Demo 2 Starts", "-*-" * 20 demo2() print "-*-" * 20, "Demo 2 Ends", "-*-" * 20
cenkbircanoglu/Anomaly-Detection
demos/demo2.py
Python
mit
1,996
import waffle from rest_framework.exceptions import NotFound def waffle_feature_is_active(request, instance_type, instance_name): """ Determine if flag, switch, or sample is active for the given user. :param request: Django request :param instance_type: Either "flag", "switch", or "sample" :param instance_name: *Name* of the flag/switch/sample :return: Boolean. Is the flag/switch/or sample active? """ waffle_map = { 'flag': { 'waffle_func': waffle.flag_is_active, 'waffle_args': (request, instance_name), }, 'switch': { 'waffle_func': waffle.switch_is_active, 'waffle_args': (instance_name,), }, 'sample': { 'waffle_func': waffle.sample_is_active, 'waffle_args': (instance_name,), }, }[instance_type] return waffle_map['waffle_func'](*waffle_map['waffle_args']) def require_flag(flag_name): """ Decorator to check whether waffle flag is active. If inactive, raises NotFound. """ def wrapper(fn): return check_waffle_object(fn, 'flag', flag_name) return wrapper def require_switch(switch_name): """ Decorator to check whether waffle switch is active. If inactive, raises NotFound. """ def wrapper(fn): return check_waffle_object(fn, 'switch', switch_name) return wrapper def require_sample(sample_name): """ Decorator to check whether waffle sample is active. If inactive, raises NotFound. """ def wrapper(fn): return check_waffle_object(fn, 'sample', sample_name) return wrapper def check_waffle_object(fn, instance_type, instance_name): def check_waffle_object(*args, **kwargs): if waffle_feature_is_active(args[0].request, instance_type, instance_name): return fn(*args, **kwargs) else: raise NotFound('Endpoint is disabled.') return check_waffle_object
pattisdr/osf.io
api/base/waffle_decorators.py
Python
apache-2.0
1,958
# -*- coding: utf-8 -*- import os class CronParser(object): def __init__(self, logger=None): self.logger = logger def parse_cron_string(self, cron_string): """ Parse a cron data string :param cron_string: :return: """ formatted_cron_data = [] if cron_string: cron_data = cron_string.split(u'\\n') parsed_cron_data = self.parse_cron_data(cron_data) formatted_cron_data = self.format_cron_data(parsed_cron_data) return formatted_cron_data def parse_cron_file(self, cron_file_path): """ Given a cron file return its contents in a list of dict :param cron_file_path: :return: formatted_cron_data dict """ formatted_cron_data = [] if self.is_valid_file_path(cron_file_path): cron_data = self.get_cron_data(cron_file_path) parsed_cron_data = self.parse_cron_data(cron_data) formatted_cron_data = self.format_cron_data(parsed_cron_data) return formatted_cron_data def is_valid_file_path(self, cron_file_path): """ Check if the cron file exists / path is valid :param cron_file_path: :return: """ is_valid = False if os.path.isfile(cron_file_path): is_valid = True return is_valid def get_cron_data(self, cron_file_path): """ Read in a cron file :param cron_file_path: :return: list of cron config strings """ cron_data = [] try: with open(cron_file_path, u'r') as cron_file: for cron_config in cron_file: if cron_config and len(cron_config) > 5: cron_data.append(cron_config.strip(u'\n')) except IOError as e: if self.logger: self.logger.error(u'Could not read cron file %s', e) return cron_data def parse_cron_data(self, cron_data): """ Parse and separate config string into constituent parts :param cron_data: :return list of lists of cron data """ parsed_cron_data = [] for cron_config in cron_data: try: cron_parts = cron_config.strip().split() parsed_cron_data.append(cron_parts) except ValueError as e: if self.logger: self.logger.warning(u'Malformed cron config %s', e) return parsed_cron_data def format_cron_data(self, cron_data): """ Put data into a desired list of dicts format :param cron_data: :return: structured list of dicts """ formatted_cron_data = [] for data in cron_data: try: format_data = { u'minute': self.validate_in_range(data[0], 0, 59), u'hour': self.validate_in_range(data[1], 0, 23), u'path': data[2] } formatted_cron_data.append(format_data) except IndexError as e: if self.logger: self.logger.error(u'Malformed cron entry %s', e) return formatted_cron_data def validate_in_range(self, value, low, high): """ Check a value is in range or return None :param number: :param low: :param high: :return: """ validated = None try: if low <= int(value) <= high: validated = int(value) except ValueError: # Is usually '*' if value == u'*': validated = u'*' return validated
ian-wilson/cron-admin
nextrun/cron_parser.py
Python
mit
3,747
# Spiel.py import pygame from pygame.locals import * class Spiel(object): def __init__(self): self.Datum = "01-01" self.Takt = 0 def Zyklus_Morgen_Schule(self):
Aurora-Beta/VinVG
experiments/spiel.py
Python
mit
175
# Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. # pylint: disable=eval-used,invalid-name,too-many-arguments """Utility functions""" import tvm from tvm import relay from tvm.relay import transform def has_multiple_inputs(node_list, node_idx, input_names, opt_out_op): """Check whether a node has multiple input nodes except variable nodes. Parameters ---------- node_list : list of dict of str to object List of all nodes in a graph. node_idx : int Node index to be checked. input_names : list of str List of input names of graph. Returns ------- out : bool Whether the specified node has multiple input nodes """ num_inputs = 0 node = node_list[node_idx] for in_idx in node["inputs"]: in_idx = in_idx[0] in_node = node_list[in_idx] # Exclude parameter nodes if in_node["op"] is not None and in_node["op"].name in opt_out_op: increase = False for t_idx in in_node["inputs"]: increase = has_multiple_inputs(node_list, t_idx[0], input_names, opt_out_op) if increase: num_inputs += 1 elif in_node["op"] is not None or ("name" in in_node and in_node["name"] in input_names): num_inputs += 1 return num_inputs > 1 def is_boundary_node(node_entry, input_names): """Whether a node is a boundary node. Currently input node and nodes in LAYOUT_FIXED_OP are counted as boundary. Parameters ---------- node_entry : dict Node entry. input_names : list of str List of input names of graph. Returns ------- out : bool whether node is a boundary node. """ # Operators dependent on original layouts. _LAYOUT_FIXED_OP = [ relay.op.get(name) for name in ( "nn.batch_flatten", "transpose", "reshape", "vision.multibox_prior", "vision.multibox_transform_loc", "where", "vision.non_max_suppression", "strided_slice", ) ] out = node_entry["op"] in _LAYOUT_FIXED_OP or ( "name" in node_entry and node_entry["name"] in input_names ) return out def is_skipped_node(node_entry): """Whether a node is not counted. Parameters ---------- node_entry : dict Node entry. Returns ------- out : bool whether node is skipped. """ # Operators not counted in graph tuner. return isinstance(node_entry["node"], relay.Tuple) def bind_inputs(expr, input_shapes=None, input_dtypes="float32"): """Bind input variables of a relay function expression to new shapes and/or dtypes. Parameters ---------- expr : tvm.relay.Expr.Function Input relay function expression. input_shapes : dict of str to tuple of int, optional Input shapes. input_dtypes : str or dict of str to str, optional Input dtypes. Returns ------- out : tvm.relay.Expr.Function Bind relay function expression. """ if input_shapes is None: return expr if isinstance(input_dtypes, str): input_dtypes = {key: input_dtypes for key in input_shapes.keys()} updated_input_dict = {} for input_name in input_shapes.keys(): updated_input = relay.var( input_name, shape=input_shapes[input_name], dtype=input_dtypes[input_name] ) updated_input_dict[input_name] = updated_input rebind_dict = {} for var in expr.params: if var.name_hint in updated_input_dict: rebind_dict[var] = updated_input_dict[var.name_hint] updated_expr = relay.expr.bind(expr, rebind_dict) mod = tvm.IRModule.from_expr(updated_expr) mod = transform.InferType()(mod) entry = mod["main"] return entry if isinstance(updated_expr, relay.Function) else entry.body
Laurawly/tvm-1
python/tvm/autotvm/graph_tuner/utils/utils.py
Python
apache-2.0
4,682
version='alpha9' version_info = (0,0,9)
chaomodus/pixywerk
pixywerk/version.py
Python
mit
40
from setuptools import setup, find_packages setup(name='MODEL6399676120', version=20140916, description='MODEL6399676120 from BioModels', url='http://www.ebi.ac.uk/biomodels-main/MODEL6399676120', maintainer='Stanley Gu', maintainer_url='[email protected]', packages=find_packages(), package_data={'': ['*.xml', 'README.md']}, )
biomodels/MODEL6399676120
setup.py
Python
cc0-1.0
377
# -*- coding: utf-8 -*- """ test_dirtools.py - Test the dirtools module with pyfakefs. """ import shutil import unittest import os import tarfile import time try: import fake_filesystem import fake_filesystem_shutil except ImportError: print "You must install pyfakefs in order to run the test suite." import dirtools class TestDirtools(unittest.TestCase): def setUp(self): """ Initialize a fake filesystem and dirtools. """ # First we create a fake filesystem in order to test dirtools fk = fake_filesystem.FakeFilesystem() fk.CreateDirectory('/test_dirtools') fk.CreateFile('/test_dirtools/file1', contents='contents1') fk.CreateFile('/test_dirtools/file2', contents='contents2') fk.CreateFile('/test_dirtools/file3.py', contents='print "ok"') fk.CreateFile('/test_dirtools/file3.pyc', contents='') fk.CreateFile('/test_dirtools/.exclude', contents='excluded_dir/\n*.pyc') fk.CreateDirectory('/test_dirtools/excluded_dir') fk.CreateFile('/test_dirtools/excluded_dir/excluded_file', contents='excluded') fk.CreateDirectory('/test_dirtools/dir1') fk.CreateDirectory('/test_dirtools/dir1/subdir1') fk.CreateFile('/test_dirtools/dir1/subdir1/file_subdir1', contents='inside subdir1') fk.CreateFile('/test_dirtools/dir1/subdir1/.project') fk.CreateDirectory('/test_dirtools/dir2') fk.CreateFile('/test_dirtools/dir2/file_dir2', contents='inside dir2') # Sort of "monkey patch" to make dirtools use the fake filesystem dirtools.os = fake_filesystem.FakeOsModule(fk) dirtools.open = fake_filesystem.FakeFileOpen(fk) # Dirtools initialization self.dir = dirtools.Dir('/test_dirtools') self.os = dirtools.os self.open = dirtools.open self.shutil = fake_filesystem_shutil.FakeShutilModule(fk) self.fk = fk def testFiles(self): """ Check that Dir.files return all files, except those excluded. """ self.assertEqual(sorted(self.dir.files()), sorted(["file1", "file2", "file3.py", ".exclude", "dir1/subdir1/file_subdir1", "dir1/subdir1/.project", "dir2/file_dir2"])) def testFilesWithPatterns(self): """ Check that Dir.files return all files matching the pattern, except those excluded. """ self.assertEqual(sorted(self.dir.files("*.py")), sorted(["file3.py"])) self.assertEqual(sorted(self.dir.files("*_dir2")), sorted(["dir2/file_dir2"])) def testSubdirs(self): """ Check that Dir.subdirs return all subdirs, except those excluded. """ self.assertEqual(sorted(self.dir.subdirs()), sorted(["dir1", "dir1/subdir1", "dir2"])) def testSubdirsWithPatterns(self): """ Check that Dir.subdirs return all subdirs matching the pattern, except those excluded. """ self.assertEqual(sorted(self.dir.subdirs("*1")), sorted(["dir1", "dir1/subdir1"])) def testHashdir(self): """ Check that the hashdir changes when a file change in the tree. """ hashdir = self.dir.hash(dirtools.filehash) with self.open('/test_dirtools/file2', 'w') as f: f.write("new content") new_hashdir = self.dir.hash(dirtools.filehash) self.assertNotEqual(hashdir, new_hashdir) def testDirState(self): dir_state = dirtools.DirState(self.dir, index_cmp=dirtools.filehash) self.shutil.copytree('/test_dirtools', 'test_dirtools2') with self.open('/test_dirtools2/dir1/subdir1/file_subdir1', 'w') as f: f.write("dir state") with self.open('/test_dirtools2/new_file', 'w') as f: f.write("dir state") self.os.remove('/test_dirtools2/file1') self.shutil.rmtree('/test_dirtools2/dir2') dir_state2 = dirtools.DirState(dirtools.Dir('/test_dirtools2'), index_cmp=dirtools.filehash) diff = dir_state2 - dir_state self.assertEqual(diff, {'deleted': ['file1', 'dir2/file_dir2'], 'updated': ['dir1/subdir1/file_subdir1'], 'deleted_dirs': ['dir2'], 'created': ['new_file']}) self.assertEqual(diff, dirtools.compute_diff(dir_state2.state, dir_state.state)) def testExclude(self): """ Check that Dir.is_excluded actually exclude files. """ self.assertTrue(self.dir.is_excluded("excluded_dir")) # Only the dir is excluded, the exclude line is excluded_dir/ not excluded_dir/* self.assertFalse(self.dir.is_excluded("excluded_dir/excluded_file")) self.assertTrue(self.dir.is_excluded("file3.pyc")) self.assertFalse(self.dir.is_excluded("file3.py")) def testProjects(self): """ Check if Dir.find_projects find all projects in the directory tree. """ self.assertEqual(self.dir.find_projects(".project"), ['dir1/subdir1']) def testCompression(self): """ Check the compression, withouth pyfakefs because it doesn't support tarfile. """ dirtools.os = os dirtools.open = open test_dir = '/tmp/test_dirtools' if os.path.isdir(test_dir): shutil.rmtree(test_dir) os.mkdir(test_dir) with open(os.path.join(test_dir, 'file1'), 'w') as f: f.write(os.urandom(2 ** 10)) with open(os.path.join(test_dir, 'file2.pyc'), 'w') as f: f.write('excluded') os.mkdir(os.path.join(test_dir, 'dir1')) with open(os.path.join(test_dir, 'dir1/file1'), 'w') as f: f.write(os.urandom(2 ** 10)) cdir = dirtools.Dir(test_dir) archive_path = cdir.compress_to() tar = tarfile.open(archive_path) test_dir_extract = '/tmp/test_dirtools_extract' if os.path.isdir(test_dir_extract): shutil.rmtree(test_dir_extract) os.mkdir(test_dir_extract) tar.extractall(test_dir_extract) extracted_dir = dirtools.Dir(test_dir_extract) self.assertEqual(sorted(extracted_dir.files()), sorted(cdir.files())) self.assertEqual(sorted(extracted_dir.subdirs()), sorted(cdir.subdirs())) self.assertEqual(extracted_dir.hash(dirtools.filehash), cdir.hash(dirtools.filehash)) shutil.rmtree(test_dir) shutil.rmtree(test_dir_extract) os.remove(archive_path) if __name__ == '__main__': unittest.main()
tsileo/dirtools
test_dirtools.py
Python
mit
6,852
# -*- coding: utf-8 -*- # # Copyright 2015 Federico Ficarelli # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from setuptools import setup import glob import os import sys if __name__ == "__main__": DIRNAME = os.path.abspath(os.path.dirname(__file__)) if DIRNAME: os.chdir(DIRNAME) try: py_dirname = DIRNAME sys.path.insert(0, py_dirname) import observer version = observer.__version__ finally: del sys.path[0] # search executables scripts = [] for filepath in glob.glob('bin/*'): if os.path.isfile(filepath) and os.access(filepath, os.X_OK): scripts.append(filepath) # search packages root_packages = [] packages = [] for package in root_packages: package_dirname = os.path.join(DIRNAME, package) for dirpath, dirnames, filenames in os.walk(package_dirname): if '__init__.py' in filenames: rdirpath = os.path.relpath(dirpath, DIRNAME) packages.append(os.path.normpath(rdirpath).replace(os.sep, '.')) setup( name="python-observer", version=version, requires=[], description="Python Observer Pattern", author="Federico Ficarelli", author_email="[email protected]", install_requires=(), package_data={}, url="https://nazavode.github.io", packages=packages, scripts=scripts, py_modules=['observer'], classifiers=[ # status: # 3 - Alpha # 4 - Beta # 5 - Production/Stable 'Development Status :: 4 - Beta', # audience: 'Intended Audience :: Developers', 'Topic :: Software Development :: Libraries :: Python Modules', # license: 'License :: OSI Approved :: Apache Software License', # language: 'Programming Language :: Python :: 3.4', 'Programming Language :: Python :: 2.7', ], keywords='observer design pattern', )
nazavode/observer
setup.py
Python
apache-2.0
2,604
# -*- coding: utf-8 -*- def social_eyebrow(entity, argument): return True #- Fine Funzione -
Onirik79/aaritmud
src/socials/social_eyebrow.py
Python
gpl-2.0
98
# ---------------------------------------------------------------------- # Numenta Platform for Intelligent Computing (NuPIC) # Copyright (C) 2021, Numenta, Inc. Unless you have an agreement # with Numenta, Inc., for a separate license for this software code, the # following terms and conditions apply: # # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero Public License version 3 as # published by the Free Software Foundation. # # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. # See the GNU Affero Public License for more details. # # You should have received a copy of the GNU Affero Public License # along with this program. If not, see http://www.gnu.org/licenses. # # http://numenta.org/licenses/ # ---------------------------------------------------------------------- """ This module is used as a nupic.research.frameworks plugin entrypoint to vernon command line parser interface. Each nupic.research.framework willing to add command line arguments to vernon framework must implement two functions:: - get_parser : Returns preconfigured `argparse.ArgumentParser` class to be added to the main `argparse.ArgumentParser`. - process_args : Processes parsed arguments to modify config appropriately. See nupic.research.frameworks.vernon.parset_utils for more details """ import argparse import socket __all__ = [ "get_parser", "process_args", ] def get_parser(): """ Returns command line `argparse.ArgumentParser` with ray and ray tune command line arguments """ ray_parser = argparse.ArgumentParser( formatter_class=argparse.ArgumentDefaultsHelpFormatter, argument_default=argparse.SUPPRESS, add_help=False, ) ray_parser.add_argument("-s", "--with-server", action="store_true", help="Start Ray Tune API server") ray_parser.add_argument("--single_instance", action="store_true", help="Uses single instance run method") ray_parser.add_argument("--local-mode", action="store_true", help="Start ray in local mode. Useful for debugging") ray_parser.add_argument("-a", "--redis-address", help="redis address of an existing Ray server", default="{}:6379".format( socket.gethostbyname(socket.gethostname()) )) return ray_parser def process_args(args, config): """ Processes parsed arguments to modify config appropriately. :return: modified config or None to exit without running """ return config
numenta/nupic.research
packages/ray/src/nupic/research/frameworks/ray/command_line_args.py
Python
agpl-3.0
2,825
from datetime import datetime import numpy as np import pytest import pandas as pd from pandas import NaT, Series, Timestamp import pandas._testing as tm from pandas.core.internals.blocks import IntBlock class TestSeriesInternals: # GH 10265 def test_convert(self): # Tests: All to nans, coerce, true # Test coercion returns correct type s = Series(["a", "b", "c"]) results = s._convert(datetime=True, coerce=True) expected = Series([NaT] * 3) tm.assert_series_equal(results, expected) results = s._convert(numeric=True, coerce=True) expected = Series([np.nan] * 3) tm.assert_series_equal(results, expected) expected = Series([NaT] * 3, dtype=np.dtype("m8[ns]")) results = s._convert(timedelta=True, coerce=True) tm.assert_series_equal(results, expected) dt = datetime(2001, 1, 1, 0, 0) td = dt - datetime(2000, 1, 1, 0, 0) # Test coercion with mixed types s = Series(["a", "3.1415", dt, td]) results = s._convert(datetime=True, coerce=True) expected = Series([NaT, NaT, dt, NaT]) tm.assert_series_equal(results, expected) results = s._convert(numeric=True, coerce=True) expected = Series([np.nan, 3.1415, np.nan, np.nan]) tm.assert_series_equal(results, expected) results = s._convert(timedelta=True, coerce=True) expected = Series([NaT, NaT, NaT, td], dtype=np.dtype("m8[ns]")) tm.assert_series_equal(results, expected) # Test standard conversion returns original results = s._convert(datetime=True) tm.assert_series_equal(results, s) results = s._convert(numeric=True) expected = Series([np.nan, 3.1415, np.nan, np.nan]) tm.assert_series_equal(results, expected) results = s._convert(timedelta=True) tm.assert_series_equal(results, s) # test pass-through and non-conversion when other types selected s = Series(["1.0", "2.0", "3.0"]) results = s._convert(datetime=True, numeric=True, timedelta=True) expected = Series([1.0, 2.0, 3.0]) tm.assert_series_equal(results, expected) results = s._convert(True, False, True) tm.assert_series_equal(results, s) s = Series([datetime(2001, 1, 1, 0, 0), datetime(2001, 1, 1, 0, 0)], dtype="O") results = s._convert(datetime=True, numeric=True, timedelta=True) expected = Series([datetime(2001, 1, 1, 0, 0), datetime(2001, 1, 1, 0, 0)]) tm.assert_series_equal(results, expected) results = s._convert(datetime=False, numeric=True, timedelta=True) tm.assert_series_equal(results, s) td = datetime(2001, 1, 1, 0, 0) - datetime(2000, 1, 1, 0, 0) s = Series([td, td], dtype="O") results = s._convert(datetime=True, numeric=True, timedelta=True) expected = Series([td, td]) tm.assert_series_equal(results, expected) results = s._convert(True, True, False) tm.assert_series_equal(results, s) s = Series([1.0, 2, 3], index=["a", "b", "c"]) result = s._convert(numeric=True) tm.assert_series_equal(result, s) # force numeric conversion r = s.copy().astype("O") r["a"] = "1" result = r._convert(numeric=True) tm.assert_series_equal(result, s) r = s.copy().astype("O") r["a"] = "1." result = r._convert(numeric=True) tm.assert_series_equal(result, s) r = s.copy().astype("O") r["a"] = "garbled" result = r._convert(numeric=True) expected = s.copy() expected["a"] = np.nan tm.assert_series_equal(result, expected) # GH 4119, not converting a mixed type (e.g.floats and object) s = Series([1, "na", 3, 4]) result = s._convert(datetime=True, numeric=True) expected = Series([1, np.nan, 3, 4]) tm.assert_series_equal(result, expected) s = Series([1, "", 3, 4]) result = s._convert(datetime=True, numeric=True) tm.assert_series_equal(result, expected) # dates s = Series( [ datetime(2001, 1, 1, 0, 0), datetime(2001, 1, 2, 0, 0), datetime(2001, 1, 3, 0, 0), ] ) s2 = Series( [ datetime(2001, 1, 1, 0, 0), datetime(2001, 1, 2, 0, 0), datetime(2001, 1, 3, 0, 0), "foo", 1.0, 1, Timestamp("20010104"), "20010105", ], dtype="O", ) result = s._convert(datetime=True) expected = Series( [Timestamp("20010101"), Timestamp("20010102"), Timestamp("20010103")], dtype="M8[ns]", ) tm.assert_series_equal(result, expected) result = s._convert(datetime=True, coerce=True) tm.assert_series_equal(result, expected) expected = Series( [ Timestamp("20010101"), Timestamp("20010102"), Timestamp("20010103"), NaT, NaT, NaT, Timestamp("20010104"), Timestamp("20010105"), ], dtype="M8[ns]", ) result = s2._convert(datetime=True, numeric=False, timedelta=False, coerce=True) tm.assert_series_equal(result, expected) result = s2._convert(datetime=True, coerce=True) tm.assert_series_equal(result, expected) s = Series(["foo", "bar", 1, 1.0], dtype="O") result = s._convert(datetime=True, coerce=True) expected = Series([NaT] * 2 + [Timestamp(1)] * 2) tm.assert_series_equal(result, expected) # preserver if non-object s = Series([1], dtype="float32") result = s._convert(datetime=True, coerce=True) tm.assert_series_equal(result, s) # FIXME: dont leave commented-out # r = s.copy() # r[0] = np.nan # result = r._convert(convert_dates=True,convert_numeric=False) # assert result.dtype == 'M8[ns]' # dateutil parses some single letters into today's value as a date expected = Series([NaT]) for x in "abcdefghijklmnopqrstuvwxyz": s = Series([x]) result = s._convert(datetime=True, coerce=True) tm.assert_series_equal(result, expected) s = Series([x.upper()]) result = s._convert(datetime=True, coerce=True) tm.assert_series_equal(result, expected) def test_convert_no_arg_error(self): s = Series(["1.0", "2"]) msg = r"At least one of datetime, numeric or timedelta must be True\." with pytest.raises(ValueError, match=msg): s._convert() def test_convert_preserve_bool(self): s = Series([1, True, 3, 5], dtype=object) r = s._convert(datetime=True, numeric=True) e = Series([1, 1, 3, 5], dtype="i8") tm.assert_series_equal(r, e) def test_convert_preserve_all_bool(self): s = Series([False, True, False, False], dtype=object) r = s._convert(datetime=True, numeric=True) e = Series([False, True, False, False], dtype=bool) tm.assert_series_equal(r, e) def test_constructor_no_pandas_array(self): ser = pd.Series([1, 2, 3]) result = pd.Series(ser.array) tm.assert_series_equal(ser, result) assert isinstance(result._mgr.blocks[0], IntBlock) def test_astype_no_pandas_dtype(self): # https://github.com/pandas-dev/pandas/pull/24866 ser = pd.Series([1, 2], dtype="int64") # Don't have PandasDtype in the public API, so we use `.array.dtype`, # which is a PandasDtype. result = ser.astype(ser.array.dtype) tm.assert_series_equal(result, ser) def test_from_array(self): result = pd.Series(pd.array(["1H", "2H"], dtype="timedelta64[ns]")) assert result._mgr.blocks[0].is_extension is False result = pd.Series(pd.array(["2015"], dtype="datetime64[ns]")) assert result._mgr.blocks[0].is_extension is False def test_from_list_dtype(self): result = pd.Series(["1H", "2H"], dtype="timedelta64[ns]") assert result._mgr.blocks[0].is_extension is False result = pd.Series(["2015"], dtype="datetime64[ns]") assert result._mgr.blocks[0].is_extension is False def test_hasnans_uncached_for_series(): # GH#19700 idx = pd.Index([0, 1]) assert idx.hasnans is False assert "hasnans" in idx._cache ser = idx.to_series() assert ser.hasnans is False assert not hasattr(ser, "_cache") ser.iloc[-1] = np.nan assert ser.hasnans is True assert Series.hasnans.__doc__ == pd.Index.hasnans.__doc__
TomAugspurger/pandas
pandas/tests/series/test_internals.py
Python
bsd-3-clause
8,912
# Copyright (c) 2006 Nathan Binkert <[email protected]> # All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are # met: redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer; # redistributions in binary form must reproduce the above copyright # notice, this list of conditions and the following disclaimer in the # documentation and/or other materials provided with the distribution; # neither the name of the copyright holders nor the names of its # contributors may be used to endorse or promote products derived from # this software without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS # "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT # LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR # A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT # OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, # SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT # LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, # DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY # THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT # (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE # OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. class _neg_inf(object): '''This object always compares less than any other object''' def __repr__(self): return '<neg_inf>' def __lt__(self, other): return type(self) != type(other) def __le__(self, other): return True def __gt__(self, other): return False def __ge__(self, other): return type(self) == type(other) def __eq__(self, other): return type(self) == type(other) def __ne__(self, other): return type(self) != type(other) neg_inf = _neg_inf() class _pos_inf(object): '''This object always compares greater than any other object''' def __repr__(self): return '<pos_inf>' def __lt__(self, other): return False def __le__(self, other): return type(self) == type(other) def __gt__(self, other): return type(self) != type(other) def __ge__(self, other): return True def __eq__(self, other): return type(self) == type(other) def __ne__(self, other): return type(self) != type(other) pos_inf = _pos_inf() class Region(tuple): '''A region (range) of [start, end). This includes utility functions to compare overlap of regions.''' def __new__(cls, *args): if len(args) == 1: arg = args[0] if isinstance(arg, Region): return arg args = tuple(arg) if len(args) != 2: raise AttributeError, \ "Only one or two arguments allowed, %d provided" % (alen, ) return tuple.__new__(cls, args) def __repr__(self): return 'Region(%s, %s)' % (self[0], self[1]) @property def start(self): return self[0] @property def end(self): return self[1] def __contains__(self, other): '''other is region: True if self and other is fully contained within self. pos: True if other is within the region''' if isinstance(other, tuple): return self[0] <= other[0] and self[1] >= other[1] return self[0] <= other and other < self[1] def __eq__(self, other): '''other is region: True if self and other are identical. pos: True if other is within the region''' if isinstance(other, tuple): return self[0] == other[0] and self[1] == other[1] return self[0] <= other and other < self[1] # @param self is a region. # @param other is a region. # @return if self and other are not identical. def __ne__(self, other): '''other is region: true if they are not identical pos: True if other is not in the region''' if isinstance(other, tuple): return self[0] != other[0] or self[1] != other[1] return other < self[0] or self[1] <= other # @param self is a region. # @param other is a region. # @return if self is less than other and does not overlap self. def __lt__(self, other): "self completely left of other (cannot overlap)" if isinstance(other, tuple): return self[1] <= other[0] return self[1] <= other # @param self is a region. # @param other is a region. # @return if self is less than other. self may overlap other, # but not extend beyond the _end of other. def __le__(self, other): "self extends to the left of other (can overlap)" if isinstance(other, tuple): return self[0] <= other[0] return self[0] <= other # @param self is a region. # @param other is a region. # @return if self is greater than other and does not overlap other. def __gt__(self, other): "self is completely right of other (cannot overlap)" if isinstance(other, tuple): return self[0] >= other[1] return self[0] > other # @param self is a region. # @param other is a region. # @return if self is greater than other. self may overlap other, # but not extend beyond the beginning of other. def __ge__(self, other): "self ex_ends beyond other to the right (can overlap)" if isinstance(other, tuple): return self[1] >= other[1] return self[1] > other class Regions(object): '''A set of regions (ranges). Basically a region with holes. Includes utility functions to merge regions and figure out if something is in one of the regions.''' def __init__(self, *args): self.regions = [] self.extend(*args) def copy(self): copy = Regions() copy.regions.extend(self.regions) return copy def append(self, *args): self.regions.append(Region(*args)) def extend(self, *args): self.regions.extend(Region(a) for a in args) def __contains__(self, position): for region in self.regions: if position in region: return True return False def __len__(self): return len(self.regions) def __iand__(self, other): A = self.regions B = other.regions R = [] i = 0 j = 0 while i < len(self) and j < len(other): a = A[i] b = B[j] if a[1] <= b[0]: # A is completely before B. Skip A i += 1 elif a[0] <= b[0]: if a[1] <= b[1]: # A and B overlap with B not left of A and A not right of B R.append(Region(b[0], a[1])) # Advance A because nothing is left i += 1 if a[1] == b[1]: # Advance B too j += 1 else: # A and B overlap with B completely within the bounds of A R.append(Region(b[0], b[1])) # Advance only B because some of A may still be useful j += 1 elif b[1] <= a[0]: # B is completely before A. Skip B. j += 1 else: assert b[0] < a[0] if b[1] <= a[1]: # A and B overlap with A not left of B and B not right of A R.append(Region(a[0], b[1])) # Advance B because nothing is left j += 1 if a[1] == b[1]: # Advance A too i += 1 else: # A and B overlap with A completely within the bounds of B R.append(Region(a[0], a[1])) # Advance only A because some of B may still be useful i += 1 self.regions = R return self def __and__(self, other): result = self.copy() result &= other return result def __repr__(self): return 'Regions(%s)' % ([(r[0], r[1]) for r in self.regions], ) all_regions = Regions(Region(neg_inf, pos_inf)) if __name__ == '__main__': x = Regions(*((i, i + 1) for i in xrange(0,30,2))) y = Regions(*((i, i + 4) for i in xrange(0,30,5))) z = Region(6,7) n = Region(9,10) def test(left, right): print "%s == %s: %s" % (left, right, left == right) print "%s != %s: %s" % (left, right, left != right) print "%s < %s: %s" % (left, right, left < right) print "%s <= %s: %s" % (left, right, left <= right) print "%s > %s: %s" % (left, right, left > right) print "%s >= %s: %s" % (left, right, left >= right) print test(neg_inf, neg_inf) test(neg_inf, pos_inf) test(pos_inf, neg_inf) test(pos_inf, pos_inf) test(neg_inf, 0) test(neg_inf, -11111) test(neg_inf, 11111) test(0, neg_inf) test(-11111, neg_inf) test(11111, neg_inf) test(pos_inf, 0) test(pos_inf, -11111) test(pos_inf, 11111) test(0, pos_inf) test(-11111, pos_inf) test(11111, pos_inf) print x print y print x & y print z print 4 in x print 4 in z print 5 not in x print 6 not in z print z in y print n in y, n not in y
rjschof/gem5
util/style/region.py
Python
bsd-3-clause
9,612
from batch_iv_analysis.ivAnalyzer import ivAnalyzer import argparse def runCLI(analyzer,args): analyzer.setup() print ("Got args:", args) def handle_cli(): parser = argparse.ArgumentParser(description='Process some iv data.') parser.add_argument('-f', '--files', default=None, type=argparse.FileType('r'), help='File(s) to analyze.') parser.add_argument('-g', '--gui', default=False, action='store_true', help='Run with GUI.') parser.add_argument('-s', '--no-sloppy', dest='sloppyMath', default=True, action='store_false', help="Don't do sloppy math (slower).") parser.add_argument('-w', '--workers', default=0, type=int, help='Multiprocessing control. w=0 disables it. w>0 enables it with w workers.') args = parser.parse_args() if args.gui == False and args.files == None: raise(ValueError('Command line interface (cli) mode needs files to process')) a = ivAnalyzer(beFastAndSloppy=args.sloppyMath, poolWorkers=args.workers) if args.gui == False: runCLI(a,args) else: import batch_iv_analysis.gui as gui gui.runGUI(a,args) if __name__ == "__main__": handle_cli()
greysAcademicCode/batch-iv-analysis
batch_iv_analysis/cli.py
Python
mit
1,115
# # This file is part of pySMT. # # Copyright 2014 Andrea Micheli and Marco Gario # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # import unittest from pysmt.shortcuts import * from pysmt.typing import REAL, BOOL, INT from pysmt.test import (TestCase, skipIfSolverNotAvailable) from pysmt.exceptions import (SolverReturnedUnknownResultError, \ NoSolverAvailableError) from pysmt.logics import LRA, LIA, UFLIRA class TestInterpolation(TestCase): def test_selection(self): with self.assertRaises(NoSolverAvailableError): Interpolator(logic=UFLIRA) with self.assertRaises(NoSolverAvailableError): Interpolator(name="nonexistent") @skipIfSolverNotAvailable('z3') def test_binary_interpolant_z3(self): self._test_binary_interpolant('z3') @skipIfSolverNotAvailable('msat') def test_binary_interpolant_msat(self): self._test_binary_interpolant('msat') @skipIfSolverNotAvailable('z3') def test_sequence_interpolant_z3(self): self._test_sequence_interpolant('z3') @skipIfSolverNotAvailable('msat') def test_sequence_interpolant_msat(self): self._test_sequence_interpolant('msat') def _test_binary_interpolant(self, name): itp = Interpolator(name=name) self._bool_example(itp, True) self._real_example(itp, True) self._int_example(itp, True) def _test_sequence_interpolant(self, name): itp = Interpolator(name=name) self._bool_example(itp, False) self._real_example(itp, False) self._int_example(itp, False) def _bool_example(self, itp, binary): # Bool Example x, y, z = Symbol("bx"), Symbol("by"), Symbol("bz") a = And(x, Not(y)) b = And(Implies(z, y), z) if binary: i = itp.binary_interpolant(a, b) else: i = itp.sequence_interpolant([a, b]) self.assertTrue(i is not None) if not binary: self.assertTrue(hasattr(i, '__len__')) self.assertTrue(len(i) == 1) i = i[0] self.assertTrue(i.get_free_variables() == set([y])) self.assertValid(Implies(a, i)) self.assertUnsat(And(i, b)) def _real_example(self, itp, binary): # Real Example x, y, z = Symbol("rx", REAL), Symbol("ry", REAL), Symbol("rz", REAL) a = And(LE(x, Real(0)), LE(y, x)) b = And(GE(y, z), Equals(z, Real(1))) if binary: i = itp.binary_interpolant(a, b) else: i = itp.sequence_interpolant([a, b]) self.assertTrue(i is not None) if not binary: self.assertTrue(hasattr(i, '__len__')) self.assertTrue(len(i) == 1) i = i[0] self.assertTrue(i.get_free_variables() == set([y])) self.assertValid(Implies(a, i)) self.assertUnsat(And(i, b)) def _int_example(self, itp, binary): # Int Example x, y, z = Symbol("ix", INT), Symbol("iy", INT), Symbol("iz", INT) a = And(LE(x, Int(1)), LT(y, x)) b = And(GE(y, z), GT(z, Int(0))) if binary: i = itp.binary_interpolant(a, b) else: i = itp.sequence_interpolant([a, b]) self.assertTrue(i is not None) if not binary: self.assertTrue(hasattr(i, '__len__')) self.assertTrue(len(i) == 1) i = i[0] self.assertTrue(i.get_free_variables() == set([y])) self.assertValid(Implies(a, i)) self.assertUnsat(And(i, b)) if __name__ == '__main__': unittest.main()
idkwim/pysmt
pysmt/test/test_interpolation.py
Python
apache-2.0
4,190
# -*- coding: utf-8 -*- # # Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. from builtins import str from pyhive import presto from pyhive.exc import DatabaseError from airflow.hooks.dbapi_hook import DbApiHook class PrestoException(Exception): pass class PrestoHook(DbApiHook): """ Interact with Presto through PyHive! >>> ph = PrestoHook() >>> sql = "SELECT count(1) AS num FROM airflow.static_babynames" >>> ph.get_records(sql) [[340698]] """ conn_name_attr = 'presto_conn_id' default_conn_name = 'presto_default' def get_conn(self): """Returns a connection object""" db = self.get_connection(self.presto_conn_id) return presto.connect( host=db.host, port=db.port, username=db.login, catalog=db.extra_dejson.get('catalog', 'hive'), schema=db.schema) @staticmethod def _strip_sql(sql): return sql.strip().rstrip(';') @staticmethod def _get_pretty_exception_message(e): """ Parses some DatabaseError to provide a better error message """ if (hasattr(e, 'message') and 'errorName' in e.message and 'message' in e.message): return ('{name}: {message}'.format( name=e.message['errorName'], message=e.message['message'])) else: return str(e) def get_records(self, hql, parameters=None): """ Get a set of records from Presto """ try: return super(PrestoHook, self).get_records( self._strip_sql(hql), parameters) except DatabaseError as e: raise PrestoException(self._get_pretty_exception_message(e)) def get_first(self, hql, parameters=None): """ Returns only the first row, regardless of how many rows the query returns. """ try: return super(PrestoHook, self).get_first( self._strip_sql(hql), parameters) except DatabaseError as e: raise PrestoException(self._get_pretty_exception_message(e)) def get_pandas_df(self, hql, parameters=None): """ Get a pandas dataframe from a sql query. """ import pandas cursor = self.get_cursor() try: cursor.execute(self._strip_sql(hql), parameters) data = cursor.fetchall() except DatabaseError as e: raise PrestoException(self._get_pretty_exception_message(e)) column_descriptions = cursor.description if data: df = pandas.DataFrame(data) df.columns = [c[0] for c in column_descriptions] else: df = pandas.DataFrame() return df def run(self, hql, parameters=None): """ Execute the statement against Presto. Can be used to create views. """ return super(PrestoHook, self).run(self._strip_sql(hql), parameters) # TODO Enable commit_every once PyHive supports transaction. # Unfortunately, PyHive 0.5.1 doesn't support transaction for now, # whereas Presto 0.132+ does. def insert_rows(self, table, rows, target_fields=None): """ A generic way to insert a set of tuples into a table. :param table: Name of the target table :type table: str :param rows: The rows to insert into the table :type rows: iterable of tuples :param target_fields: The names of the columns to fill in the table :type target_fields: iterable of strings """ super(PrestoHook, self).insert_rows(table, rows, target_fields, 0)
sid88in/incubator-airflow
airflow/hooks/presto_hook.py
Python
apache-2.0
4,438
from django.dispatch import Signal location_created = Signal(providing_args=['loc']) location_edited = Signal(providing_args=['loc', 'moved'])
puttarajubr/commcare-hq
corehq/apps/locations/signals.py
Python
bsd-3-clause
144
from corehq.apps.commtrack.models import StockState from custom.ilsgateway.models import SupplyPointStatus, SupplyPointStatusValues, SupplyPointStatusTypes from custom.ilsgateway.tanzania.reminders import DELIVERY_PARTIAL_CONFIRM, NOT_DELIVERED_CONFIRM, \ DELIVERY_CONFIRM_DISTRICT, DELIVERY_CONFIRM_CHILDREN from custom.ilsgateway.tanzania.test.utils import ILSTestScript class ILSDeliveredTest(ILSTestScript): def setUp(self): super(ILSDeliveredTest, self).setUp() def test_delivery_facility_received_no_quantities_reported(self): script = """ 5551234 > delivered 5551234 < {0} """.format(DELIVERY_PARTIAL_CONFIRM) self.run_script(script) sps = SupplyPointStatus.objects.filter(location_id=self.loc1.get_id, status_type="del_fac").order_by("-status_date")[0] self.assertEqual(SupplyPointStatusValues.RECEIVED, sps.status_value) self.assertEqual(SupplyPointStatusTypes.DELIVERY_FACILITY, sps.status_type) def test_delivery_facility_received_quantities_reported(self): script = """ 5551234 > delivered jd 400 mc 569 5551234 < {0} """.format("received stock report for loc1(Test Facility 1) R jd400 mc569") self.run_script(script) self.assertEqual(2, StockState.objects.count()) for ps in StockState.objects.all(): self.assertEqual(self.loc1.linked_supply_point().get_id, ps.case_id) self.assertTrue(0 != ps.stock_on_hand) def test_delivery_facility_not_received(self): script = """ 5551234 > sijapokea 5551234 < {0} """.format(NOT_DELIVERED_CONFIRM) self.run_script(script) sps = SupplyPointStatus.objects.filter(location_id=self.loc1.get_id, status_type="del_fac").order_by("-status_date")[0] self.assertEqual(SupplyPointStatusValues.NOT_RECEIVED, sps.status_value) self.assertEqual(SupplyPointStatusTypes.DELIVERY_FACILITY, sps.status_type) def test_delivery_district_received(self): script = """ 555 > nimepokea 555 < {0} 5551234 < {1} 5555678 < {1} """.format(DELIVERY_CONFIRM_DISTRICT % dict(contact_name="{0} {1}".format(self.user_dis.first_name, self.user_dis.last_name), facility_name=self.dis.name), DELIVERY_CONFIRM_CHILDREN % dict(district_name=self.dis.name)) self.run_script(script) sps = SupplyPointStatus.objects.filter(location_id=self.dis.get_id, status_type="del_dist").order_by("-status_date")[0] self.assertEqual(SupplyPointStatusValues.RECEIVED, sps.status_value) self.assertEqual(SupplyPointStatusTypes.DELIVERY_DISTRICT, sps.status_type) def test_delivery_district_not_received(self): script = """ 555 > sijapokea 555 < {0} """.format(NOT_DELIVERED_CONFIRM) self.run_script(script) sps = SupplyPointStatus.objects.filter(location_id=self.dis.get_id, status_type="del_dist").order_by("-status_date")[0] self.assertEqual(SupplyPointStatusValues.NOT_RECEIVED, sps.status_value) self.assertEqual(SupplyPointStatusTypes.DELIVERY_DISTRICT, sps.status_type)
puttarajubr/commcare-hq
custom/ilsgateway/tanzania/test/delivered.py
Python
bsd-3-clause
3,569
"""Raw SNMP SMI module dumps. As dumped by smidump dump using the python format option. """ from __future__ import absolute_import from itertools import chain import importlib from django.utils import six from nav.config import NAV_CONFIG from nav.oids import OID _mib_map = {} def get_mib(mib_module): """Returns the smidumped MIB definition of a named MIB module, if it exists in NAV. """ if not mib_module: return None if mib_module not in _mib_map: for path in get_search_path(): try: name = '.' + mib_module if path else mib_module # support top namespace module = importlib.import_module(name, path) except ImportError: continue else: convert_oids(module.MIB) _mib_map[mib_module] = module break else: return None return _mib_map[mib_module].MIB def get_search_path(): """Returns the configured smidumps search path""" return NAV_CONFIG.get("SMIDUMPS", "nav.smidumps").split(':') def convert_oids(mib): """Converts a mib data structure's oid strings to OID objects. mib is expected to be a data structure as dumped by the smidump utility (using the -f python option). """ for node in chain( mib.get('nodes', {}).values(), mib.get('notifications', {}).values() ): if isinstance(node['oid'], six.string_types): node['oid'] = OID(node['oid'])
hmpf/nav
python/nav/smidumps/__init__.py
Python
gpl-3.0
1,524
import pickle import matplotlib.pyplot as plt import matplotlib.patches import matplotlib as mpl import numpy as np import sys, argparse sys.path.append("../") import Plotting colors=[ '#d7191c', '#fdae61', '#abd9e9', '#2c7bb6', ] Names = { 'mini_gb2': 'VC-GB2', 'mini_gb5': 'VC-GB5', 'mini_lin': 'VC-Lin', 'epsall_gb2': '$\epsilon$-GB2', 'epsall_gb5': '$\epsilon$-GB5', 'epsall_lin': '$\epsilon$-Lin', 'lin': 'LinUCB' } Styles = { 'mini_gb2': ['k', 'solid'], 'mini_gb5': [colors[1], 'solid'], 'mini_lin': [colors[0], 'solid'], 'epsall_gb2': ['k', 'dashed'], 'epsall_gb5': [colors[1], 'dashed'], 'epsall_lin': [colors[0], 'dashed'], 'lin': [colors[3], 'solid'] } marker=10 band=False parser = argparse.ArgumentParser() parser.add_argument('--save', dest='save', action='store_true') Args = parser.parse_args(sys.argv[1:]) D1 = Plotting.read_dir("../results/mslr30k_T=36000_L=3_e=0.1/") fig = plt.figure(figsize=(mpl.rcParams['figure.figsize'][0],mpl.rcParams['figure.figsize'][1]-1)) ax = fig.add_subplot(111) plt.rc('font', size=18) plt.rcParams['text.usetex'] = True plt.rc('font', family='sans-serif') ticks=ax.get_yticks() print(ticks) ax.set_ylim(2.15, 2.35) print("Setting ylim to %0.2f, %0.2f" % (ticks[3], ticks[len(ticks)-2])) ticks = ax.get_yticks() print(ticks) # ticks = ["", "", "2.2", "", "2.3", ""] # ax.set_yticklabels(ticks,size=16) ticks = ['', '', '10000', '', '20000', '', '30000'] ax.set_xlim(1000, 31000) ax.set_xticklabels(ticks,size=16) plt.ylabel('Average reward', fontsize=16) plt.xlabel('Rounds (T)', fontsize=16) # ax.tick_params(labelsize=16) plt.gcf().subplots_adjust(bottom=0.25) plt.savefig('../figs/mslr_blank.pdf', format='pdf') keys = ['epsall_lin', 'epsall_gb5'] for k in keys: params = [] mus = [] for (k1,v1) in D1[0].items(): if k1.find(k) == 0 and len(D1[0][k1]) != 0: x = np.arange(100, 10*len(D1[0][k1][0])+1, 100) mus.append(np.mean(D1[0][k1],axis=0)[9::10]/x) params.append(k1.split("_")[-1]) if len(mus) == 0: continue A = np.vstack(mus) ids = np.argmax(A, axis=0) mu = np.array([A[ids[i], i] for i in range(len(ids))]) if k == 'mini_gb5': mu = np.mean(D1[0]['mini_gb5_0.008'], axis=0)[9::10]/x l1 = ax.plot(x,mu,rasterized=True, linewidth=2.0, label=Names[k], color=Styles[k][0], linestyle=Styles[k][1]) plt.savefig('../figs/mslr_noninteractive.pdf', format='pdf') keys = ['mini_lin', 'mini_gb5', 'lin'] for k in keys: params = [] mus = [] for (k1,v1) in D1[0].items(): if k1.find(k) == 0 and len(D1[0][k1]) != 0: x = np.arange(100, 10*len(D1[0][k1][0])+1, 100) mus.append(np.mean(D1[0][k1],axis=0)[9::10]/x) params.append(k1.split("_")[-1]) if len(mus) == 0: continue A = np.vstack(mus) ids = np.argmax(A, axis=0) mu = np.array([A[ids[i], i] for i in range(len(ids))]) if k == 'mini_gb5': mu = np.mean(D1[0]['mini_gb5_0.008'], axis=0)[9::10]/x l1 = ax.plot(x,mu,rasterized=True, linewidth=5.0, label=Names[k], color=Styles[k][0], linestyle=Styles[k][1]) else: l1 = ax.plot(x,mu,rasterized=True, linewidth=2.0, label=Names[k], color=Styles[k][0], linestyle=Styles[k][1]) plt.savefig('../figs/mslr_all.pdf', format='pdf')
akshaykr/oracle_cb
semibandits/sequential_plot.py
Python
mit
3,374
#!/usr/bin/python import realog.debug as debug import lutin.tools as tools import os def get_type(): return "LIBRARY" def get_desc(): return "opencv Image processing library" def get_licence(): return "APAPCHE-2" def get_maintainer(): return ["Maksim Shabunin <[email protected]>"] def get_version(): return [3,1,0] def configure(target, my_module): my_module.add_src_file([ 'opencv/modules/superres/src/btv_l1_cuda.cpp', 'opencv/modules/superres/src/btv_l1.cpp', 'opencv/modules/superres/src/optical_flow.cpp', 'opencv/modules/superres/src/super_resolution.cpp', #'opencv/modules/superres/src/cuda/btv_l1_gpu.cu', 'opencv/modules/superres/src/input_array_utility.cpp', #'opencv/modules/superres/src/opencl/superres_btvl1.cl', 'opencv/modules/superres/src/frame_source.cpp', ]) my_module.add_flag('c++', [ "-DCVAPI_EXPORTS", "-D__OPENCV_BUILD=1", "-fsigned-char", "-W", "-Wall", "-Werror=return-type", "-Werror=non-virtual-dtor", "-Werror=address", "-Werror=sequence-point", "-Wformat", "-Werror=format-security", "-Wmissing-declarations", "-Winit-self", "-Wpointer-arith", "-Wshadow", "-Wsign-promo", "-Wno-narrowing", "-Wno-delete-non-virtual-dtor", "-fdiagnostics-show-option", "-Wno-long-long", "-fomit-frame-pointer", "-ffunction-sections", "-fvisibility=hidden", "-fvisibility-inlines-hidden", ]) my_module.add_header_file( "opencv/modules/superres/include/*", recursive=True) my_module.add_depend([ 'opencv-core', 'opencv-imgproc', 'opencv-video', ]) if "Android" in target.get_type(): my_module.add_flag('c++', "-DANDROID") my_module.compile_version("C++", 2003) return True
generic-library/opencv-lutin
lutin_opencv-superres.py
Python
apache-2.0
1,814
# Copyright 2010 United States Government as represented by the # Administrator of the National Aeronautics and Space Administration. # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. """Nova base exception handling. Includes decorator for re-raising Nova-type exceptions. SHOULD include dedicated exception logging. """ import functools import sys from oslo.config import cfg import webob.exc from nova.i18n import _ from nova.openstack.common import excutils from nova.openstack.common import log as logging from nova import safe_utils LOG = logging.getLogger(__name__) exc_log_opts = [ cfg.BoolOpt('fatal_exception_format_errors', default=False, help='Make exception message format errors fatal'), ] CONF = cfg.CONF CONF.register_opts(exc_log_opts) class ConvertedException(webob.exc.WSGIHTTPException): def __init__(self, code=0, title="", explanation=""): self.code = code self.title = title self.explanation = explanation super(ConvertedException, self).__init__() def _cleanse_dict(original): """Strip all admin_password, new_pass, rescue_pass keys from a dict.""" return dict((k, v) for k, v in original.iteritems() if "_pass" not in k) def wrap_exception(notifier=None, get_notifier=None): """This decorator wraps a method to catch any exceptions that may get thrown. It logs the exception as well as optionally sending it to the notification system. """ def inner(f): def wrapped(self, context, *args, **kw): # Don't store self or context in the payload, it now seems to # contain confidential information. try: return f(self, context, *args, **kw) except Exception as e: with excutils.save_and_reraise_exception(): if notifier or get_notifier: payload = dict(exception=e) call_dict = safe_utils.getcallargs(f, context, *args, **kw) cleansed = _cleanse_dict(call_dict) payload.update({'args': cleansed}) # If f has multiple decorators, they must use # functools.wraps to ensure the name is # propagated. event_type = f.__name__ (notifier or get_notifier()).error(context, event_type, payload) return functools.wraps(f)(wrapped) return inner class NovaException(Exception): """Base Nova Exception To correctly use this class, inherit from it and define a 'msg_fmt' property. That msg_fmt will get printf'd with the keyword arguments provided to the constructor. """ msg_fmt = _("An unknown exception occurred.") code = 500 headers = {} safe = False def __init__(self, message=None, **kwargs): self.kwargs = kwargs if 'code' not in self.kwargs: try: self.kwargs['code'] = self.code except AttributeError: pass if not message: try: message = self.msg_fmt % kwargs except Exception: exc_info = sys.exc_info() # kwargs doesn't match a variable in the message # log the issue and the kwargs LOG.exception(_('Exception in string format operation')) for name, value in kwargs.iteritems(): LOG.error("%s: %s" % (name, value)) # noqa if CONF.fatal_exception_format_errors: raise exc_info[0], exc_info[1], exc_info[2] else: # at least get the core message out if something happened message = self.msg_fmt super(NovaException, self).__init__(message) def format_message(self): # NOTE(mrodden): use the first argument to the python Exception object # which should be our full NovaException message, (see __init__) return self.args[0] class EncryptionFailure(NovaException): msg_fmt = _("Failed to encrypt text: %(reason)s") class DecryptionFailure(NovaException): msg_fmt = _("Failed to decrypt text: %(reason)s") class RevokeCertFailure(NovaException): msg_fmt = _("Failed to revoke certificate for %(project_id)s") class VirtualInterfaceCreateException(NovaException): msg_fmt = _("Virtual Interface creation failed") class VirtualInterfaceMacAddressException(NovaException): msg_fmt = _("Creation of virtual interface with " "unique mac address failed") class GlanceConnectionFailed(NovaException): msg_fmt = _("Connection to glance host %(host)s:%(port)s failed: " "%(reason)s") class CinderConnectionFailed(NovaException): msg_fmt = _("Connection to cinder host failed: %(reason)s") class Forbidden(NovaException): ec2_code = 'AuthFailure' msg_fmt = _("Not authorized.") code = 403 class AdminRequired(Forbidden): msg_fmt = _("User does not have admin privileges") class PolicyNotAuthorized(Forbidden): msg_fmt = _("Policy doesn't allow %(action)s to be performed.") class ImageNotActive(NovaException): # NOTE(jruzicka): IncorrectState is used for volumes only in EC2, # but it still seems like the most appropriate option. ec2_code = 'IncorrectState' msg_fmt = _("Image %(image_id)s is not active.") class ImageNotAuthorized(NovaException): msg_fmt = _("Not authorized for image %(image_id)s.") class Invalid(NovaException): msg_fmt = _("Unacceptable parameters.") code = 400 class InvalidBDM(Invalid): msg_fmt = _("Block Device Mapping is Invalid.") class InvalidBDMSnapshot(InvalidBDM): msg_fmt = _("Block Device Mapping is Invalid: " "failed to get snapshot %(id)s.") class InvalidBDMVolume(InvalidBDM): msg_fmt = _("Block Device Mapping is Invalid: " "failed to get volume %(id)s.") class InvalidBDMImage(InvalidBDM): msg_fmt = _("Block Device Mapping is Invalid: " "failed to get image %(id)s.") class InvalidBDMBootSequence(InvalidBDM): msg_fmt = _("Block Device Mapping is Invalid: " "Boot sequence for the instance " "and image/block device mapping " "combination is not valid.") class InvalidBDMLocalsLimit(InvalidBDM): msg_fmt = _("Block Device Mapping is Invalid: " "You specified more local devices than the " "limit allows") class InvalidBDMEphemeralSize(InvalidBDM): msg_fmt = _("Ephemeral disks requested are larger than " "the instance type allows.") class InvalidBDMSwapSize(InvalidBDM): msg_fmt = _("Swap drive requested is larger than instance type allows.") class InvalidBDMFormat(InvalidBDM): msg_fmt = _("Block Device Mapping is Invalid: " "%(details)s") class InvalidBDMForLegacy(InvalidBDM): msg_fmt = _("Block Device Mapping cannot " "be converted to legacy format. ") class InvalidBDMVolumeNotBootable(InvalidBDM): msg_fmt = _("Block Device %(id)s is not bootable.") class InvalidAttribute(Invalid): msg_fmt = _("Attribute not supported: %(attr)s") class ValidationError(Invalid): msg_fmt = "%(detail)s" class VolumeUnattached(Invalid): ec2_code = 'IncorrectState' msg_fmt = _("Volume %(volume_id)s is not attached to anything") class VolumeNotCreated(NovaException): msg_fmt = _("Volume %(volume_id)s did not finish being created" " even after we waited %(seconds)s seconds or %(attempts)s" " attempts.") class InvalidKeypair(Invalid): ec2_code = 'InvalidKeyPair.Format' msg_fmt = _("Keypair data is invalid: %(reason)s") class InvalidRequest(Invalid): msg_fmt = _("The request is invalid.") class InvalidInput(Invalid): msg_fmt = _("Invalid input received: %(reason)s") class InvalidVolume(Invalid): ec2_code = 'UnsupportedOperation' msg_fmt = _("Invalid volume: %(reason)s") class InvalidVolumeAccessMode(Invalid): msg_fmt = _("Invalid volume access mode: %(access_mode)s") class InvalidMetadata(Invalid): msg_fmt = _("Invalid metadata: %(reason)s") class InvalidMetadataSize(Invalid): msg_fmt = _("Invalid metadata size: %(reason)s") class InvalidPortRange(Invalid): ec2_code = 'InvalidParameterValue' msg_fmt = _("Invalid port range %(from_port)s:%(to_port)s. %(msg)s") class InvalidIpProtocol(Invalid): msg_fmt = _("Invalid IP protocol %(protocol)s.") class InvalidContentType(Invalid): msg_fmt = _("Invalid content type %(content_type)s.") class InvalidUnicodeParameter(Invalid): msg_fmt = _("Invalid Parameter: " "Unicode is not supported by the current database.") # Cannot be templated as the error syntax varies. # msg needs to be constructed when raised. class InvalidParameterValue(Invalid): ec2_code = 'InvalidParameterValue' msg_fmt = _("%(err)s") class InvalidAggregateAction(Invalid): msg_fmt = _("Cannot perform action '%(action)s' on aggregate " "%(aggregate_id)s. Reason: %(reason)s.") class InvalidGroup(Invalid): msg_fmt = _("Group not valid. Reason: %(reason)s") class InvalidSortKey(Invalid): msg_fmt = _("Sort key supplied was not valid.") class InvalidStrTime(Invalid): msg_fmt = _("Invalid datetime string: %(reason)s") class InstanceInvalidState(Invalid): msg_fmt = _("Instance %(instance_uuid)s in %(attr)s %(state)s. Cannot " "%(method)s while the instance is in this state.") class InstanceNotRunning(Invalid): msg_fmt = _("Instance %(instance_id)s is not running.") class InstanceNotInRescueMode(Invalid): msg_fmt = _("Instance %(instance_id)s is not in rescue mode") class InstanceNotRescuable(Invalid): msg_fmt = _("Instance %(instance_id)s cannot be rescued: %(reason)s") class InstanceNotReady(Invalid): msg_fmt = _("Instance %(instance_id)s is not ready") class InstanceSuspendFailure(Invalid): msg_fmt = _("Failed to suspend instance: %(reason)s") class InstanceResumeFailure(Invalid): msg_fmt = _("Failed to resume instance: %(reason)s") class InstancePowerOnFailure(Invalid): msg_fmt = _("Failed to power on instance: %(reason)s") class InstancePowerOffFailure(Invalid): msg_fmt = _("Failed to power off instance: %(reason)s") class InstanceRebootFailure(Invalid): msg_fmt = _("Failed to reboot instance: %(reason)s") class InstanceTerminationFailure(Invalid): msg_fmt = _("Failed to terminate instance: %(reason)s") class InstanceDeployFailure(Invalid): msg_fmt = _("Failed to deploy instance: %(reason)s") class MultiplePortsNotApplicable(Invalid): msg_fmt = _("Failed to launch instances: %(reason)s") class InvalidFixedIpAndMaxCountRequest(Invalid): msg_fmt = _("Failed to launch instances: %(reason)s") class ServiceUnavailable(Invalid): msg_fmt = _("Service is unavailable at this time.") class ComputeResourcesUnavailable(ServiceUnavailable): msg_fmt = _("Insufficient compute resources: %(reason)s.") class HypervisorUnavailable(NovaException): msg_fmt = _("Connection to the hypervisor is broken on host: %(host)s") class ComputeServiceUnavailable(ServiceUnavailable): msg_fmt = _("Compute service of %(host)s is unavailable at this time.") class ComputeServiceInUse(NovaException): msg_fmt = _("Compute service of %(host)s is still in use.") class UnableToMigrateToSelf(Invalid): msg_fmt = _("Unable to migrate instance (%(instance_id)s) " "to current host (%(host)s).") class InvalidHypervisorType(Invalid): msg_fmt = _("The supplied hypervisor type of is invalid.") class DestinationHypervisorTooOld(Invalid): msg_fmt = _("The instance requires a newer hypervisor version than " "has been provided.") class DestinationDiskExists(Invalid): msg_fmt = _("The supplied disk path (%(path)s) already exists, " "it is expected not to exist.") class InvalidDevicePath(Invalid): msg_fmt = _("The supplied device path (%(path)s) is invalid.") class DevicePathInUse(Invalid): msg_fmt = _("The supplied device path (%(path)s) is in use.") code = 409 class DeviceIsBusy(Invalid): msg_fmt = _("The supplied device (%(device)s) is busy.") class InvalidCPUInfo(Invalid): msg_fmt = _("Unacceptable CPU info: %(reason)s") class InvalidIpAddressError(Invalid): msg_fmt = _("%(address)s is not a valid IP v4/6 address.") class InvalidVLANTag(Invalid): msg_fmt = _("VLAN tag is not appropriate for the port group " "%(bridge)s. Expected VLAN tag is %(tag)s, " "but the one associated with the port group is %(pgroup)s.") class InvalidVLANPortGroup(Invalid): msg_fmt = _("vSwitch which contains the port group %(bridge)s is " "not associated with the desired physical adapter. " "Expected vSwitch is %(expected)s, but the one associated " "is %(actual)s.") class InvalidDiskFormat(Invalid): msg_fmt = _("Disk format %(disk_format)s is not acceptable") class InvalidDiskInfo(Invalid): msg_fmt = _("Disk info file is invalid: %(reason)s") class DiskInfoReadWriteFail(Invalid): msg_fmt = _("Failed to read or write disk info file: %(reason)s") class ImageUnacceptable(Invalid): msg_fmt = _("Image %(image_id)s is unacceptable: %(reason)s") class InstanceUnacceptable(Invalid): msg_fmt = _("Instance %(instance_id)s is unacceptable: %(reason)s") class InvalidEc2Id(Invalid): msg_fmt = _("Ec2 id %(ec2_id)s is unacceptable.") class InvalidUUID(Invalid): msg_fmt = _("Expected a uuid but received %(uuid)s.") class InvalidID(Invalid): msg_fmt = _("Invalid ID received %(id)s.") class ConstraintNotMet(NovaException): msg_fmt = _("Constraint not met.") code = 412 class NotFound(NovaException): msg_fmt = _("Resource could not be found.") code = 404 class AgentBuildNotFound(NotFound): msg_fmt = _("No agent-build associated with id %(id)s.") class AgentBuildExists(NovaException): msg_fmt = _("Agent-build with hypervisor %(hypervisor)s os %(os)s " "architecture %(architecture)s exists.") class VolumeNotFound(NotFound): ec2_code = 'InvalidVolume.NotFound' msg_fmt = _("Volume %(volume_id)s could not be found.") class VolumeBDMNotFound(NotFound): msg_fmt = _("No volume Block Device Mapping with id %(volume_id)s.") class SnapshotNotFound(NotFound): ec2_code = 'InvalidSnapshot.NotFound' msg_fmt = _("Snapshot %(snapshot_id)s could not be found.") class DiskNotFound(NotFound): msg_fmt = _("No disk at %(location)s") class VolumeDriverNotFound(NotFound): msg_fmt = _("Could not find a handler for %(driver_type)s volume.") class InvalidImageRef(Invalid): msg_fmt = _("Invalid image href %(image_href)s.") class AutoDiskConfigDisabledByImage(Invalid): msg_fmt = _("Requested image %(image)s " "has automatic disk resize disabled.") class ImageNotFound(NotFound): msg_fmt = _("Image %(image_id)s could not be found.") class PreserveEphemeralNotSupported(Invalid): msg_fmt = _("The current driver does not support " "preserving ephemeral partitions.") # NOTE(jruzicka): ImageNotFound is not a valid EC2 error code. class ImageNotFoundEC2(ImageNotFound): msg_fmt = _("Image %(image_id)s could not be found. The nova EC2 API " "assigns image ids dynamically when they are listed for the " "first time. Have you listed image ids since adding this " "image?") class ProjectNotFound(NotFound): msg_fmt = _("Project %(project_id)s could not be found.") class StorageRepositoryNotFound(NotFound): msg_fmt = _("Cannot find SR to read/write VDI.") class NetworkDuplicated(Invalid): msg_fmt = _("Network %(network_id)s is duplicated.") class NetworkInUse(NovaException): msg_fmt = _("Network %(network_id)s is still in use.") class NetworkNotCreated(Invalid): msg_fmt = _("%(req)s is required to create a network.") class LabelTooLong(Invalid): msg_fmt = _("Maximum allowed length for 'label' is 255.") class InvalidIntValue(Invalid): msg_fmt = _("%(key)s must be an integer.") class InvalidCidr(Invalid): msg_fmt = _("%(cidr)s is not a valid ip network.") class InvalidAddress(Invalid): msg_fmt = _("%(address)s is not a valid ip address.") class AddressOutOfRange(Invalid): msg_fmt = _("%(address)s is not within %(cidr)s.") class DuplicateVlan(NovaException): msg_fmt = _("Detected existing vlan with id %(vlan)d") code = 409 class CidrConflict(NovaException): msg_fmt = _('Requested cidr (%(cidr)s) conflicts ' 'with existing cidr (%(other)s)') code = 409 class NetworkHasProject(NetworkInUse): msg_fmt = _('Network must be disassociated from project ' '%(project_id)s before it can be deleted.') class NetworkNotFound(NotFound): msg_fmt = _("Network %(network_id)s could not be found.") class PortNotFound(NotFound): msg_fmt = _("Port id %(port_id)s could not be found.") class NetworkNotFoundForBridge(NetworkNotFound): msg_fmt = _("Network could not be found for bridge %(bridge)s") class NetworkNotFoundForUUID(NetworkNotFound): msg_fmt = _("Network could not be found for uuid %(uuid)s") class NetworkNotFoundForCidr(NetworkNotFound): msg_fmt = _("Network could not be found with cidr %(cidr)s.") class NetworkNotFoundForInstance(NetworkNotFound): msg_fmt = _("Network could not be found for instance %(instance_id)s.") class NoNetworksFound(NotFound): msg_fmt = _("No networks defined.") class NoMoreNetworks(NovaException): msg_fmt = _("No more available networks.") class NetworkNotFoundForProject(NotFound): msg_fmt = _("Either network uuid %(network_uuid)s is not present or " "is not assigned to the project %(project_id)s.") class NetworkAmbiguous(Invalid): msg_fmt = _("More than one possible network found. Specify " "network ID(s) to select which one(s) to connect to,") class NetworkRequiresSubnet(Invalid): msg_fmt = _("Network %(network_uuid)s requires a subnet in order to boot" " instances on.") class ExternalNetworkAttachForbidden(Forbidden): msg_fmt = _("It is not allowed to create an interface on " "external network %(network_uuid)s") class NetworkMissingPhysicalNetwork(NovaException): msg_fmt = _("Physical network is missing for network %(network_uuid)s") class DatastoreNotFound(NotFound): msg_fmt = _("Could not find the datastore reference(s) which the VM uses.") class PortInUse(Invalid): msg_fmt = _("Port %(port_id)s is still in use.") class PortRequiresFixedIP(Invalid): msg_fmt = _("Port %(port_id)s requires a FixedIP in order to be used.") class PortNotUsable(Invalid): msg_fmt = _("Port %(port_id)s not usable for instance %(instance)s.") class PortNotFree(Invalid): msg_fmt = _("No free port available for instance %(instance)s.") class FixedIpExists(NovaException): msg_fmt = _("Fixed ip %(address)s already exists.") class FixedIpNotFound(NotFound): msg_fmt = _("No fixed IP associated with id %(id)s.") class FixedIpNotFoundForAddress(FixedIpNotFound): msg_fmt = _("Fixed ip not found for address %(address)s.") class FixedIpNotFoundForInstance(FixedIpNotFound): msg_fmt = _("Instance %(instance_uuid)s has zero fixed ips.") class FixedIpNotFoundForNetworkHost(FixedIpNotFound): msg_fmt = _("Network host %(host)s has zero fixed ips " "in network %(network_id)s.") class FixedIpNotFoundForSpecificInstance(FixedIpNotFound): msg_fmt = _("Instance %(instance_uuid)s doesn't have fixed ip '%(ip)s'.") class FixedIpNotFoundForNetwork(FixedIpNotFound): msg_fmt = _("Fixed IP address (%(address)s) does not exist in " "network (%(network_uuid)s).") class FixedIpAlreadyInUse(NovaException): msg_fmt = _("Fixed IP address %(address)s is already in use on instance " "%(instance_uuid)s.") class FixedIpAssociatedWithMultipleInstances(NovaException): msg_fmt = _("More than one instance is associated with fixed ip address " "'%(address)s'.") class FixedIpInvalid(Invalid): msg_fmt = _("Fixed IP address %(address)s is invalid.") class NoMoreFixedIps(NovaException): ec2_code = 'UnsupportedOperation' msg_fmt = _("Zero fixed ips available.") class NoFixedIpsDefined(NotFound): msg_fmt = _("Zero fixed ips could be found.") class FloatingIpExists(NovaException): msg_fmt = _("Floating ip %(address)s already exists.") class FloatingIpNotFound(NotFound): ec2_code = "UnsupportedOperation" msg_fmt = _("Floating ip not found for id %(id)s.") class FloatingIpDNSExists(Invalid): msg_fmt = _("The DNS entry %(name)s already exists in domain %(domain)s.") class FloatingIpNotFoundForAddress(FloatingIpNotFound): msg_fmt = _("Floating ip not found for address %(address)s.") class FloatingIpNotFoundForHost(FloatingIpNotFound): msg_fmt = _("Floating ip not found for host %(host)s.") class FloatingIpMultipleFoundForAddress(NovaException): msg_fmt = _("Multiple floating ips are found for address %(address)s.") class FloatingIpPoolNotFound(NotFound): msg_fmt = _("Floating ip pool not found.") safe = True class NoMoreFloatingIps(FloatingIpNotFound): msg_fmt = _("Zero floating ips available.") safe = True class FloatingIpAssociated(NovaException): ec2_code = "UnsupportedOperation" msg_fmt = _("Floating ip %(address)s is associated.") class FloatingIpNotAssociated(NovaException): msg_fmt = _("Floating ip %(address)s is not associated.") class NoFloatingIpsDefined(NotFound): msg_fmt = _("Zero floating ips exist.") class NoFloatingIpInterface(NotFound): ec2_code = "UnsupportedOperation" msg_fmt = _("Interface %(interface)s not found.") class CannotDisassociateAutoAssignedFloatingIP(NovaException): ec2_code = "UnsupportedOperation" msg_fmt = _("Cannot disassociate auto assigned floating ip") class KeypairNotFound(NotFound): ec2_code = 'InvalidKeyPair.NotFound' msg_fmt = _("Keypair %(name)s not found for user %(user_id)s") class ServiceNotFound(NotFound): msg_fmt = _("Service %(service_id)s could not be found.") class ServiceBinaryExists(NovaException): msg_fmt = _("Service with host %(host)s binary %(binary)s exists.") class ServiceTopicExists(NovaException): msg_fmt = _("Service with host %(host)s topic %(topic)s exists.") class HostNotFound(NotFound): msg_fmt = _("Host %(host)s could not be found.") class ComputeHostNotFound(HostNotFound): msg_fmt = _("Compute host %(host)s could not be found.") class ComputeHostNotCreated(HostNotFound): msg_fmt = _("Compute host %(name)s needs to be created first" " before updating.") class HostBinaryNotFound(NotFound): msg_fmt = _("Could not find binary %(binary)s on host %(host)s.") class InvalidReservationExpiration(Invalid): msg_fmt = _("Invalid reservation expiration %(expire)s.") class InvalidQuotaValue(Invalid): msg_fmt = _("Change would make usage less than 0 for the following " "resources: %(unders)s") class InvalidQuotaMethodUsage(Invalid): msg_fmt = _("Wrong quota method %(method)s used on resource %(res)s") class QuotaNotFound(NotFound): msg_fmt = _("Quota could not be found") class QuotaExists(NovaException): msg_fmt = _("Quota exists for project %(project_id)s, " "resource %(resource)s") class QuotaResourceUnknown(QuotaNotFound): msg_fmt = _("Unknown quota resources %(unknown)s.") class ProjectUserQuotaNotFound(QuotaNotFound): msg_fmt = _("Quota for user %(user_id)s in project %(project_id)s " "could not be found.") class ProjectQuotaNotFound(QuotaNotFound): msg_fmt = _("Quota for project %(project_id)s could not be found.") class QuotaClassNotFound(QuotaNotFound): msg_fmt = _("Quota class %(class_name)s could not be found.") class QuotaUsageNotFound(QuotaNotFound): msg_fmt = _("Quota usage for project %(project_id)s could not be found.") class ReservationNotFound(QuotaNotFound): msg_fmt = _("Quota reservation %(uuid)s could not be found.") class OverQuota(NovaException): msg_fmt = _("Quota exceeded for resources: %(overs)s") class SecurityGroupNotFound(NotFound): msg_fmt = _("Security group %(security_group_id)s not found.") class SecurityGroupNotFoundForProject(SecurityGroupNotFound): msg_fmt = _("Security group %(security_group_id)s not found " "for project %(project_id)s.") class SecurityGroupNotFoundForRule(SecurityGroupNotFound): msg_fmt = _("Security group with rule %(rule_id)s not found.") class SecurityGroupExists(Invalid): ec2_code = 'InvalidGroup.Duplicate' msg_fmt = _("Security group %(security_group_name)s already exists " "for project %(project_id)s.") class SecurityGroupExistsForInstance(Invalid): msg_fmt = _("Security group %(security_group_id)s is already associated" " with the instance %(instance_id)s") class SecurityGroupNotExistsForInstance(Invalid): msg_fmt = _("Security group %(security_group_id)s is not associated with" " the instance %(instance_id)s") class SecurityGroupDefaultRuleNotFound(Invalid): msg_fmt = _("Security group default rule (%rule_id)s not found.") class SecurityGroupCannotBeApplied(Invalid): msg_fmt = _("Network requires port_security_enabled and subnet associated" " in order to apply security groups.") class SecurityGroupRuleExists(Invalid): ec2_code = 'InvalidPermission.Duplicate' msg_fmt = _("Rule already exists in group: %(rule)s") class NoUniqueMatch(NovaException): msg_fmt = _("No Unique Match Found.") code = 409 class MigrationNotFound(NotFound): msg_fmt = _("Migration %(migration_id)s could not be found.") class MigrationNotFoundByStatus(MigrationNotFound): msg_fmt = _("Migration not found for instance %(instance_id)s " "with status %(status)s.") class ConsolePoolNotFound(NotFound): msg_fmt = _("Console pool %(pool_id)s could not be found.") class ConsolePoolExists(NovaException): msg_fmt = _("Console pool with host %(host)s, console_type " "%(console_type)s and compute_host %(compute_host)s " "already exists.") class ConsolePoolNotFoundForHostType(NotFound): msg_fmt = _("Console pool of type %(console_type)s " "for compute host %(compute_host)s " "on proxy host %(host)s not found.") class ConsoleNotFound(NotFound): msg_fmt = _("Console %(console_id)s could not be found.") class ConsoleNotFoundForInstance(ConsoleNotFound): msg_fmt = _("Console for instance %(instance_uuid)s could not be found.") class ConsoleNotFoundInPoolForInstance(ConsoleNotFound): msg_fmt = _("Console for instance %(instance_uuid)s " "in pool %(pool_id)s could not be found.") class ConsoleTypeInvalid(Invalid): msg_fmt = _("Invalid console type %(console_type)s") class ConsoleTypeUnavailable(Invalid): msg_fmt = _("Unavailable console type %(console_type)s.") class ConsolePortRangeExhausted(NovaException): msg_fmt = _("The console port range %(min_port)d-%(max_port)d is " "exhausted.") class FlavorNotFound(NotFound): msg_fmt = _("Flavor %(flavor_id)s could not be found.") class FlavorNotFoundByName(FlavorNotFound): msg_fmt = _("Flavor with name %(flavor_name)s could not be found.") class FlavorAccessNotFound(NotFound): msg_fmt = _("Flavor access not found for %(flavor_id)s / " "%(project_id)s combination.") class FlavorExtraSpecUpdateCreateFailed(NovaException): msg_fmt = _("Flavor %(id)d extra spec cannot be updated or created " "after %(retries)d retries.") class CellNotFound(NotFound): msg_fmt = _("Cell %(cell_name)s doesn't exist.") class CellExists(NovaException): msg_fmt = _("Cell with name %(name)s already exists.") class CellRoutingInconsistency(NovaException): msg_fmt = _("Inconsistency in cell routing: %(reason)s") class CellServiceAPIMethodNotFound(NotFound): msg_fmt = _("Service API method not found: %(detail)s") class CellTimeout(NotFound): msg_fmt = _("Timeout waiting for response from cell") class CellMaxHopCountReached(NovaException): msg_fmt = _("Cell message has reached maximum hop count: %(hop_count)s") class NoCellsAvailable(NovaException): msg_fmt = _("No cells available matching scheduling criteria.") class CellsUpdateUnsupported(NovaException): msg_fmt = _("Cannot update cells configuration file.") class InstanceUnknownCell(NotFound): msg_fmt = _("Cell is not known for instance %(instance_uuid)s") class SchedulerHostFilterNotFound(NotFound): msg_fmt = _("Scheduler Host Filter %(filter_name)s could not be found.") class FlavorExtraSpecsNotFound(NotFound): msg_fmt = _("Flavor %(flavor_id)s has no extra specs with " "key %(extra_specs_key)s.") class ComputeHostMetricNotFound(NotFound): msg_fmt = _("Metric %(name)s could not be found on the compute " "host node %(host)s.%(node)s.") class FileNotFound(NotFound): msg_fmt = _("File %(file_path)s could not be found.") class NoFilesFound(NotFound): msg_fmt = _("Zero files could be found.") class SwitchNotFoundForNetworkAdapter(NotFound): msg_fmt = _("Virtual switch associated with the " "network adapter %(adapter)s not found.") class NetworkAdapterNotFound(NotFound): msg_fmt = _("Network adapter %(adapter)s could not be found.") class ClassNotFound(NotFound): msg_fmt = _("Class %(class_name)s could not be found: %(exception)s") class NotAllowed(NovaException): msg_fmt = _("Action not allowed.") class ImageRotationNotAllowed(NovaException): msg_fmt = _("Rotation is not allowed for snapshots") class RotationRequiredForBackup(NovaException): msg_fmt = _("Rotation param is required for backup image_type") class KeyPairExists(NovaException): ec2_code = 'InvalidKeyPair.Duplicate' msg_fmt = _("Key pair '%(key_name)s' already exists.") class InstanceExists(NovaException): msg_fmt = _("Instance %(name)s already exists.") class FlavorExists(NovaException): msg_fmt = _("Flavor with name %(name)s already exists.") class FlavorIdExists(NovaException): msg_fmt = _("Flavor with ID %(flavor_id)s already exists.") class FlavorAccessExists(NovaException): msg_fmt = _("Flavor access already exists for flavor %(flavor_id)s " "and project %(project_id)s combination.") class InvalidSharedStorage(NovaException): msg_fmt = _("%(path)s is not on shared storage: %(reason)s") class InvalidLocalStorage(NovaException): msg_fmt = _("%(path)s is not on local storage: %(reason)s") class StorageError(NovaException): msg_fmt = _("Storage error: %(reason)s") class MigrationError(NovaException): msg_fmt = _("Migration error: %(reason)s") class MigrationPreCheckError(MigrationError): msg_fmt = _("Migration pre-check error: %(reason)s") class MalformedRequestBody(NovaException): msg_fmt = _("Malformed message body: %(reason)s") # NOTE(johannes): NotFound should only be used when a 404 error is # appropriate to be returned class ConfigNotFound(NovaException): msg_fmt = _("Could not find config at %(path)s") class PasteAppNotFound(NovaException): msg_fmt = _("Could not load paste app '%(name)s' from %(path)s") class CannotResizeToSameFlavor(NovaException): msg_fmt = _("When resizing, instances must change flavor!") class ResizeError(NovaException): msg_fmt = _("Resize error: %(reason)s") class CannotResizeDisk(NovaException): msg_fmt = _("Server disk was unable to be resized because: %(reason)s") class FlavorMemoryTooSmall(NovaException): msg_fmt = _("Flavor's memory is too small for requested image.") class FlavorDiskTooSmall(NovaException): msg_fmt = _("Flavor's disk is too small for requested image.") class InsufficientFreeMemory(NovaException): msg_fmt = _("Insufficient free memory on compute node to start %(uuid)s.") class NoValidHost(NovaException): msg_fmt = _("No valid host was found. %(reason)s") class QuotaError(NovaException): ec2_code = 'ResourceLimitExceeded' msg_fmt = _("Quota exceeded: code=%(code)s") # NOTE(cyeoh): 413 should only be used for the ec2 API # The error status code for out of quota for the nova api should be # 403 Forbidden. code = 413 headers = {'Retry-After': 0} safe = True class TooManyInstances(QuotaError): msg_fmt = _("Quota exceeded for %(overs)s: Requested %(req)s," " but already used %(used)d of %(allowed)d %(resource)s") class FloatingIpLimitExceeded(QuotaError): msg_fmt = _("Maximum number of floating ips exceeded") class FixedIpLimitExceeded(QuotaError): msg_fmt = _("Maximum number of fixed ips exceeded") class MetadataLimitExceeded(QuotaError): msg_fmt = _("Maximum number of metadata items exceeds %(allowed)d") class OnsetFileLimitExceeded(QuotaError): msg_fmt = _("Personality file limit exceeded") class OnsetFilePathLimitExceeded(OnsetFileLimitExceeded): msg_fmt = _("Personality file path too long") class OnsetFileContentLimitExceeded(OnsetFileLimitExceeded): msg_fmt = _("Personality file content too long") class KeypairLimitExceeded(QuotaError): msg_fmt = _("Maximum number of key pairs exceeded") class SecurityGroupLimitExceeded(QuotaError): ec2_code = 'SecurityGroupLimitExceeded' msg_fmt = _("Maximum number of security groups or rules exceeded") class PortLimitExceeded(QuotaError): msg_fmt = _("Maximum number of ports exceeded") class AggregateError(NovaException): msg_fmt = _("Aggregate %(aggregate_id)s: action '%(action)s' " "caused an error: %(reason)s.") class AggregateNotFound(NotFound): msg_fmt = _("Aggregate %(aggregate_id)s could not be found.") class AggregateNameExists(NovaException): msg_fmt = _("Aggregate %(aggregate_name)s already exists.") class AggregateHostNotFound(NotFound): msg_fmt = _("Aggregate %(aggregate_id)s has no host %(host)s.") class AggregateMetadataNotFound(NotFound): msg_fmt = _("Aggregate %(aggregate_id)s has no metadata with " "key %(metadata_key)s.") class AggregateHostExists(NovaException): msg_fmt = _("Aggregate %(aggregate_id)s already has host %(host)s.") class FlavorCreateFailed(NovaException): msg_fmt = _("Unable to create flavor") class InstancePasswordSetFailed(NovaException): msg_fmt = _("Failed to set admin password on %(instance)s " "because %(reason)s") safe = True class InstanceNotFound(NotFound): ec2_code = 'InvalidInstanceID.NotFound' msg_fmt = _("Instance %(instance_id)s could not be found.") class InstanceInfoCacheNotFound(NotFound): msg_fmt = _("Info cache for instance %(instance_uuid)s could not be " "found.") class NodeNotFound(NotFound): msg_fmt = _("Node %(node_id)s could not be found.") class NodeNotFoundByUUID(NotFound): msg_fmt = _("Node with UUID %(node_uuid)s could not be found.") class MarkerNotFound(NotFound): msg_fmt = _("Marker %(marker)s could not be found.") class InvalidInstanceIDMalformed(Invalid): msg_fmt = _("Invalid id: %(instance_id)s (expecting \"i-...\")") ec2_code = 'InvalidInstanceID.Malformed' class InvalidVolumeIDMalformed(Invalid): msg_fmt = _("Invalid id: %(volume_id)s (expecting \"i-...\")") ec2_code = 'InvalidVolumeID.Malformed' class CouldNotFetchImage(NovaException): msg_fmt = _("Could not fetch image %(image_id)s") class CouldNotUploadImage(NovaException): msg_fmt = _("Could not upload image %(image_id)s") class TaskAlreadyRunning(NovaException): msg_fmt = _("Task %(task_name)s is already running on host %(host)s") class TaskNotRunning(NovaException): msg_fmt = _("Task %(task_name)s is not running on host %(host)s") class InstanceIsLocked(InstanceInvalidState): msg_fmt = _("Instance %(instance_uuid)s is locked") class ConfigDriveInvalidValue(Invalid): msg_fmt = _("Invalid value for Config Drive option: %(option)s") class ConfigDriveMountFailed(NovaException): msg_fmt = _("Could not mount vfat config drive. %(operation)s failed. " "Error: %(error)s") class ConfigDriveUnknownFormat(NovaException): msg_fmt = _("Unknown config drive format %(format)s. Select one of " "iso9660 or vfat.") class InterfaceAttachFailed(Invalid): msg_fmt = _("Failed to attach network adapter device to " "%(instance_uuid)s") class InterfaceDetachFailed(Invalid): msg_fmt = _("Failed to detach network adapter device from " "%(instance_uuid)s") class InstanceUserDataTooLarge(NovaException): msg_fmt = _("User data too large. User data must be no larger than " "%(maxsize)s bytes once base64 encoded. Your data is " "%(length)d bytes") class InstanceUserDataMalformed(NovaException): msg_fmt = _("User data needs to be valid base 64.") class UnexpectedTaskStateError(NovaException): msg_fmt = _("Unexpected task state: expecting %(expected)s but " "the actual state is %(actual)s") class UnexpectedDeletingTaskStateError(UnexpectedTaskStateError): pass class InstanceActionNotFound(NovaException): msg_fmt = _("Action for request_id %(request_id)s on instance" " %(instance_uuid)s not found") class InstanceActionEventNotFound(NovaException): msg_fmt = _("Event %(event)s not found for action id %(action_id)s") class UnexpectedVMStateError(NovaException): msg_fmt = _("Unexpected VM state: expecting %(expected)s but " "the actual state is %(actual)s") class CryptoCAFileNotFound(FileNotFound): msg_fmt = _("The CA file for %(project)s could not be found") class CryptoCRLFileNotFound(FileNotFound): msg_fmt = _("The CRL file for %(project)s could not be found") class InstanceRecreateNotSupported(Invalid): msg_fmt = _('Instance recreate is not supported.') class ServiceGroupUnavailable(NovaException): msg_fmt = _("The service from servicegroup driver %(driver)s is " "temporarily unavailable.") class DBNotAllowed(NovaException): msg_fmt = _('%(binary)s attempted direct database access which is ' 'not allowed by policy') class UnsupportedVirtType(Invalid): msg_fmt = _("Virtualization type '%(virt)s' is not supported by " "this compute driver") class UnsupportedHardware(Invalid): msg_fmt = _("Requested hardware '%(model)s' is not supported by " "the '%(virt)s' virt driver") class Base64Exception(NovaException): msg_fmt = _("Invalid Base 64 data for file %(path)s") class BuildAbortException(NovaException): msg_fmt = _("Build of instance %(instance_uuid)s aborted: %(reason)s") class RescheduledException(NovaException): msg_fmt = _("Build of instance %(instance_uuid)s was re-scheduled: " "%(reason)s") class ShadowTableExists(NovaException): msg_fmt = _("Shadow table with name %(name)s already exists.") class InstanceFaultRollback(NovaException): def __init__(self, inner_exception=None): message = _("Instance rollback performed due to: %s") self.inner_exception = inner_exception super(InstanceFaultRollback, self).__init__(message % inner_exception) class UnsupportedObjectError(NovaException): msg_fmt = _('Unsupported object type %(objtype)s') class OrphanedObjectError(NovaException): msg_fmt = _('Cannot call %(method)s on orphaned %(objtype)s object') class IncompatibleObjectVersion(NovaException): msg_fmt = _('Version %(objver)s of %(objname)s is not supported') class ReadOnlyFieldError(NovaException): msg_fmt = _('Cannot modify readonly field %(field)s') class ObjectActionError(NovaException): msg_fmt = _('Object action %(action)s failed because: %(reason)s') class ObjectFieldInvalid(NovaException): msg_fmt = _('Field %(field)s of %(objname)s is not an instance of Field') class CoreAPIMissing(NovaException): msg_fmt = _("Core API extensions are missing: %(missing_apis)s") class AgentError(NovaException): msg_fmt = _('Error during following call to agent: %(method)s') class AgentTimeout(AgentError): msg_fmt = _('Unable to contact guest agent. ' 'The following call timed out: %(method)s') class AgentNotImplemented(AgentError): msg_fmt = _('Agent does not support the call: %(method)s') class InstanceGroupNotFound(NotFound): msg_fmt = _("Instance group %(group_uuid)s could not be found.") class InstanceGroupIdExists(NovaException): msg_fmt = _("Instance group %(group_uuid)s already exists.") class InstanceGroupMetadataNotFound(NotFound): msg_fmt = _("Instance group %(group_uuid)s has no metadata with " "key %(metadata_key)s.") class InstanceGroupMemberNotFound(NotFound): msg_fmt = _("Instance group %(group_uuid)s has no member with " "id %(instance_id)s.") class InstanceGroupPolicyNotFound(NotFound): msg_fmt = _("Instance group %(group_uuid)s has no policy %(policy)s.") class PluginRetriesExceeded(NovaException): msg_fmt = _("Number of retries to plugin (%(num_retries)d) exceeded.") class ImageDownloadModuleError(NovaException): msg_fmt = _("There was an error with the download module %(module)s. " "%(reason)s") class ImageDownloadModuleMetaDataError(ImageDownloadModuleError): msg_fmt = _("The metadata for this location will not work with this " "module %(module)s. %(reason)s.") class ImageDownloadModuleNotImplementedError(ImageDownloadModuleError): msg_fmt = _("The method %(method_name)s is not implemented.") class ImageDownloadModuleConfigurationError(ImageDownloadModuleError): msg_fmt = _("The module %(module)s is misconfigured: %(reason)s.") class ResourceMonitorError(NovaException): msg_fmt = _("Error when creating resource monitor: %(monitor)s") class PciDeviceWrongAddressFormat(NovaException): msg_fmt = _("The PCI address %(address)s has an incorrect format.") class PciDeviceInvalidAddressField(NovaException): msg_fmt = _("Invalid PCI Whitelist: " "The PCI address %(address)s has an invalid %(field)s.") class PciDeviceInvalidDeviceName(NovaException): msg_fmt = _("Invalid PCI Whitelist: " "The PCI whitelist can specify devname or address," " but not both") class PciDeviceNotFoundById(NotFound): msg_fmt = _("PCI device %(id)s not found") class PciDeviceNotFound(NovaException): msg_fmt = _("PCI Device %(node_id)s:%(address)s not found.") class PciDeviceInvalidStatus(NovaException): msg_fmt = _( "PCI device %(compute_node_id)s:%(address)s is %(status)s " "instead of %(hopestatus)s") class PciDeviceInvalidOwner(NovaException): msg_fmt = _( "PCI device %(compute_node_id)s:%(address)s is owned by %(owner)s " "instead of %(hopeowner)s") class PciDeviceRequestFailed(NovaException): msg_fmt = _( "PCI device request (%requests)s failed") class PciDevicePoolEmpty(NovaException): msg_fmt = _( "Attempt to consume PCI device %(compute_node_id)s:%(address)s " "from empty pool") class PciInvalidAlias(NovaException): msg_fmt = _("Invalid PCI alias definition: %(reason)s") class PciRequestAliasNotDefined(NovaException): msg_fmt = _("PCI alias %(alias)s is not defined") class MissingParameter(NovaException): ec2_code = 'MissingParameter' msg_fmt = _("Not enough parameters: %(reason)s") code = 400 class PciConfigInvalidWhitelist(Invalid): msg_fmt = _("Invalid PCI devices Whitelist config %(reason)s") class PciTrackerInvalidNodeId(NovaException): msg_fmt = _("Cannot change %(node_id)s to %(new_node_id)s") # Cannot be templated, msg needs to be constructed when raised. class InternalError(NovaException): ec2_code = 'InternalError' msg_fmt = "%(err)s" class PciDevicePrepareFailed(NovaException): msg_fmt = _("Failed to prepare PCI device %(id)s for instance " "%(instance_uuid)s: %(reason)s") class PciDeviceDetachFailed(NovaException): msg_fmt = _("Failed to detach PCI device %(dev)s: %(reason)s") class PciDeviceUnsupportedHypervisor(NovaException): msg_fmt = _("%(type)s hypervisor does not support PCI devices") class KeyManagerError(NovaException): msg_fmt = _("Key manager error: %(reason)s") class VolumesNotRemoved(Invalid): msg_fmt = _("Failed to remove volume(s): (%(reason)s)") class InvalidVideoMode(Invalid): msg_fmt = _("Provided video model (%(model)s) is not supported.") class RngDeviceNotExist(Invalid): msg_fmt = _("The provided RNG device path: (%(path)s) is not " "present on the host.") class RequestedVRamTooHigh(NovaException): msg_fmt = _("The requested amount of video memory %(req_vram)d is higher " "than the maximum allowed by flavor %(max_vram)d.") class InvalidWatchdogAction(Invalid): msg_fmt = _("Provided watchdog action (%(action)s) is not supported.") class LiveMigrationWithOldNovaNotSafe(NovaException): msg_fmt = _("Host %(server)s is running an old version of Nova, " "live migrations involving that version may cause data loss. " "Upgrade Nova on %(server)s and try again.") class UnshelveException(NovaException): msg_fmt = _("Error during unshelve instance %(instance_id)s: %(reason)s") class ImageVCPULimitsRangeExceeded(Invalid): msg_fmt = _("Image vCPU limits %(sockets)d:%(cores)d:%(threads)d " "exceeds permitted %(maxsockets)d:%(maxcores)d:%(maxthreads)d") class ImageVCPUTopologyRangeExceeded(Invalid): msg_fmt = _("Image vCPU topology %(sockets)d:%(cores)d:%(threads)d " "exceeds permitted %(maxsockets)d:%(maxcores)d:%(maxthreads)d") class ImageVCPULimitsRangeImpossible(Invalid): msg_fmt = _("Requested vCPU limits %(sockets)d:%(cores)d:%(threads)d " "are impossible to satisfy for vcpus count %(vcpus)d") class InvalidArchitectureName(Invalid): msg_fmt = _("Architecture name '%(arch)s' is not recognised") class ImageNUMATopologyIncomplete(Invalid): msg_fmt = _("CPU and memory allocation must be provided for all " "NUMA nodes") class ImageNUMATopologyForbidden(Invalid): msg_fmt = _("Image property '%(name)s' is not permitted to override " "NUMA configuration set against the flavor") class ImageNUMATopologyAsymmetric(Invalid): msg_fmt = _("Asymmetric NUMA topologies require explicit assignment " "of CPUs and memory to nodes in image or flavor") class ImageNUMATopologyCPUOutOfRange(Invalid): msg_fmt = _("CPU number %(cpunum)d is larger than max %(cpumax)d") class ImageNUMATopologyCPUDuplicates(Invalid): msg_fmt = _("CPU number %(cpunum)d is assigned to two nodes") class ImageNUMATopologyCPUsUnassigned(Invalid): msg_fmt = _("CPU number %(cpuset)s is not assigned to any node") class ImageNUMATopologyMemoryOutOfRange(Invalid): msg_fmt = _("%(memsize)d MB of memory assigned, but expected " "%(memtotal)d MB") class InvalidHostname(Invalid): msg_fmt = _("Invalid characters in hostname '%(hostname)s'") class NumaTopologyNotFound(NotFound): msg_fmt = _("Instance %(instance_uuid)s does not specify a NUMA topology") class SocketPortRangeExhaustedException(NovaException): msg_fmt = _("Not able to acquire a free port for %(host)s") class SocketPortInUseException(NovaException): msg_fmt = _("Not able to bind %(host)s:%(port)d, %(error)s") class ImageSerialPortNumberInvalid(Invalid): msg_fmt = _("Number of serial ports '%(num_ports)s' specified in " "'%(property)s' isn't valid.") class ImageSerialPortNumberExceedFlavorValue(Invalid): msg_fmt = _("Forbidden to exceed flavor value of number of serial " "ports passed in image meta.") class InvalidImageConfigDrive(Invalid): msg_fmt = _("Image's config drive option '%(config_drive)s' is invalid")
jumpstarter-io/nova
nova/exception.py
Python
apache-2.0
49,700
# Copyright (c) 2019 Ericsson # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. from tempest.lib.services.network import base class QosMinimumBandwidthRulesClient(base.BaseNetworkClient): def create_minimum_bandwidth_rule(self, qos_policy_id, **kwargs): """Creates a minimum bandwidth rule for a QoS policy. For full list of available parameters, please refer to the official API reference: https://docs.openstack.org/api-ref/network/v2/index.html#create-minimum-bandwidth-rule """ uri = '/qos/policies/%s/minimum_bandwidth_rules' % qos_policy_id post_data = {'minimum_bandwidth_rule': kwargs} return self.create_resource(uri, post_data) def update_minimum_bandwidth_rule(self, qos_policy_id, rule_id, **kwargs): """Updates a minimum bandwidth rule. For full list of available parameters, please refer to the official API reference: https://docs.openstack.org/api-ref/network/v2/index.html#update-minimum-bandwidth-rule """ uri = '/qos/policies/%s/minimum_bandwidth_rules/%s' % ( qos_policy_id, rule_id) post_data = {'minimum_bandwidth_rule': kwargs} return self.update_resource(uri, post_data) def show_minimum_bandwidth_rule(self, qos_policy_id, rule_id, **fields): """Show details of a minimum bandwidth rule. For full list of available parameters, please refer to the official API reference: https://docs.openstack.org/api-ref/network/v2/index.html#show-minimum-bandwidth-rule-details """ uri = '/qos/policies/%s/minimum_bandwidth_rules/%s' % ( qos_policy_id, rule_id) return self.show_resource(uri, **fields) def delete_minimum_bandwidth_rule(self, qos_policy_id, rule_id): """Deletes a minimum bandwidth rule for a QoS policy. For full list of available parameters, please refer to the official API reference: https://docs.openstack.org/api-ref/network/v2/index.html#delete-minimum-bandwidth-rule """ uri = '/qos/policies/%s/minimum_bandwidth_rules/%s' % ( qos_policy_id, rule_id) return self.delete_resource(uri) def list_minimum_bandwidth_rules(self, qos_policy_id, **filters): """Lists all minimum bandwidth rules for a QoS policy. For full list of available parameters, please refer to the official API reference: https://docs.openstack.org/api-ref/network/v2/index.html#list-minimum-bandwidth-rules-for-qos-policy """ uri = '/qos/policies/%s/minimum_bandwidth_rules' % qos_policy_id return self.list_resources(uri, **filters)
masayukig/tempest
tempest/lib/services/network/qos_minimum_bandwidth_rules_client.py
Python
apache-2.0
3,226